Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Nucleic Acid > Bis(3',5')-cyclic diguanylic acid

Bis(3',5')-cyclic diguanylic acid

Bis(3',5')-cyclic diguanylic acid is a signaling molecule involved in bacterial cell-cell communication and biofilm formation.
It is a cyclic dinucleotide composed of two guanosine moieties linked by 3',5'-phosphodiester bonds.
This secondd messenger plays a crucial role in prokaryotic physiology and is an important target for antimicrobial drug development.
PubCompare.ai's AI-driven platform can help researchers optimize protocols and enhance reproducibility for studies on this key biological compuond.

Most cited protocols related to «Bis(3',5')-cyclic diguanylic acid»

1
Construction and Validation of ΔSA0701 Mutant
Based on the S. aureus N315 genome database, the sequence of SA0701 (Bfd1, GdpS), which carries the GGDEF motif, was identified (Tu Quoc et al., 2007 (link); Holland et al., 2008 (link);). A 0.65-kb N-terminal fragment of the gene for SA0701 was amplified with a forward primer TGCACTGCAGACCATTTATTCACCTTCATC and a reverse primer GGGGTACCATAACAATCAACGTAACACC, and a 0.72-kb C-terminal fragment was amplified with a forward primer ACGCGTCGACAAGGGCGAAACAAAGTAATG and a reverse primer ACGCGTCGACAAGGGCGAAACAAAGTAATG. The two PCR products were digested with the relevant restriction enzymes, and the N-terminal fragment was inserted into the PstI–KpnI site and the C-terminal fragment was inserted into the SalI–HindIII site of pYT3 (kindly provided by Hiramatsu, Juntendo University, Tokyo). The resulting plasmid pYT3ΔSA0701 was transformed into S. aureus MS2507 as described previously (Schen & Laddaga, 1992 (link)). The transformants were selected with the tetracycline resistance phenotype at 42 °C to isolate a ΔSA0701 mutant through a double-crossover recombination. The inactivation of the gene for SA0701 was verified using PCR, followed by DNA sequencing (data not shown).
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
DNA Restriction Enzymes Genes, vif Gene Silencing Genome Guanosine Diphosphate Oligonucleotide Primers Phenotype Plasmids Recombination, Genetic
2
Pathogenic Bacterial Strains for Biofilm Research
Pseudomonas aeruginosa strain PAO1 and S. aureus strain MS2507 were used in this study. Staphylococcus aureus MS2507 was isolated from the blood culture of a patient and was a highly biofilm-forming strain. These strains were cultured in tryptic soy broth (TSB), Luria–Bertani (LB; 1% Bacto tryptone, 0.5% Bacto yeast extract, pH 7.2% and 1.0% NaCl) or on LB agar plates overnight at 37 °C before use.
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
Agar Biofilms Blood Culture Patients Pseudomonas aeruginosa Sodium Chloride Staphylococcus aureus Staphylococcus aureus Infection Strains tryptic soy broth Yeasts
3
Quantifying Biofilm Formation with Crystal Violet
Quantification of biofilm formation by MS2507, MS2507ΔSA0701 and PAO1 was performed using a crystal violet staining method (Karaolis et al., 2005 ) with some modifications. Bacteria were precultured on LB agar plates at 37 °C overnight. Culture conditions for biofilm formation were LB for PAO1 and TSB for MS2507 and MS2507ΔSA0701 at 30 °C 12-h static culture. The media for biofilm formation were supplemented with various concentrations of synthetic cyclic-di-GMP and its analogs. A single colony was inoculated into 4 mL of LB or TSB and incubated at 37 °C with constant shaking at 160 r.p.m. until late logarithmic stage. The culture was then diluted 1 : 104 with fresh LB or TSB supplemented with various concentrations of cyclic-di-GMP and its analogs and a 200 μL of the diluted cultures was transferred into round-bottom wells of a polystyrene microtiter plate (Iwaki, Tokyo, Japan). The microtiter plate was incubated statically at 30 °C for 12 h. The supernatant was then discarded and the wells were washed three times with 200 μL of phosphate-buffered saline. After the wells were dried, 200 μL of 0.1% crystal violet was added and the wells were stained at room temperature for 15 min. The wells were then washed three times with distilled water to remove the extra dye and dried. The dye staining the biofilm in each well was extracted with 200 μL of dimethyl sulfoxide and the OD570 nm was measured with a plate reader (Tecan Austria GmbH, Austria). These experiments were repeated at least three times, and the results were expressed as the mean values ± SD. P-values for significance were calculated by the Student t-test.
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
Agar Bacteria Biofilms bis(3',5')-cyclic diguanylic acid Phosphates Polystyrenes Saline Solution Student Sulfoxide, Dimethyl Violet, Gentian
4
Quantifying Biofilm Formation under Cyclic-di-GMP Influence
PAO1 and MS2507 were prepared in the same way as those described in the quantification assay of the biofilm. Freshly prepared bacterial solutions were inoculated into 2 mL of LB for PAO1 and TSB for MS2507 supplemented with various concentrations of cyclic-di-GMP or its analogs in glass-based dishes (coverslip diameter 27 mm, Iwaki) and were incubated statically at 30 °C for 15 h for PAO1 and 9 h for MS2507. The culture supernatant was discarded and the dishes were carefully rinsed three times with 0.85% NaCl and viability staining of unfixed biofilms was performed using BacLight Live/Dead kit (L-7012, Molecular Probes) according to the manufacturer's recommendations to visualize biofilms. The biofilms attached on the polyethyleneimine-coated glass dishes (Iwaki) were observed at × 400 magnification using a confocal laser scanning microscope (LSM5 Pascal, Carl Zeiss Co. Ltd). Images were acquired at a 1-μm interval through the biofilms and five image stacks, each representing a different field of view, and were compiled from at least two independent experiments. The image stacks were analyzed using the comstat program (Heydorn et al., 2000 (link)) and the following parameters were obtained: total biomass; mean thickness, the mean height of the biofilm; maximum thickness; roughness coefficient, a measure of how much the thickness of the biofilm varies; and surface-to-volume ratio, an estimate of the portion of the biofilm exposed to nutrients.
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
Bacteria Biofilms Biological Assay bis(3',5')-cyclic diguanylic acid Hyperostosis, Diffuse Idiopathic Skeletal Microscopy, Confocal, Laser Scanning Molecular Probes Nutrients Polyethyleneimine Sodium Chloride
5
Synthesis and Characterization of Cyclic-di-GMP Analogs
Cyclic-di-GMP and its analogs were chemically synthesized as described previously (Hayakawa et al., 2003 ; Hyodo et al., 2006 ;). Cyclic-di-GMP analogs used in this study were cyclic bis(3′–5′)guanylic/adenylic acid (cyclic-GpAp or c-GpAp), cyclic bis(3′–5′)guanylic/inosinic acid (cyclic-GpIp or c-GpIp) and monophosphorothioic acid of cyclic-di-GMP (cyclic-GpGps or c-GpGps) (Hyodo et al., 2006 ). The structures of these compounds are shown in Fig. 1. These compounds were dissolved in 0.85% NaCl for use.
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
Acids bis(3',5')-cyclic diguanylic acid Guanosine Monophosphate Inosine Monophosphate Sodium Chloride

