Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Nucleic Acid > Deoxyribonucleosides

Deoxyribonucleosides

Deoxyribonucleosides are the fundamental building blocks of deoxyribonucleic acid (DNA), the genetic material found in all living organisms.
These molecules consist of a deoxyribose sugar attached to one of four nitrogenous bases: adenine, guanine, cytosine, or thymine.
Deoxyribonucleosides play a critical role in DNA replication, transcription, and repair processes, making them a key focus of study in molecular biology and genetics.
Researchers can leverage PubCompare.ai's AI-driven tools to optimize their deoxyribonucleoside research, enhancing reproducibility and accuracy through seamless access to protocols from literature, preprints, and patents, as well as AI-driven comparisons to identify the best protocols and products for their studies.

Most cited protocols related to «Deoxyribonucleosides»

1
Antisense oligonucleotide design and synthesis
ASOs 1, 3 and 4 (sequence 5′-GCTCATACTCGTAGGCCA-3′, position 791–808) and 2 (sequence 5′-CTCATACTCGTAGGCC-3′, position 792–807) are complementary to Mus musculus TNFRSF1A-associated via death domain (TRADD) mRNA (Genbank accession no. NM_001033161). The ASO lead 1a is the murine homolog (a G to A base change at position 5) of the human TRADD lead reported previously (28 (link)). Control oligonucleotides 5 (5′-GCCCAATCTCGTTAGCGA-3′) were designed with six mismatches to 4, such that they contained ≥4 mismatches to all known mouse sequence. ASOs 6 and 7 (sequence TCTGGTACATGGAAGTCTGG, position 8232–8251) and 8 (sequence AAGTTGCCACCCACATTCAG, position 5586–5605) are complementary to Mus musculus apolipoprotein B (ApoB) mRNA (Genbank accession no. XM_137955.5). The sequences were identified by a screen of 5-10-5 MOE 20mer ASOs as described previously (29 (link)–31 (link)). ASOs 9, 10 and 11 (sequence 5′-CTGCTAGCCTCTGGATTTGA-3′, position 1931–1950) are complementary to M.musculus phosphatase and tensin homolog (PTEN), mRNA (Genbank accession no. NM_008960). ASO 9 (18 (link)) and control oligonucleotide 12 (19 (link)) have been described previously.
MOE phosphoramidites were prepared as described previously (7 ,32 ,33 (link)). LNA and 2′-deoxyribonucleoside phosphoramidites were purchased from commercial suppliers. Oligonucleotides were prepared similar to that described previously (34 (link)) on either an Amersham AKTA 10 or AKTA 100 oligonucleotide synthesizer. Modifications from the reported procedure include: a decrease in the detritylation time to ∼1 min, as this step was closely monitored by UV analysis for complete release of the trityl group; phosphoramidite concentration was 0.1 M; 4,5-dicyanoimidazole catalyst was used at 0.7 M in the coupling step; 3-picoline was used instead of pyridine for the sulfurization step, and the time decreased from 3 to 2 min. The oligonucleotides were then purified by ion-exchange chromatography on an AKTA Explorer and desalted by reverse phase HPLC to yield modified oligonucleotides in 30–40% isolated yield, based on the loading of the 3′-base onto the solid support. Oligonucleotides were characterized by ion-pair-HPLC-MS analysis (IP-HPLC-MS) with an Agilent 1100 MSD system. The purity of the oligonucleotides was ≥90% (Supplementary Table S1).
Swayze E.E., Siwkowski A.M., Wancewicz E.V., Migawa M.T., Wyrzykiewicz T.K., Hung G., Monia B.P, & Bennett A.C. (2006). Antisense oligonucleotides containing locked nucleic acid improve potency but cause significant hepatotoxicity in animals. Nucleic Acids Research, 35(2), 687-700.
Publication 2006
Apolipoproteins B Death Domain Deoxyribonucleosides High-Performance Liquid Chromatographies Homo sapiens Ion-Exchange Chromatographies Mice, House Mus Muscle Tissue Oligonucleotides phosphoramidite Phosphoric Monoester Hydrolases Picoline PTEN protein, human pyridine RNA, Messenger Tensin TNFRSF1A protein, human
2
16S rRNA Amplification and Sequencing
