Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Nucleic Acid > DNA Primers

DNA Primers

DNA primers are short, synthetic oligonucleotides used to initiate the replication of specific DNA sequences during polymerase chain reaction (PCR) and other molecular biology techniques.
They serve as a starting point for DNA synthesis, enabling researchers to amplify and analyze target genetic regions.
DNA primers are designed to be complementary to the flanking sequences of the DNA fragment of interest, allowing for precise and efficient DNA amplification.
Effective primer design is crucial for successful PCR experiments and other DNA-based applications.
Researchers can leverage AI-driven platforms like PubCompare.ai to optimze their primer research, locate relevant protocols, and identify the best products for their needs, taking the guesswork out of DNA primer selection and achieving superior results.

Most cited protocols related to «DNA Primers»

1
Antibody and Hashtag Library Generation for 10x 3P v3
The 10x 3P v3 protocol was followed according to manufacturer’s instructions for cDNA amplification, with the following modifications:

During cDNA amplification, 0.2 μM of ADT additive primer (5′CCTTGGCACCCGAGAATTCC) and 0.2 μM of HTO additive primer (5′GTGACTGGAGTTCAGACGTGTGCTC) were added to the reaction.

During cDNA cleanup, the supernatant from the 0.6x SPRI cleanup was saved and purified with two rounds of 2x SPRI. The eluate was split and used as template for production of ADT and Hashtag libraries:

Hashtag libraries were generated by PCR using Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer (5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC), and 10 μM Illumina TruSeq DNA D7xx primer (5′CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTGACTGGAGTTCAGACGTGTGC). Following amplification, Hashtag libraries were and cleaned up with 1.6x SPRI.

Antibody tag libraries were generated by PCR using Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer, and 10 μM TruSeq Small RNA RPIx primer (5′CAAGCAGAAGACGGCATACGAGxxxxxxxxGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA) Following amplification, Antibody tag libraries were and cleaned up with 1.6x SPRI.
Hao Y., Hao S., Andersen-Nissen E., Mauck WM I.I.I., Zheng S., Butler A., Lee M.J., Wilk A.J., Darby C., Zager M., Hoffman P., Stoeckius M., Papalexi E., Mimitou E.P., Jain J., Srivastava A., Stuart T., Fleming L.M., Yeung B., Rogers A.J., McElrath J.M., Blish C.A., Gottardo R., Smibert P, & Satija R. (2021). Integrated analysis of multimodal single-cell data. Cell, 184(13), 3573-3587.e29.
Full text: Click here
Publication 2021
DNA, Complementary DNA Primers Immunoglobulins Oligonucleotide Primers
2
Customized 10x Immune Profiling Protocol
The 10x Immune Profiling v1 protocol was followed according to manufacturer’s instructions for cDNA amplification, with the following modifications:

During cDNA amplification, 0.2 μM each of ADT (5′CCTTGGCACCCGAGAATT∗C∗C), HTO (5′GTGACTGGAGTTCAGACGTGTGC∗T∗C), and TotalSeq-C additives (5′ CTCGTGGGCTCGGAGATGTGTATAAGAGACAG) were added to the reaction.

Post cDNA cleanup, a 0.6x SPRI cleanup was performed, where larger cDNA fragments were kept on the beads, and the smaller tag libraries were retained in the supernatant. From the material retained on the beads, a portion of the eluted material was used to generate TCR α/β libraries (as written in the 10x protocol), BCR libraries (as written in the 10x protocol) and TCR γ/δ libraries (as written in the 10x protocol for TCR α/β, with these modifications):

5 μL of cDNA was taken into the initial reaction

For the first PCR, instead of the TCR1 primer mix provided by 10x genomics, we substituted our own mix consisting of primers 5′AGCTTGACAGCATTGTACTTCC and 5′TGTGTCGTTAGTCTTCATGGTGTTCC

For the second PCR, instead of the TCR2 primer mix provided by 10x Genomics, we substituted our own of primers consisting of 5′TCCTTCACCAGACAAGCGAC and 5′GATCCCAGAATCGTGTTGCTC

The 0.6X SPRI supernatant remaining following cDNA cleanup was subjected to 2 rounds of 2x SPRI. The eluate was split into three reactions for tag library production:

Hashtag libraries were created by performing a PCR reaction consisting of Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer, and 10 μM Illumina TruSeq DNA D7xx primer.