Most recents protocols related to «Bis(3',5')-cyclic diguanylic acid»

1
Insights into Cellulose Biosynthesis Regulation
Not available on PMC !

Example 2

Comparing the structures of the c-di-GMP-activated and resting states of the BcsA-B complex, at intermediate states during cellulose translocation provides unique insights into the mechanism of cellulose biosynthesis. In the absence of c-di-GMP, BcsA is catalytically inactive and its gating loop blocks the entrance to the active site23,27. Allosteric activation by c-di-GMP displaces the gating loop from the active site, thereby forming a large opening towards the substrate-binding pocket, wide enough for substrate diffusion. However, opening and closing the active site is unlikely to be the only function of BcsA's gating loop. When UDP binds to the active site, the gating loop inserts deeply into the catalytic pocket and coordinates the nucleotide via conserved residues. Most likely, this also reflects how BcsA interacts with its substrate UDP-Glc, positioning it for catalysis, excluding water from the active site and perhaps also stabilizing the UDP leaving group during glycosyl transfer. A similar mechanism of substrate-dependent loop insertion and de-insertion has been described for non-processive galactosyltransferases38,39.

The functional importance of the gating loop is further underlined by its sequence homology with the location of the isoxaben resistance mutation in Arabidopsis thaliana cellulose synthase 3 (Example 2, Supplementary FIG. 3a). Here, Thr942 of the “FxVTxK” motif is mutated to Ile, thereby allowing growth in the presence of the herbicide isoxaben40. However, because pro- and eukaryotic cellulose synthases differ in their predicted TM topologies28, further experimental analyses are required to confirm a similar eukaryotic gating loop function.