For samples from each animal and at each time-point, the 16S rRNA gene was amplified from extracted DNA using the composite forward primer 5′-GCCTCCCTCGCGCCATCAGNNNNCTGCTGCCTYCCGTA-3′ where the underlined sequence is that of 454 Life Sciences® primer A and in italics is the broad range bacterial primer BSR357. The reverse primer was 5′-GCCTTGCCAGCCCGCTCAGNNNN AGAGTTTGATCCTGGCTCAG-′3, where the underlined sequence is that of 454 Life Sciences® primer B and in italics is the broad range bacterial primer BSF8. The NNNN designates the unique four base bar code used to tag each PCR product. Reaction conditions were as follows: 5.0 μl 10× PCR buffer II (Applied Biosystems, Foster City, CA), 3.0 μl MgCl2 (25 mM; Applied Biosystems), 2.5 μl Triton X-100 (1%), 2.0 μl deoxyribonucleoside triphosphates (10 mM), 1.0 μl forward primer and 1.0 μl reverse primer (20 pmol/μl each) and 0.5 μl AmpliTaq® DNA polymerase (5U/μl; Applied Biosystems) and 100 ng of template DNA in a total reaction volume of 50 μl. Reactions were run in a GeneAmp® PCR System 9700 cycler (Applied Biosystems) using the following cycling parameters: 5 minutes denaturing at 95 °C followed by 20 cycles of 30 secs at 95 °C (denaturing), 30 secs at 56 °C (annealing) and 90 secs at 72 °C (elongation), with a final extension at 72 °C for 7 minutes. Four independent PCR reactions were performed for each sample along with a no template negative control.
McKenna P., Hoffmann C., Minkah N., Aye P.P., Lackner A., Liu Z., Lozupone C.A., Hamady M., Knight R, & Bushman F.D. (2008). The Macaque Gut Microbiome in Health, Lentiviral Infection, and Chronic Enterocolitis. PLoS Pathogens, 4(2), e20.
Full text: Click here
Publication 2008
Adjustment Disorders Animals Bacteria Buffers Deoxyribonucleosides DNA-Directed DNA Polymerase Genes Magnesium Chloride Oligonucleotide Primers Ribosomal RNA Genes RNA, Ribosomal, 16S triphosphate Triton X-100
3
Improved Molecular Dynamics Force Field for DNA
The AMBER simulations were carried out with the ff9931 (link), bsc08 (link), χOL39 ,10 (link) and χOL4 (this work) versions of the Cornell et al. force field.5 Bsc0 introduced significant modification to α/γ backbone torsional parameters essential for stability of B-DNA simulations. The χOL3 parametrization modified the χ glycosidic torsions to stabilize RNA simulations. While χOL3 modification can be combined with either ff99 or bsc0 for RNA, it works best in combination with bsc0. All DNA simulations must include bsc0.
ParmχOL4 is a new version of the χ-profile which aims to improve description of the syn region and syn-anti balance while not deteriorating the B-DNA simulations by the anti to high-anti region. The syn region of χOL4 profile differs from that of the RNA χOL3 force field in that it provides narrower and somewhat deeper syn valley than χOL3, thus suppressing the excessive population of χ syn angles in the region of 90–110°. This is a result of using a deoxyribonucleoside model compound instead of the ribonucleoside one for fitting, i.e., the difference is consistent with the primary QM data. When compared to the ff99 force field, χOL4 shifts the syn minimum to the higher χ values by about 10° and apparent are also differences in the barrier heights (Figure 2). Also, the syn minimum is somewhat deeper, which is an opposite trend compared to the χOL3 modification. While the syn region was fitted to the deoxyribonucleoside QM data, the anti to high-anti region has been modified empirically. The reason is that subtle increase of the slope of the χ correction between the anti and high-anti regions as compared to the ff99 supports helical twist of B-DNA. It subtly increases the helical twist of B-DNA (see below) though it remains to be seen if this change can be significant for B-DNA modeling. However, the change is probably in the right direction.
Krepl M., Zgarbová M., Stadlbauer P., Otyepka M., Banáš P., Koča J., Cheatham TE I.I.I., Jurečka P, & Šponer J. (2012). Reference simulations of noncanonical nucleic acids with different χ variants of the AMBER force field: quadruplex DNA, quadruplex RNA and Z-DNA. Journal of chemical theory and computation, 8(7), 2506-2520.
Publication 2012
11-dehydrocorticosterone Amber Antibodies, Anti-DNA Cardiac Glycosides Deoxyribonucleosides Helix (Snails) Ribonucleosides Vertebral Column Vision