Antibody libraries (for homemade conjugates) were created by performing a PCR reaction with Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer, and 10 μM TruSeq Small RNA RPIx primer.

TotlaSeq-C antibody libraries were created by performing a PCR reaction with 2x Kapa Hifi Master Mix, 10 μM 10x Genomics SI-PCR primer, and 10 μM Nextera indexing primer (CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG).

Hao Y., Hao S., Andersen-Nissen E., Mauck WM I.I.I., Zheng S., Butler A., Lee M.J., Wilk A.J., Darby C., Zager M., Hoffman P., Stoeckius M., Papalexi E., Mimitou E.P., Jain J., Srivastava A., Stuart T., Fleming L.M., Yeung B., Rogers A.J., McElrath J.M., Blish C.A., Gottardo R., Smibert P, & Satija R. (2021). Integrated analysis of multimodal single-cell data. Cell, 184(13), 3573-3587.e29.
Full text: Click here
Publication 2021
cDNA Library DNA, Complementary DNA Primers gamma-delta T-Cell Receptor Immunoglobulins Oligonucleotide Primers
3
Random Transposon Mutagenesis in S. aureus
The mariner-based transposon (Tn) bursa aurealis was used to generate random Tn insertion mutations in S. aureus strain JE2 essentially as described by Bae et al. (4 (link), 43 (link)). First, bacteriophage ϕ11 was used to transduce the bursa aurealis delivery plasmid pBursa into JE2 containing the transposase-encoding plasmid pFA545, with selection on TSA medium containing chloramphenicol (Cm) (10 µg/ml) and Tet (5 µg/ml). After growth for 48 h at 30°C to allow for transposition events, one colony was resuspended in 100 µl of prewarmed 45°C water and then 10 µl was plated onto TSA plates containing erythromycin (Erm) (25 µg/ml) and grown at 45°C for 12 to 24 h. Resulting colonies, irrespective of colony size, were then screened for loss of the temperature-sensitive plasmids pBursa and pFA545 by patching them on TSA-Erm (25 µg/ml), TSA-Cm (10 µg/ml), and TSA-Tet (5 µg/ml). Those colonies that were Cm and Tet susceptible but resistant to Erm were arrayed into 1-ml deep-well plates containing 400 µl of TSB-Erm (5 µg/ml) and grown at 37°C overnight. The next day, 400 µl of 50% glycerol was added to each well and the plates were stored in a −80°C freezer.
To identify the locations of the bursa aurealis transposon insertions, 400 µl of TSB-Erm (5 µg/ml) was inoculated into 96-well plates using a 96-prong replicator. After overnight growth, the Wizard genomic DNA purification kit (Promega) was used to isolate genomic DNA from the cultures with the following modifications. Briefly, after centrifugation at 4,100 rpm for 5 min in a Sorvall (Newtown, CT) Legend tabletop centrifuge, supernatants were removed, the content of each well was resuspended in 110 µl of 50 mM EDTA (pH 8.0), and 5 µl of 10-mg/ml lysostaphin was added. After incubation at 37°C for 60 min, 600 µl of Nuclei Lysis solution was added and the genomic DNA was collected according to the manufacturer’s instructions. After resuspension in Tris-EDTA (TE) buffer, approximately 2 µg of genomic DNA was digested with 10 units of AciI (New England Biolabs) at 37°C for 4 h. AciI was then heat inactivated at 65°C for 30 min; T4 DNA ligase (200 U) (Monserate Biotechnologies, San Diego, CA) was then added to each sample and ligated overnight at 4°C, followed by heat inactivation at 65°C for 30 min. DNA fragments spanning the bursa aurealis insertion sites in each sample were amplified using the Buster (5′ GCTTTTTCTAAATGTTTTTTAAGTAAATCAAGTACC 3′) and Martn-ermR (5′ AAACTGATTTTTAGTAAACAGTTGACGATATTC 3′) primer set. PCR conditions included 30 cycles with an annealing temperature of 63°C and an extension time of 3 min. Once amplified, samples of the DNA products were separated in a 1% agarose gel by electrophoresis, and the remainder was purified for sequencing using Exo-SAP-IT (GE Healthcare) according to the manufacturer’s instructions. Finally, determination of the nucleotide sequences of the genomic DNA flanking the transposons was achieved using the Buster primer at the DNA Microarray and Sequencing Core Facility at the University of Nebraska Medical Center.
Fey P.D., Endres J.L., Yajjala V.K., Widhelm T.J., Boissy R.J., Bose J.L, & Bayles K.W. (2013). A Genetic Resource for Rapid and Comprehensive Phenotype Screening of Nonessential Staphylococcus aureus Genes. mBio, 4(1), e00537-12.
Publication 2013