UDP, the second reaction product of many GTs24,41, competitively inhibits BcsA, which has also been observed for hyaluronan synthases23,42. BcsA binds UDP and UDP-Glc with similar affinities23, however, the large excess of UDP-Glc over UDP under physiological conditions would favor substrate binding upon gating loop opening43. Presumably during or after UDP-Glc binding, the gating loop inserts into the active site to initiate catalysis. Following glycosyl transfer and with the newly extended glucan at the active site, the gating loop may retract from the GT domain, thereby allowing UDP to UDP-Glc exchange. Because the gating loop undergoes its full range of motion in the presence of c-di-GMP, it is likely that the allosteric activator remains bound during catalysis. In vivo, c-di-GMP-stimulated cellulose biosynthesis may terminate upon depletion of the activator, whose cytosolic concentration is in turn controlled by the synergy of diguanylate cyclases and diesterases1.

The BcsA-B complex contains a translocating cellulose polymer that spans the distance from the GT domain to the periplasmic BcsA-B interface. In the c-di-GMP activated structure, the polymer's acceptor terminus rests at the entrance to the TM channel, one glucose unit further into the pore compared to its position in the absence of c-di-GMP27. Thus, while our previously reported structure likely represents a state post glycosyl transfer but prior to translocation, the c-di-GMP-activated BcsA-B structure is consistent with a state after polymer translocation. Cellulose translocation may be accomplished by BcsA's finger helix, which hydrogen bonds with the acceptor glucose and pivots towards the TM channel entrance in the c-di-GMP-activated complex. In this position, Asp343 of the finger helix is at an ideal distance to facilitate catalysis. Perhaps the finger helix returns to the “down” position after glycosyl transfer to interact with the new polymer terminus A similar mechanism involving a flexible loop or helical domain has been postulated for the processive translocation of unfolded polypeptide chains44,45.

C-di-GMP stimulates the biosynthesis of several extracellular polysaccharides important for biofilm formation, including alginate and PNAG46-48. While the mechanism for activating PNAG biosynthesis most likely differs from BcsA48, alginate and cellulose synthases share a strikingly similar organization49. Alginate is a major component of Pseudomonas aeruginosa biofilms in the respiratory tract of cystic fibrosis patients18,49. In contrast to BcsA-B, the alginate synthase's c-di-GMP-binding PilZ domain is located at the intracellular N terminus of Alg44, the non-catalytic subunit that resembles BcsB and likely interacts with the catalytic Alg8 subunit. Thus, c-di-GMP could exert control by a similar mechanism in alginate synthase as revealed for bacterial cellulose synthase.

Our analyses provide the first insights into how enzymatic functions can be modulated by c-di-GMP. A detailed mechanistic characterization of this bacterial signaling system is required for the development of novel anti-microbial therapeutics.