4
Modeling Nucleoside Conformational Energies
In our attempts to improve modeling of the χ potential, we used almost complete ribo- and deoxyribonucleoside models with the 5′-OH group replaced by a hydrogen (Figure 1; only the ribo compounds are shown). We omitted the 5′-OH group to avoid its contacts with the nucleobases (for instance, the contact of 5′-OH with H6 of pyrimidines), which would bias the parameters. Note that the value of the pseudorotation angle was fixed in all calculations (see below), and therefore, neglect of the anomeric effect of the missing 5′-OH group should not influence our results. We refer to the compounds in Figure 1 as ribo/deoxyribonucleosides or simply dN/rN hereafter to facilitate discussion, noting that in this work these terms always refer to the nucleosides with the 5′-OH replaced by a hydrogen. These molecules are probably the smallest models that could be reasonably used for our purpose as they include all the intramolecular contacts that occur upon rotation about the torsion angle. The intramolecular contacts are very important because they make major contributions to the torsion energy. For instance, the repulsive O4′···O2 and O4′···N3 contacts in purines and pyrimidines, respectively, correspond to the highest rotation barriers on the potential energy surface. Note also that increasing the complexity of the model beyond certain limits does not necessarily improve the quality of the results as some long-range interactions and contacts might introduce considerable additional problems.25 (link),52 As described below, to assess the influence of the sugar pucker, the calculations were performed for two sugar conformations in deoxyribonucleosides, C2′-endo and C3′-endo. For the ribonucleosides only the C3′-endo conformation was considered.
Zgarbová M., Otyepka M., Šponer J., Mládek A., Banáš P., Cheatham TE I.I.I, & Jurečka P. (2011). Refinement of the Cornell et al. Nucleic Acids Force Field Based on Reference Quantum Chemical Calculations of Glycosidic Torsion Profiles. Journal of Chemical Theory and Computation, 7(9), 2886-2902.
Publication 2011
Carbohydrates Deoxyribonucleosides Disgust Endometriosis Hydrogen Nucleosides purine Pyrimidines Ribonucleosides
5
Annealing DNA and DNA-Tl3+ Samples for ESR Analysis
γ-Irradiated DNA and DNA-Tl3+ ice samples were annealed to 130 K to remove the ESR signal of •OH (35 (link),36 (link)); since the •OH is in the separate ice phase, annealing does not result in additional DNA radicals (35 (link),36 (link)). These samples were then illuminated with light at two different temperatures. At 77 K, either of the two sources was used: (i) a 200 W high pressure Xe lamp (Oriel Corporation), with cut-off filters which cut off light ≤310 nm, ≤480 nm, or ≤540 nm, or band-pass filters (340–370 nm and 380–480 nm), (ii) a Nd-yag laser at 521 nm, with 40 J/pulse and a 10 Hz repetition rate. At 143 K, a 250 W tungsten lamp was used with and without a variety of cut-off filters.
Glassy guanine model compound samples were annealed to 150 K for 10–12 min (see Results) which resulted in the loss of (light yellow) Cl2•− and the concomitant formation of G•+ as evidenced by the ESR spectrum and color development in the sample: red–violet at pH ≤ 9, and blue at pH ≥ 11. The samples of deoxyribonucleosides/tides were illuminated at a variety of temperatures using a 250 W tungsten lamp with and without cut-off or band-pass filters. The phrase ‘visible light illumination’ used throughout this paper refers to illumination with this lamp with wavelengths ≤310 nm cut-off; because of the small size of the sample and small solid angle it subtends, only a small fraction of the 250 W impinges on the sample.
Adhikary A., Malkhasian A.Y., Collins S., Koppen J., Becker D, & Sevilla M.D. (2005). UVA-visible photo-excitation of guanine radical cations produces sugar radicals in DNA and model structures. Nucleic Acids Research, 33(17), 5553-5564.
Publication 2005
Deoxyribonucleosides Guanine K 130 Light Light, Visible Neodymium-Doped Yttrium Aluminum Garnet Lasers Pressure Pulse Rate sodium polymetaphosphate Tungsten Viola