Bacteriophages Cell Nucleus Centrifugation Chloramphenicol DNA Chips DNA Primers Edetic Acid Electrophoresis Erythromycin Genome Glycerin Jumping Genes Lysostaphin Microarray Analysis Obstetric Delivery Oligonucleotide Primers Plasmids Promega Sepharose Sequence Determinations, DNA Strains Synovial Bursa T4 DNA Ligase Transposase Tromethamine
4
Generation of Transgenic 2D2 TCR Mice
The rearranged TCRα and TCRβ chains from 2D2 genomic DNA were analyzed by sequencing. The amino acid sequence of the CDR3 regions is as follows: TCRα, VYF CALRSY NFG; TCRβ, CASS LDCG ANP. The Vα3.2Jα18 and Vβ11DJβ1.1 regions of 2D2 TCR were amplified by PCR from genomic DNA with specific primers. PCR products were cloned into TCR expression cassettes (26 (link)). Linearized TCR containing plasmids were injected directly into the pronuclei of fertilized C57Bl/6 oocytes. Transgenic founders were identified by PCR using specific primers for 2D2 Vα-Jα and Vβ-Jβ regions. Transgenic founder mice were bred with C57Bl/6 mice (The Jackson Laboratory). Alternatively, 2D2 TCR transgenic mice were bred with C57Bl/6 RAG-1−/− (The Jackson Laboratory) and then intercrossed to generate 2D2 TCR transgenic RAG-1−/− mice. Routine screening to identify the transgenic mice was performed by FACS® analysis from blood using specific antibodies to Vβ11 or Vα3.2. For phenotyping, the blood was always drawn from the tail and not from the eyes of these animals. Mice were housed in a specific pathogen-free/viral antibody-free animal facility at the Harvard Institutes of Medicine. All breeding and experiments were performed in accordance with the guidelines of the committee on Animals of Harvard Medical School.
Bettelli E., Pagany M., Weiner H.L., Linington C., Sobel R.A, & Kuchroo V.K. (2003). Myelin Oligodendrocyte Glycoprotein–specific T Cell Receptor Transgenic Mice Develop Spontaneous Autoimmune Optic Neuritis. The Journal of Experimental Medicine, 197(9), 1073-1081.
Publication 2003
6-chloropenicillanic acid S-sulfoxide Amino Acid Sequence Animals Animals, Transgenic Antibodies Antibodies, Viral BLOOD DNA Primers Eye Founder Mice, Transgenic Genome Mice, Inbred C57BL Mice, Laboratory Mice, Transgenic Oligonucleotide Primers Ovum Plasmids Specific Pathogen Free Tail T Cell Receptor beta Chain Genes
5
Digitonin-based Mitochondrial DNA Extraction
Digitonin extracts from MEFs and BMDM were generated largely as described47 . WT and Tfam+/− MEFs (7 × 106) or Tflox ERCre−/+ BMDM exposed to 4OHT for 72 hours (1 × 107) were each divided into two equal aliquots, and one aliquot was resuspended in 500 µl of 50 µM NaOH and boiled for 30 minutes to solubilize DNA. 50µl 1M Tris-HCl pH 8 was added to neutralize the pH, and these extracts served normalization controls for total mtDNA. The second equal aliquots were resuspended in roughly 500 µl buffer containing 150 mM NaCl, 50 mM HEPES, pH 7.4, and 15–25 µg/ml digitonin (EMD Chemicals). The homogenates were incubated end over end for 10 minutes to allow selective plasma membrane permeabilization, then centrifuged at 980 g for 3 min three times to pellet intact cells. The first pellet was saved as the ‘Pel’ fraction for western blotting. The cytosolic supernatants were transferred to fresh tubes and spun at 17000 g for 10 min to pellet any remaining cellular debris, yielding cytosolic preps free of nuclear, mitochondrial, and ER contamination. DNA was then isolated from these pure cytosolic fractions using QIAQuick Nucleotide Removal Columns (QIAGEN). qPCR was performed on both whole cell extracts and cytosolic fractions using nuclear DNA primers (Tert) and mtDNA primers (Dloop1-3, Cytb, 16S, Nd4), and the Ct values obtained for mtDNA abundance for whole cell extracts served as normalization controls for the mtDNA values obtained from the cytosolic fractions. This allowed effective standardization among samples and controlled for any variations in the total amount of mtDNA in control and TFAM-deficient samples. Using this digitonin method, no nuclear Tert DNA was detected in the cytosolic fractions, indicating nuclear lysis did not occur.
West A.P., Khoury-Hanold W., Staron M., Tal M.C., Pineda C.M., Lang S.M., Bestwick M., Duguay B.A., Raimundo N., MacDuff D.A., Kaech S.M., Smiley J.R., Means R.E., Iwasaki A, & Shadel G.S. (2015). Mitochondrial DNA Stress Primes the Antiviral Innate Immune Response. Nature, 520(7548), 553-557.
Publication 2014
Buffers Cell Extracts Cells Cytosol Digitonin DNA, Mitochondrial DNA Primers HEPES Mitochondria Nucleotides Oligonucleotide Primers Plasma Membrane Sodium Chloride TERT protein, human TFAM protein, human Tromethamine

