Cell-Free RNA

Circulating RNAs were isolated from serum/plasma by S/P miRsol method developed in this study. Briefly, 1 ml of RNAiso-Plus (TaKaRa, Dalian, China) supplemented with 0.1 pM spiked-in Caenorhabditis elegans cel-miR-54-5p for normalization was added to 100 μl of serum or plasma and quickly vortexed thoroughly. Then 200 μl of chloroform was added and mixed by vigorous shaking for 20 s. The samples were incubated for 5 min at room temperature and centrifuged at 12,000 g for 15 min at 4 ^oC. A 500 μl of aqueous phase was transferred into a fresh tube and mixed with 6 μl of glycogen (AppliChem, Darmstadt, Germany). An equal volume (506 μl) of isopropyl alcohol was added into the mixture and incubated at −20 ^oC for 10 min followed by centrifugation at 13,500 g for 10 min at 4 ^oC. The RNA pellet was washed with 1 ml of 75% ethanol and dissolved in 20 μl of RNase-free water. The same procedure was used to isolate total RNAs from cultured cells except that no spiked-in cel-miR-54-5p and glycogen were used.
In certain experiments, second extraction was performed to see whether additional RNAs can be recovered from serum/plasma samples. Briefly, after 500 μl of aqueous phase was removed for the first exaction, an equal volume (500 μl) of RNase-free water was added to the organic phase. A 500 μl aqueous phase was collected as the second extraction of RNAs after mixing and centrifugation

Total circulating RNA (tRNA) was isolated from serum and plasma using the miRCURY RNA Isolation Kit for Biofluids (Exiqon, Vedbaek, Denmark) following the manufacturer’s instructions. An aliquot of 400 μL of serum or plasma per sample was transferred to new RNAse-free microcentrifuge tubes for lysis and protein precipitation with the provided solutions. tRNA was precipitated with isopropanol and loaded onto a spin chromatography column provided by the kit. Following recommended washes, tRNA was eluted by adding 50 μL of RNAse-free water to the column and incubating for 1 min before centrifugation at 15000 g at room temperature. microRNA was assessed for quality and quantity with a chip for Small RNA with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA) and by Invitrogen™ Qubit™ 3.0 Fluorometer (Thermo Fisher, Waltham, MA) respectively. Equal amounts (50 ng) of miRNA were used for reverse transcription (RT) using the TaqMan miRNA Reverse Transcription Kit and for amplification by qPCR, using TaqMan MicroRNA Assays (Applied Biosystems, Thermo Fisher, Waltham, MA) of the selected miRNAs, and most used endogenous control (Table 5). Each sample was analyzed in duplicate, and the expression was calculated according to the 2^−ΔΔCt method considering a pull of RNA from control samples (serum or plasma) as a reference. Relative quantification was performed using QuantStudio™ Software. The limit of quantitation (LoQ) for each miRNA studied was determined based on the principle of the minimum signal-to-noise ratio of 10, a typical constant used to define the minimum concentration at which an analyte can be reliably quantified^{32 (link)}. Therefore, LoQ was calculated as the Cycle Threshold (Ct) value that is 3.2 Ct units lower than the limit of blank (LoB) (Ct value detected in non-template controls, containing the primer pair and master mix, without RNA sample). This difference provides a factor that is 10 times higher in LoQ (assuming a doubling miRNA product per cycle) and considering that Ct values are inversely proportional to miRNA expression. Samples with Ct higher than the established LoQ were considered as not expressing the analyzed miRNA.Table 5

MicroRNA (miR) index for individual assays used.

Assay Name	Assay ID	Assay Target Sequence	miRBase ID (v21) or NCBI Name (for Controls)	miRBase Alias
U6 snRNA	001973	GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUU	U6 snRNA	NA
RNU44	001094	CCUGGAUGAUGAUAGCAAAUGCUGACUGAACAUGAAGGUCUUAAUUAGCUCUAACUGACU	RNU44	U44
RNU48	001006	GAUGACCCCAGGUAACUCUGAGUGUGUCGCUGAUGCCAUCACCGCAGCGCUCUGACC	RNU48	U48
miR-186	002285	CAAAGAAUUCUCCUUUUGGGCU	hsa-miR-186-5p	hsa-miR-186(17)
miR-191	002299	CAACGGAAUCCCAAAAGCAGCUG	hsa-miR-191-5p	hsa-miR-191(17)
miR-192	000491	CUGACCUAUGAAUUGACAGCC	hsa-miR-192-5p	hsa-miR-192(17)
miR-451	001141	AAACCGUUACCAUUACUGAGUU	hsa-miR-451a	hsa-miR-451(17)
miR-484	001821	UCAGGCUCAGUCCCCUCCCGAU	hsa-miR-484	NA
miR-1	002222	UGGAAUGUAAAGAAGUAUGUAU	hsa-miR-1-3p	hsa-miR-1(20)
miR-133a	002246	UUUGGUCCCCUUCAACCAGCUG	hsa-miR-133a-3p	hsa-miR-133a(19)
miR-208b	002290	AUAAGACGAACAAAAGGUUUGU	hsa-miR-208b-3p	hsa-miR-208b(19)
miR-21	000397	UAGCUUAUCAGACUGAUGUUGA	hsa-miR-21-5p	hsa-miR-21(17)
miR-26a	000405	UUCAAGUAAUCCAGGAUAGGCU	hsa-miR-26a-5p	hsa-miR-26a(17)
miR-499	002427	AACAUCACAGCAAGUCUGUGCU	hsa-miR-499a-3p	hsa-miR-499-3p(17)