Most recents protocols related to «Deoxyribonucleosides»

1
Bacterial Genome Sequencing and Annotation
For the bacterial isolates, extracted DNA underwent library preparation and whole genome shotgun sequencing using the Illumina Miseq PE150 system at SeqCenter. The resulting bacterial genomes were assessed for their quality using FastQC version 0.11.9 and the resulting FastQC files were visualized using MultiQC version 1.12.60 ,61 (link) Sequences were then assembled and annotated using Bactopia version 2.2.1.62 (link) Genome quality was verified using CheckM (version 1.2.0).63 (link) Assembled genes underwent functional annotation, orthology assignments, and domain prediction using eggNOG-mapper v2.64 (link) All tools were used with default settings.
For the pyrimidine salvage gene pathway to be considered complete, all three of the following proteins needed to be present: thymidine kinase (K00857), thymidylate kinase (K00943), and nucleoside-diphosphate kinase (K00940).
For the de novo pyrimidine synthesis pathway to be considered complete, all eight of the following proteins (from KEGG Module 00051) needed to be present: dihydroorotate dehydrogenase (K00226 or K00254 or K17828), aspartate carbamoyltransferase catalytic subunit (K00609), aspartate carbamoyltransferase regulatory subunit (K00610), orotate phosphoribosyltransferase (K00762), dihydroorotase (K01465), orotidine-5’-phosphate decarboxylase (K01591), carbamoyl-phosphate synthase large subunit (K01955), and carbamoyl-phosphate synthase small subunit (K01956).
For the pyrimidine deoxyribonucleoside biosynthesis pathway to be considered complete, all six of the following proteins (from KEGG Module 00053) needed to be present: ribonucleoside-diphosphate reductase alpha chain (K00525), ribonucleoside-diphosphate reductase beta chain (K00526), thymidylate synthase (K00560), nucleoside-diphosphate kinase (K00940), thymidylate kinase (K00943), and dUTP pyrophosphatase (K01520).
Beauchemin E.T., Hunter C, & Maurice C.F. (2023). Actively replicating gut bacteria identified by 5-ethynyl-2’-deoxyuridine (EdU) click chemistry and cell sorting. Gut Microbes, 15(1), 2180317.
Full text: Click here
Publication 2023
Aspartate Carbamoyltransferase Bacteria Biosynthetic Pathways Carbamoyl-Phosphate Synthase (Ammonia) Catalytic Domain Deoxyribonucleosides Dihydroorotase Dihydroorotate Dehydrogenase DNA Library dUTP pyrophosphatase Genes Genome Genome, Bacterial Nucleoside-Diphosphate Kinase Orotidine-5'-Phosphate Decarboxylase Phosphoribosyltransferase, Orotate Proteins Protein Subunits Pyrimidines Ribonucleoside Diphosphate Reductase Thymidine Kinase thymidylate kinase Thymidylate Synthase
2
Synthesis of Modified Nucleotides and Oligonucleotides
The chemical synthesis of base-modified ribo- and deoxyribonucleoside triphosphates (rZTP and dZTP, respectively, Supplementary Figure S1), and C7G-modified oligonucleotides (Supplementary Table S1), as well as preparation of mutant T7 RNAP variants are described in detail in the Supplementary Data section.
Yang H., Eremeeva E., Abramov M., Jacquemyn M., Groaz E., Daelemans D, & Herdewijn P. (2023). CRISPR-Cas9 recognition of enzymatically synthesized base-modified nucleic acids. Nucleic Acids Research, 51(4), 1501-1511.
Publication 2023
5-amino-1-(2'-deoxy-beta-ribofuranosyl)imidazole-4-carboxamide-5'-triphosphate Deoxyribonucleosides Oligonucleotides triphosphate
3
Molecular Biology Reagents and Protocols
Deoxyribonucleoside triphosphates (dNTPs), Taq DNA polymerase with 10 × ThermoPol buffer, MgSO4, GC enhancer, Q5 High-Fidelity DNA polymerase with 5 × Q5 reaction buffer, RNase inhibitor, Cas9 Nuclease (S. pyogenes) with NEBuffer r3.1, Proteinase K, Monarch DNA Gel Extraction Kit, and the Monarch Plasmid DNA Miniprep Kit were purchased from New England Biolabs. The SYBR Gold Nucleic Acid Gel Stain, Turbo DNase I, guanosine 5′-monophosphate (GMP), T4 RNA ligase with 10 × reaction buffer, and CloneJet PCR cloning kit were obtained from ThermoFisher Scientific. T7 RNA polymerases were purchased either from New England Biolabs (T7 RNA polymerase and HiScribe T7 High Yield RNA Synthesis Kit) or ThermoFisher Scientific (T7 RNA polymerase with 5× Transcription Buffer). pCp-Cy5 dye was purchased from Jena Bioscience. Gel filtration columns, illustra NAP-25, were acquired from Cytiva. All unmodified oligodeoxyribonucleotides were purchased from Integrated DNA Technologies (IDT, Leuven). All other chemicals were obtained either from VWR or Sigma-Aldrich.
Yang H., Eremeeva E., Abramov M., Jacquemyn M., Groaz E., Daelemans D, & Herdewijn P. (2023). CRISPR-Cas9 recognition of enzymatically synthesized base-modified nucleic acids. Nucleic Acids Research, 51(4), 1501-1511.
Publication 2023
Anabolism bacteriophage T7 RNA polymerase Buffers Deoxyribonuclease I Deoxyribonucleosides DNA-Directed DNA Polymerase Endopeptidase K Endoribonucleases Gel Chromatography Guanosine Monophosphate Oligodeoxyribonucleotides Plasmids RNA Ligase (ATP) Streptococcus pyogenes Sulfate, Magnesium SYBR Gold nucleic acid gel stain Taq Polymerase Transcription, Genetic triphosphate
4
Comprehensive MS-based DNA Adduct Analysis