  • 1. Römling, U., Galperin, M. Y. & Gomelsky, M. Cyclic di-GMP: the First 25 Years of a Universal Bacterial Second Messenger. Microbiol. Mol. Biol. Rev. 77, 1-52 (2013).
  • 2. Gloag, E. S., Turnbull, L., Huang, A., Vallotton, P., Wang, H., Nolan, L. M., Mililli, L., Hunt, C., Lu, J., Osvath, S. R., Monahan, L. G., Cavaliere, R., Charles, I. G., Wand, M. P., Gee, M. L., Prabhakar, R. & Whitchurch, C. B. Self-organization of bacterial biofilms is facilitated by extracellular DNA. Proc. Natl. Acad. Sci. USA 110, 11541-11546 (2013).
  • 3. McCrate, O. A., Zhou, X., Reichhardt, C. & Cegelski, L. Sum of the parts: composition and architecture of the bacterial extracellular matrix. J. Mol. Biol. 425, 4286-4294 (2013).
  • 4. Wilking, J. N., Zaburdaev, V., De Volder, M., Losick, R., Brenner, M. P. & Weitz, D. A. Liquid transport facilitated by channels in Bacillus subtilis biofilms. Proc. Natl. Acad. Sci. USA 110, 848-852 (2013).
  • 5. Stewart, P. S. & Costerton, J. W. Antibiotic resistance of bacteria in biofilms. Lancet 358, 135-138 (2001).
  • 6. Romling, U. & Balsalobre, C. Biofilm infections, their resilience to therapy and innovative treatment strategies. J. Intern. Med. 272, 541-561 (2012).
  • 7. Pritt, B., O'Brien, L. & Winn, W. Mucoid Pseudomonas in cystic fibrosis. Am. J. Clin. Pathol. 128, 32-34 (2007).
  • 8. Gomes, F., Teixeira, P. & Oliveira, R. Mini-review: Staphylococcus epidermidis as the most frequent cause of nosocomial infections: old and new fighting strategies. Biofouling 30, 131-141 (2014).
  • 9. Cotter, P. A. & Stibitz, S. c-di-GMP-mediated regulation of virulence and biofilm formation. Curr. Op. Microbiol. 10, 17-23 (2007).
  • 10. Ross, P., Weinhouse, H., Aloni, Y., Michaeli, D., Weinberger-Ohana, P., Mayer, R., Braun, S., de Vroom, E., van der Marel, G. A., van Boom, J. H. & Benziman, M. Regulation of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. Nature 325, 279-281 (1987).
  • 11. Zogaj, X., Bokranz, W., Nimtz, M. & Römling, U. Production of cellulose and curli fimbriae by members of the family Enterobacteriaceae isolated from the human gastrointestinal tract. Infect. Immun. 71, 4151-4158 (2003).
  • 12. Zhang, Z., Kim, S., Gaffney, B. L. & Jones, R. A. Polymorphism of the signaling molecule c-di-GMP. J. Am. Chem. Soc. 128, 7015-7024 (2006).
  • 13. Gentner, M., Allan, M. G., Zaehringer, F., Schirmer, T. & Grzesiek, S. Oligomer formation of the bacterial second messenger c-di-GMP: reaction rates and equilibrium constants indicate a monomeric state at physiological concentrations. J. Am. Chem. Soc. 134, 1019-1029 (2012).
  • 14. Christen, M., Christen, B., Allan, M. G., Folcher, M., Jeno, P., Grzesiek, S. & Jenal, U. DgrA is a member of a new family of cyclic diguanosine monophosphate receptors and controls flagellar motor function in Caulobacter crescentus. Proc. Natl. Acad. Sci. USA 104, 4112-4117 (2007).
  • 15. Amikam, D. & Galperin, M. Y. PilZ domain is part of the bacterial c-di-GMP binding protein. Bioinformatics 22, 3-6 (2006).
  • 16. Ko, J., Ryu, K. S., Kim, H., Shin, J. S., Lee, J. O., Cheong, C. & Choi, B. S. Structure of PP4397 reveals the molecular basis for different c-di-GMP binding modes by Pilz domain proteins. J. Mol. Biol. 398, 97-110 (2010).
  • 17. Benach, J., Swaminathan, S. S., Tamayo, R., Handelman, S. K., Folta-Stogniew, E., Ramos, J. E., Forouhar, F., Neely, H., Seetharaman, J., Camilli, A. & Hunt, J. F. The structural basis of cyclic diguanylate signal transduction by PilZ domains. EMBO J. 26, 5153-5166 (2007).
  • 18. Hay, I. D., Ur Rehman, Z., Moradali, M. F., Wang, Y. & Rehm, B. H. Microbial alginate production, modification and its applications. Microb. Biotechnol. 6, 637-650 (2013).
  • 19. Hay, I. D., Wang, Y., Moradali, M. F., Rehman, Z. U. & Rehm, B. H. Genetics and regulation of bacterial alginate production. Environ Microbiol (2014).
  • 20. Whitney, J. C. & Howell, P. L. Synthase-dependent exopolysaccharide secretion in Gram-negative bacteria. Trends Microbiol. 21, 63-72 (2013).