Assay ID: Applied Biosystems Assay ID (6 digits), unique for each miRNA assay. Target Sequence: The mature miRNA target sequence of a miRNA assay. miRBase ID: List of valid miRBase gene ID or name given to a mature miRNA target of the miRNA assay. The information is derived from TaqMan miRBase Database v21(2015). 7. miRBase Alias: List of mature miRNA names (all species) that are or were associated with the target sequence and a complete list of current valid aliases (of all species). If a name was once associated with the mature miRNA target, the latest miRBase release version where the name was listed is shown in parenthesis.

Aggregated RNA differential expression data and study protocols were shared through the NASA OSDR with accession number: OSD-530^{72 (link)}. Plasma cell-free RNA samples for RNA-seq analysis were derived from blood samples collected from 6 astronauts before, during, and after the Spaceflight on the ISS. Mean expression values were obtained from normalized read counts of 6 astronauts for each time point. Heatmaps were made for the 21 genes key genes on the normalized values per time point using R package pheatmap (v1.0.12).

In this prospective and descriptive cohort study conducted at the Sant Joan University Hospital, Reus, Spain, we enrolled 46 hospitalized patients who tested positive for SARS-CoV-2 by RT-PCR from the IPACOVID clinical trial (NCT04380818) between June 2020 and February 2021. Inclusion criteria included patients with a positive COVID-19 diagnosis with moderate to severe pneumonia confirmed by chest X-ray requiring hospitalization with supplemental O₂, who, due to comorbidities or general status, were not eligible for admission to the intensive care unit (ICU). Patients were treated with LDRT, specifically a single dose of 0.5 Gy to the whole thorax, during the acute phase of COVID-19 infection. The detailed protocol regarding the radiotherapy plan and sample collection has been previously published [11 (link)]. The present study was approved by the Institutional Review Board (IRB) of the Sant Joan University Hospital in Reus. Written informed consent was obtained from each participant in accordance with the recommendations established in the latest version of the Declaration of Helsinki, Fortaleza 2013.
The primary endpoint of the present study was to study baseline SARS-CoV-2 serum viral load, whether as a continuous or a categorical variable, and its gene profiling among patients in an LDRT-treated cohort. In this line, we wanted to analyze if pre-treatment serum viral load could be used as a predictor of infection mortality, either on its own or in combination with other relevant clinical and laboratory parameters that have been previously related to worse outcomes. The secondary aim was to investigate the direct association between SARS-CoV-2 serum viral load and the severity score CURB-65 (based on age, urea level, vital signs, and presence of confusion) and of the latter with the inflammatory blood marker interleukin-6 (IL-6). The third objective was to study if serum SARS-CoV-2 viremic individuals presented higher circulating total RNA serum concentration compared to aviremic patients. The fourth aim was to investigate whether differences were found in the evolution of C-reactive protein (CRP), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH) concentrations throughout the 30-day follow-up of the trial between the serum SARS-CoV-2 positive group and the serum SARS-CoV-2 negative group. Finally, we wanted to examine the correlation between SARS-CoV-2 serum viral load and other COVID-19 severity risk factors.

Venous blood samples were collected from previously untreated MM patients in serum separating tubes. The samples were processed within two hours of collection by centrifugation at 2400× g for 10 min, as described previously [38 (link)]. Serum samples were stored at −80 °C. Isolation of cell-free total RNA, including miRNA, was performed from serum using the miRNeasy Serum/Plasma Advanced Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Briefly, 200 µL of serum was mixed with Buffer RPL to ensure a complete lysis and to release and stabilize RNA from plasma proteins and extracellular vesicles. To allow for normalization of sample-to-sample variation in RNA isolation and to control the quality of RNA isolation, before purification, each serum sample was spiked with 22 nt synthetic miRNAs added to the RPL Buffer, using the RNA Spike-In Kit, For RT (Qiagen, Hilden, Germany), according to the manufacturer’s protocol. Briefly, each sample was spiked with UniSp2 (2 fmol), UniSp4 (0.02 fmol), UniSp5 (0.00002 fmol), each at 100-fold reductions in concentration. The sample was then mixed with Buffer RPP to precipitate proteins and inhibitors and then centrifuged. Isopropanol was added to the supernatant to provide the appropriate conditions for RNA molecules (>18 nucleotides) to bind to the silica membrane. The sample was then applied to a RNeasy UCP MinElute spin column, where RNA, including miRNA, binds to the membrane and other contaminants are washed away in subsequent wash steps. In the final step, total RNA (>18 nucleotides) was eluted using 20 µL of RNase-free water. The RNA quality was determined with Agilent High Sensitivity RNA ScreenTape using 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA). Only the samples with RIN > 7.0 were further processed. Directly after the isolation, RNA was subjected to reverse transcription.