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
Deoxyribonucleosides Deoxyribose Hybrids Immune Tolerance isolation Lens, Crystalline MS 54 Nucleosides Radionuclide Imaging
5
Quantifying Fat4-Dchs1 Colocalization
Cell lines were grown in adherent cultures in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FBS. Cells were cultured in a humidified atmosphere of 5% CO2 at 37 °C.
HEK293 cells transduced with Fat4-mCitrine and Dachsous1-mCherry (courtesy of the David Sprinzak lab) were seeded onto 24-well glass bottom plates (Cellvis) treated with 100 μg/mL Concanavalin A (Millipore Sigma) and allowed to adhere for 3 days. For Fat4-mCitrine cells were washed using low-salt HBS + 1 mM CaCl2 + 1% BSA. Tetramers were prepared by incubating C-terminally biotinylated Dchs1(EC1–4) with Streptavidin-AF647 (produced in-house) for 10 min on ice. Tetramers were added to wells and incubated at 37 °C for 1 h. Cells were then washed once, fixed using 2% formaldehyde for 15 min at room temperature, and the solution diluted 1:3 before image collection. Dachsous1-mCherry cells were allowed to adhere for 3 days, then induced using Doxycycline at a concentration of 100 ng/mL for 1–2 days before staining with tetramers of Fat4 incubated with Streptavidin-AF488 (Invitrogen) (prepared as described above). Images were taken using a Keyence BZ-X710 confocal microscope. Analysis was performed using ImageJ.
A co-culture of HEK293-Dchs1 mCherry WT cells with HEK293-Fat4-mCitrine WT cells or HEK293-Fat4-mCitrine mutant (L379R) cells were seeded onto 24-well glass bottom plates (Cellvis, USA). Directly prior to imaging the media was replaced with low fluorescence imaging media (αMEM without Phenol red, ribonucleosides, deoxyribonucleosides, folic acid, biotin and vitamin B12 (Biological Industries, Israel).
Coculture experiments were imaged using a Zeiss LSM 880 confocal microscope using a 63× objective. To estimate the colocalization of FAT4 and Dchs1 on the boundaries between the cells, we first manually traced the boundaries using a custom made Matlab code. To create a binary mask that represents the boundaries region, we dilated the manually delineated lines by a radius that is slightly larger than the characteristic boundary width (this was estimated by analyzing several representative images). This edge mask was used to separately estimate the amount of FAT4 and Dchs1 fluorescence on the boundaries. To estimate the colocalization on the boundaries we applied Gaussian blurring on both channels. The blurred channels were multiplied by each other, then by the edge mask, and then summed and divided by the total length of the boundaries. Graphpad Prism was used for data visualization and analysis.
Medina E., Easa Y., Lester D.K., Lau E.K., Sprinzak D, & Luca V.C. (2023). Structure of the planar cell polarity cadherins Fat4 and Dachsous1. Nature Communications, 14, 891.
Full text: Click here
Publication 2023
Alexa Fluor 647 Atmosphere Biopharmaceuticals Biotin Cell Culture Techniques Cell Lines Cells Cobalamins Coculture Techniques Concanavalin A Deoxyribonucleosides Doxycycline Eagle Fluorescence Folic Acid Formaldehyde HEK293 Cells Microscopy, Confocal prisma Radius Ribonucleosides Sodium Chloride Streptavidin Tetrameres

Top products related to «Deoxyribonucleosides»