  • 21. Wang, X., Preston, J. F. r. & Romeo, T. The pgaABCD locus of Escherichia coli promotes the synthesis of a polysaccharide adhesin required for biofilm formation. J. Bacteriol. 186, 2724-2734 (2004).
  • 22. Merzendorfer, H. Insect chitin synthases: a review. J Comp Physiol B, Biochem Syst Environ Physiol 176, 1-15 (2006).
  • 23. Omadjela, O., Narahari, A., Strumillo, J., Melida, H., Mazur, O., Bulone, V. & Zimmer, J. BcsA and BcsB form the catalytically active core of bacterial cellulose synthase sufficient for in vitro cellulose synthesis. Proc. Natl. Acad. Sci. USA 110, 17856-17861 (2013).
  • 24. Brown, C., Leijon, F. & Bulone, V. Radiometric and spectrophotometric in vitro assays of glycosyltransferases involved in plant cell wall carbohydrate biosynthesis. Nat Protoc 7, 1634-1650 (2012).
  • 25. Mayer, R., Ross, P., Weinhouse, H., Amikam, D., Volman, G., Ohana, P., Calhoon, R. D., Wong, H. C., Emerick, A. W. & Benziman, M. Polypeptide composition of bacterial cyclic diguanylic acid-dependent cellulose synthase and the occurrence of immunologically crossreacting proteins in higher plants. Proc. Natl. Acad. Sci. USA 88, 5472-5476 (1991).
  • 26. Saxena, I. M., Kudlicka, K., Okuda, K. & Brown, R. M. Characterization of genes in the cellulose-synthesizing operon (acs operon) of Acetobacter xylinum: implications for cellulose crystallization. J. Bacteriol. 176, 5735-5752 (1994).
  • 27. Morgan, J. L., Strumillo, J. & Zimmer, J. Crystallographic snapshot of cellulose synthesis and membrane translocation. Nature 493, 181-186 (2013).
  • 28. Slabaugh, E., Davis, J. K., Haigler, C. H., Yingling, Y. G. & Zimmer, J. Cellulose synthases: new insights from crystallography and modeling. Trends Plant. Sci. (2013).
  • 29. Cantarel, B. L., Coutinho, P. M., Rancurel, C. & Bernard, T. The Carbohydrate-Active EnZymes database (CAZy): an expert resource for Glycogenomics. Nucleic Acids Res. 37, D233-8 (2009).
  • 30. Hubbard, C., McNamara, J. T., Azumaya, C., Patel, M. S. & Zimmer, J. The hyaluronan synthase catalyzes the synthesis and membrane translocation of hyaluronan. J. Mol. Biol. 418, 21-31 (2012).
  • 31. Merighi, M., Lee, V. T., Hyodo, M., Hayakawa, Y. & Lory, S. The second messenger bis-(3′-5′)-cyclic-GMP and its PilZ domain-containing receptor Alg44 are required for alginate biosynthesis in Pseudomonas aeruginosa. Mol. Microbiol. 65, 876-895 (2007).
  • 32. Faham, S. & Bowie, J. U. Bicelle crystallization: a new method for crystallizing membrane proteins yields a monomeric bacteriorhodopsin structure. J. Mol. Biol. 316, 1-6 (2002).
  • 33. Faham, S., Boulting, G. L., Massey, E. A., Yohannan, S., Yang, D. & Bowie, J. U. Crystallization of bacteriorhodopsin from bicelle formulations at room temperature. Protein Science 14, 836-840 (2005).
  • 34. Fujiwara, T., Komoda, K., Sakurai, N., Tajima, K., Tanaka, I. & Yao, M. The c-di-GMP recognition mechanism of the PilZ domain of bacterial cellulose synthase subunit A. Biochem. Biophys. Res. Commun. 431, 802-807 (2013).
  • 35. Aloni, Y., Delmer, D. P. & Benziman, M. Achievement of high rates of in vitro synthesis of 1,4-beta-D-glucan: activation by cooperative interaction of the Acetobacter xylinum enzyme system with GTP, polyethylene glycol, and a protein factor. Proc. Natl. Acad. Sci. USA 79, 6448-6452 (1982).
  • 36. Kumari, M., Sunoj, R. B. & Balaji, P. V. Exploration of CH . . . π mediated stacking interactions in saccharide: aromatic residue complexes through conformational sampling. Carbohydr. Res. 361, 133-140 (2012).
  • 37. Faham, S., Watanabe, A., Besserer, G. M., Cascio, D., Specht, A., Hirayama, B. A., Wright, E. M. & Abramson, J. The crystal structure of a sodium galactose transporter reveals mechanistic insights into Na+/sugar symport. Science 321, 810-814 (2008).
  • 38. Qasba, P. K., Ramakrishnan, B. & Boeggeman, E. Structure and Function of β-1,4-Galactosyltransferase. Curr. Drug Targets 4, 292-309 (2008).
  • 39. Ramakrishnan, B., Ramasamy, V. & Qasba, P. K. Structural snapshots of beta-1,4-galactosyltransferase-I along the kinetic pathway. J. Mol. Biol. 357, 1619-1633 (2006).
  • 40. Scheible, W. R., Eshed, R., Richmond, T., Delmer, D. & Somerville, C. Modifications of cellulose synthase confer resistance to isoxaben and thiazolidinone herbicides in Arabidopsis Ixr1 mutants. Proc. Natl. Acad. Sci. USA 98, 10079-10084 (2001).
  • 41. Lairson, L. L., Henrissat, B., Davies, G. J. & Withers, S. G. Glycosyltransferases: structures, functions, and mechanisms. Annu. Rev. Biochem. 77, 521-555 (2008).
  • 42. Tlapak-Simmons, V. L., Baron, C. A. & Weigel, P. H. Characterization of the purified hyaluronan synthase from Streptococcus equisimilis. Biochemistry 43, 9234-9242 (2004).
  • 43. Buckstein, M. H., He, J. & Rubin, H. Characterization of nucleotide pools as a function of physiological state in Escherichia coli. J. Bacteriol. 190, 718-726 (2008).
  • 44. Erlandson, K. J., Miller, S. B., Nam, Y., Osborne, A. R., Zimmer, J. & Rapoport, T. A. A role for the two-helix finger of the SecA ATPase in protein translocation. Nature 455, 984-987 (2008).
  • 45. Martin, A., Baker, T. A. & Sauer, R. T. Pore loops of the AAA+ ClpX machine grip substrates to drive translocation and unfolding. Nature Struct. Mol. Biol. 15, 1147-1151 (2008).
  • 46. Rehm, B. H. A. Alginate Production: Precursor Biosynthesis, Polymerization and Secretion. Microbiology Monographs 13, 55-71 (2009).
  • 47. Itoh, Y., Rice, J. D., Goller, C., Pannuri, A., Taylor, J., Meisner, J., Beveridge, T. J., Preston, J. F. r. & Romeo, T. Roles of pgaABCD genes in synthesis, modification, and export of the Escherichia coli biofilm adhesin poly-beta-1,6-N-acetyl-D-glucosamine. J. Bacteriol. 190, 3670-3680 (2008).
  • 48. Steiner, S., Lori, C., Boehm, A. & Jenal, U. Allosteric activation of exopolysaccharide synthesis through cyclic di-GMP-stimulated protein-protein interaction. EMBO J. 32, 354-368 (2013).
  • 49. Keiski, C. L., Harwich, M., Jain, S., Neculai, A. M., Yip, P., Robinson, H., Whitney, J. C., Riley, L., Burrows, L. L., Ohman, D. E. & Howell, P. L. AlgK is a TPR-containing protein and the periplasmic component of a novel exopolysaccharide secretin. Structure 18, 265-273 (2010).
  • 50. Karplus, P. A. & Diederichs, K. Linking crystallographic model and data quality. Science 336, 1030-1033 (2012).
  • 51. Leslie, A. G. The integration of macromolecular diffraction data. Acta Crystallogr. D Biol. Crystallogr. 62, 48-57 (2006).
  • 52. CCP4. The CCP4 suite: programs for protein crystallography. Acta Crystallogr. D Biol. Crystallogr. 50, 760-763 (1994).
  • 53. McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L. C. & Read, R. J. Phaser crystallographic software. J. Appl. Crystallogr. 40, 658-674 (2007).
  • 54. Vagin, A. & Teplyakov, A. Molecular replacement with MOLREP. Acta Crystallogr. D Biol. Crystallogr. 66, 22-25 (2010).
  • 55. Adams, P. D., Afonine, P. V., Bunkoczi, G., Chen, V. B., Davis, I. W., Echols, N., Headd, J. J., Hung, L. W., Kapral, G. J., Grosse-Kunstleve, R. W., McCoy, A. J., Moriarty, N. W., Oeffner, R., Read, R. J., Richardson, D. C., Richardson, J. S., Terwilliger, T. C. & Zwart, P. H. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213-221 (2010).
  • 56. Cowtan, K. Recent developments in classical density modification. Acta Crystallogr. D Biol. Crystallogr. 66, 470-478 (2010).
  • 57. Cowtan, K. D. & Zhang, K. Y. Density modification for macromolecular phase improvement. Prog. Biophys. Mol. Biol. 72, 245-270 (1999).
  • 58. Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126-2132 (2004).
  • 59. Terwilliger, T. C. Using prime-and-switch phasing to reduce model bias in molecular replacement. Acta Crystallogr. D Biol. Crystallogr. 60, 2144-2149 (2004).
  • 60. Painter, J. TLSMD web server for the generation of multi-group TLS models. J. Appl. Cryst. 39, 109-111 (2006).
  • 61. PyMol. The PYMOL Molecular Graphics System. DeLano Scientific (2000).
  • 62. Ho, B. K. & Gruswitz, F. HOLLOW: generating accurate representations of channel and interior surfaces in molecular structures. BMC Struct Biol 8, 49 (2008).
  • 63. Morin, A., Eisenbraun, B., Key, J., Sanschagrin, P. C., Timony, M. A., Ottaviano, M. & Sliz, P. Collaboration gets the most out of software. Elife 2, e01456 (2013).