1
L glutamine by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, France, Canada, Switzerland, Italy, Australia, Belgium, China, Japan, Austria, Spain, Brazil, Israel, Sweden, Ireland, Netherlands, Gabon, Macao, New Zealand, Holy See (Vatican City State), Portugal, Poland, Argentina, Colombia, India, Denmark, Singapore, Panama, Finland, Cameroon
L-glutamine is an amino acid that is commonly used as a dietary supplement and in cell culture media. It serves as a source of nitrogen and supports cellular growth and metabolism.
2
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
3
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
4
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.
5
Streptomycin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
6
Folic acid by Merck Group
Sourced in United States, Germany, India, Switzerland, Italy, Macao, Sao Tome and Principe, Brazil, United Kingdom, Canada, Poland
Folic acid is a laboratory reagent used in various scientific applications. It is a water-soluble vitamin that plays a crucial role in cellular function and development. Folic acid is an essential component in many biochemical processes, including DNA synthesis and cell growth.
7
Inositol by Merck Group
Sourced in United States, Germany, China, France
Inositol is a naturally occurring sugar alcohol found in various plant and animal tissues. It plays a crucial role in cellular function and signaling processes. Inositol is commonly used as a laboratory reagent and research tool to study these cellular mechanisms.
8
α minimum essential medium by Thermo Fisher Scientific
Sourced in United States, Japan, Germany, China
α-minimum essential medium is a cell culture medium designed for the maintenance and growth of various cell lines. It provides the essential nutrients required for cell proliferation and survival. The composition of this medium is optimized to support the specific requirements of different cell types.
9
Horse serum by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, New Zealand, Japan, China, France, Australia, Italy, Spain, Switzerland, Canada, Netherlands, Denmark, Austria, Belgium, Ireland, Israel, Brazil
Horse serum is a biological fluid derived from the blood of horses. It contains a complex mixture of proteins, including immunoglobulins, hormones, and other biomolecules. Horse serum is commonly used as a supplement in cell culture media to support the growth and maintenance of various cell types.
10
Taq dna polymerase by Thermo Fisher Scientific
Sourced in United States, Germany, Lithuania, Canada, United Kingdom, Brazil, China, France, Italy, India, Belgium, Finland, Sweden, Sao Tome and Principe, Morocco, Poland
Taq DNA polymerase is a thermostable enzyme used for DNA amplification in Polymerase Chain Reaction (PCR) applications. It is isolated from the thermophilic bacterium Thermus aquaticus, and its core function is to catalyze the synthesis of new DNA strands complementary to a template DNA sequence.

More about "Deoxyribonucleosides"

Deoxyribonucleosides are the fundamental building blocks of deoxyribonucleic acid (DNA), the genetic material found in all living organisms.
These molecules, also known as deoxynucleosides or nucleotides, consist of a deoxyribose sugar attached to one of four nitrogenous bases: adenine (A), guanine (G), cytosine (C), or thymine (T).
Deoxyribonucleosides play a critical role in DNA replication, transcription, and repair processes, making them a key focus of study in molecular biology and genetics.
Researchers can leverage PubCompare.ai's AI-driven tools to optimize their deoxyribonucleoside research, enhancing reproducibility and accuracy through seamless access to protocols from scientific literature, preprints, and patents.
The platform also offers AI-driven comparisons to help identify the best protocols and products for their studies, ensuring efficient and reliable research.
Deoxyribonucleosides are essential for the synthesis of DNA, which stores and transmits genetic information in all living organisms.
The four nitrogenous bases (A, G, C, and T) form specific base pairs (A-T and G-C) that create the iconic double-helix structure of DNA.
These building blocks are also crucial for DNA replication, allowing the genetic material to be faithfully copied during cell division.
In addition to their role in DNA, deoxyribonucleosides are involved in various other cellular processes, such as DNA repair mechanisms and the regulation of gene expression.
Researchers often utilize deoxyribonucleosides in combination with other essential cell culture components, such as L-glutamine, fetal bovine serum (FBS), penicillin, streptomycin, folic acid, inositol, and α-minimum essential medium, to create optimal conditions for cell growth and experimentation.
Taq DNA polymerase, a thermostable enzyme derived from the bacterium Thermus aquaticus, is also a common tool used in deoxyribonucleoside research, particularly in techniques like polymerase chain reaction (PCR) for DNA amplification and sequencing.
The combination of deoxyribonucleosides and Taq DNA polymerase allows for the efficient and accurate replication of genetic material, a fundamental aspect of molecular biology and genetics.
By leveraging PubCompare.ai's AI-driven research optimization tools, scientists can streamline their deoxyribonucleoside studies, improve reproducibility, and identify the most effective protocols and products, ultimately advancing our understanding of this critical component of the genetic code.