US09890407B2. Method for synthesizing cellulose in vitro (2018-02-13). University of Virginia Patent Foundation [US], None [US], None [US]. Inventors: Jochen Gottfried Zimmer [US], Jacob Lowell Whitten Morgan [US].
Full text: Click here
Patent 2018
A-Loop Adenosinetriphosphatase Adhesins, Escherichia coli Alginate Anabolism Antibiotic Resistance, Bacterial Arabidopsis Arabidopsis thalianas Bacillus subtilis Bacteria bacterial adhesins, polysaccharide Bacterial Fimbria Bacterial Proteins Bacteriorhodopsins Biofilms Biological Assay bis(3',5')-cyclic diguanylic acid Carbohydrates Cardiac Arrest Catalysis Catalytic Domain Caulobacter crescentus Cellulose cellulose synthase cellulose synthase (cyclic diguanylic acid) Cell Wall Chitin Synthase COMP protocol Cotransport, Ion Crystallization Crystallography Cyclic GMP Cystic Fibrosis Cytosol Diffusion diguanylate cyclase Embryophyta Enterobacteriaceae Enzyme Activation Enzymes Escherichia coli Eukaryotic Cells Extracellular Matrix Family Member Fingers Galactose Galactosyltransferases Gastrointestinal Tract Genes Genetic Polymorphism Genus Loris Glucans Gluconacetobacter xylinus Glucosamine Glucose Glycosyltransferase GMP synthase Gram Negative Bacteria Grasp Helix (Snails) Herbicides Homo sapiens Hyaluronan Synthases Hyaluronic acid Hydrogen Bonds Infection Insecta isoxaben Kinetics Membrane Proteins Membrane Transport Proteins Molecular Structure morin Mutation Nitric Oxide Synthase NOS3 protein, human Nucleic Acids Nucleotides Operon Periplasm Pharmaceutical Preparations physiology Plants Poly A Polyethylene Glycols Polymerization Polymers Polypeptides Polysaccharides Proteins Protein Subunits Protein Translocation Protoplasm Pseudomonas Pseudomonas aeruginosa Python Radiometry Respiratory System REST protein, human Rice Second Messenger Secretin secretion Signal Transduction Sodium Spectrophotometry Staphylococcal Protein A Staphylococcus epidermidis Streptococcus equisimilis Tissue, Membrane Translocation, Chromosomal Virulence xylosylprotein 4-beta-galactosyltransferase
2
Pathogenic Bacterial Strains for Biofilm Research
Pseudomonas aeruginosa strain PAO1 and S. aureus strain MS2507 were used in this study. Staphylococcus aureus MS2507 was isolated from the blood culture of a patient and was a highly biofilm-forming strain. These strains were cultured in tryptic soy broth (TSB), Luria–Bertani (LB; 1% Bacto tryptone, 0.5% Bacto yeast extract, pH 7.2% and 1.0% NaCl) or on LB agar plates overnight at 37 °C before use.
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
Agar Biofilms Blood Culture Patients Pseudomonas aeruginosa Sodium Chloride Staphylococcus aureus Staphylococcus aureus Infection Strains tryptic soy broth Yeasts
3
Quantifying Biofilm Formation with Crystal Violet
Quantification of biofilm formation by MS2507, MS2507ΔSA0701 and PAO1 was performed using a crystal violet staining method (Karaolis et al., 2005 ) with some modifications. Bacteria were precultured on LB agar plates at 37 °C overnight. Culture conditions for biofilm formation were LB for PAO1 and TSB for MS2507 and MS2507ΔSA0701 at 30 °C 12-h static culture. The media for biofilm formation were supplemented with various concentrations of synthetic cyclic-di-GMP and its analogs. A single colony was inoculated into 4 mL of LB or TSB and incubated at 37 °C with constant shaking at 160 r.p.m. until late logarithmic stage. The culture was then diluted 1 : 104 with fresh LB or TSB supplemented with various concentrations of cyclic-di-GMP and its analogs and a 200 μL of the diluted cultures was transferred into round-bottom wells of a polystyrene microtiter plate (Iwaki, Tokyo, Japan). The microtiter plate was incubated statically at 30 °C for 12 h. The supernatant was then discarded and the wells were washed three times with 200 μL of phosphate-buffered saline. After the wells were dried, 200 μL of 0.1% crystal violet was added and the wells were stained at room temperature for 15 min. The wells were then washed three times with distilled water to remove the extra dye and dried. The dye staining the biofilm in each well was extracted with 200 μL of dimethyl sulfoxide and the OD570 nm was measured with a plate reader (Tecan Austria GmbH, Austria). These experiments were repeated at least three times, and the results were expressed as the mean values ± SD. P-values for significance were calculated by the Student t-test.
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
Agar Bacteria Biofilms bis(3',5')-cyclic diguanylic acid Phosphates Polystyrenes Saline Solution Student Sulfoxide, Dimethyl Violet, Gentian
4
Construction and Validation of ΔSA0701 Mutant
Based on the S. aureus N315 genome database, the sequence of SA0701 (Bfd1, GdpS), which carries the GGDEF motif, was identified (Tu Quoc et al., 2007 (link); Holland et al., 2008 (link);). A 0.65-kb N-terminal fragment of the gene for SA0701 was amplified with a forward primer TGCACTGCAGACCATTTATTCACCTTCATC and a reverse primer GGGGTACCATAACAATCAACGTAACACC, and a 0.72-kb C-terminal fragment was amplified with a forward primer ACGCGTCGACAAGGGCGAAACAAAGTAATG and a reverse primer ACGCGTCGACAAGGGCGAAACAAAGTAATG. The two PCR products were digested with the relevant restriction enzymes, and the N-terminal fragment was inserted into the PstI–KpnI site and the C-terminal fragment was inserted into the SalI–HindIII site of pYT3 (kindly provided by Hiramatsu, Juntendo University, Tokyo). The resulting plasmid pYT3ΔSA0701 was transformed into S. aureus MS2507 as described previously (Schen & Laddaga, 1992 (link)). The transformants were selected with the tetracycline resistance phenotype at 42 °C to isolate a ΔSA0701 mutant through a double-crossover recombination. The inactivation of the gene for SA0701 was verified using PCR, followed by DNA sequencing (data not shown).
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
DNA Restriction Enzymes Genes, vif Gene Silencing Genome Guanosine Diphosphate Oligonucleotide Primers Phenotype Plasmids Recombination, Genetic
5
Quantifying Biofilm Formation under Cyclic-di-GMP Influence
PAO1 and MS2507 were prepared in the same way as those described in the quantification assay of the biofilm. Freshly prepared bacterial solutions were inoculated into 2 mL of LB for PAO1 and TSB for MS2507 supplemented with various concentrations of cyclic-di-GMP or its analogs in glass-based dishes (coverslip diameter 27 mm, Iwaki) and were incubated statically at 30 °C for 15 h for PAO1 and 9 h for MS2507. The culture supernatant was discarded and the dishes were carefully rinsed three times with 0.85% NaCl and viability staining of unfixed biofilms was performed using BacLight Live/Dead kit (L-7012, Molecular Probes) according to the manufacturer's recommendations to visualize biofilms. The biofilms attached on the polyethyleneimine-coated glass dishes (Iwaki) were observed at × 400 magnification using a confocal laser scanning microscope (LSM5 Pascal, Carl Zeiss Co. Ltd). Images were acquired at a 1-μm interval through the biofilms and five image stacks, each representing a different field of view, and were compiled from at least two independent experiments. The image stacks were analyzed using the comstat program (Heydorn et al., 2000 (link)) and the following parameters were obtained: total biomass; mean thickness, the mean height of the biofilm; maximum thickness; roughness coefficient, a measure of how much the thickness of the biofilm varies; and surface-to-volume ratio, an estimate of the portion of the biofilm exposed to nutrients.
Ishihara Y., Hyodo M., Hayakawa Y., Kamegaya T., Yamada K., Okamoto A., Hasegawa T, & Ohta M. (2009). Effect of cyclic bis(3′–5′)diguanylic acid and its analogs on bacterial biofilm formation. Fems Microbiology Letters, 301(2), 193-200.
Full text: Click here
Publication 2009
Bacteria Biofilms Biological Assay bis(3',5')-cyclic diguanylic acid Hyperostosis, Diffuse Idiopathic Skeletal Microscopy, Confocal, Laser Scanning Molecular Probes Nutrients Polyethyleneimine Sodium Chloride

Top products related to «Bis(3',5')-cyclic diguanylic acid»

More about "Bis(3',5')-cyclic diguanylic acid"

Bis(3',5')-cyclic diguanylic acid, also known as c-di-GMP, is a crucial signaling molecule in bacterial cell-cell communication and biofilm formation.
This cyclic dinucleotide is composed of two guanosine moieties linked by 3',5'-phosphodiester bonds, serving as a key secondary messenger in prokaryotic physiology. c-di-GMP plays a vital role in regulating bacterial processes such as motility, virulence, and the transition from a planktonic to a sessile lifestyle.
As an important target for antimicrobial drug development, understanding the mechanisms and functions of c-di-GMP is crucial for combating bacterial infections and improving public health.
PubCompare.ai's AI-driven platform can help researchers optimize protocols and enhance reproducibility for studies on this key biological compound, allowing for more efficient and high-quality research.
By easily locating protocols from literature, pre-prints, and patents, and using intelligent comparisons to identify the best procedures and products, researchers can experience improved efficiency and quality in their studies on c-di-GMP and related topics.
Some common abbreviations and synonyms for Bis(3',5')-cyclic diguanylic acid include c-di-GMP, cyclic diguanylate, and cyclic-di-GMP.
Key subtopics surrounding this signaling molecule include bacterial quorum sensing, biofilm formation, motility regulation, and drug targeting strategies.
With the insights and tools provided by PubCompare.ai, researchers can delve deeper into these areas and advance our understanding of this important biological compound.