Most recents protocols related to «DNA Primers»

1
Real-Time PCR Normalization with Internal Controls
Real-time PCR was performed using a One-Step SYBR PrimeScript RT–PCR Kit (Perfect Real-Time; Takara Bio), followed by detection using an ABI Prism 7000 Sequence Detection System (Applied Biosystems). Normalization was performed using two internal controls, ribosomal protein lateral stalk subunit P0 (Rplp0) and tubulin α 1A (Tub1a), and a model-based variance and stability calculation (Vandesompele et al, 2002 (link); Andersen et al, 2004 (link)). The nucleotide sequences of the primers were based on published cDNA sequences (Table S14).

Table S14. DNA sequences of the primers used in the RT–PCR analysis.

Kim J.H., Han J., Afridi R., Kim J.H., Rahman M.H., Park D.H., Lee W.S., Song G.J, & Suk K. (2023). A multiplexed siRNA screen identifies key kinase signaling networks of brain glia. Life Science Alliance, 6(5), e202201605.
Full text: Click here
Publication 2023
Base Sequence DNA, Complementary DNA Primers Oligonucleotide Primers prisma Protein Subunits Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction ribosomal protein P0 RPLP0 protein, human Stalking Tubulin
2
Comprehensive Microbiome Analysis via 16S Sequencing
Animals were wiped off with wet swabs in both directions (head to tail and tail to head). To generate representative bacteria based on relative abundancies, 16S sequencing was performed as previously described (31 (link)). DNA was extracted using the QIAamp UCP Pathogen Mini Kit automated on the QIAcube (Qiagen, Hilden, Germany) following the manufacturer’s guidelines.
16S rRNA gene libraries were generated by PCR from purified genomic DNA with primers 27F and 338R, targeting the hypervariable regions V1 and V2 of the 16S rRNA. Amplification and sequencing were performed using a dual-indexing approach (8-nt on forward- and reverse primer) as described by Kozich et al. (32 (link)) on the Illumina MiSeq platform (Illumina Inc., San Diego, USA) generating 2x300 bp reads. Demultiplexing after sequencing was based on no mismatches in the indices.
Data processing was performed using the DADA2 version 1.10 workflow for big data sets (33 (link)) resulting in abundance tables of amplicon sequence variants (ASVs) according to a workflow adjusted for V1-V2 region, which can be found here: https://github.com/mruehlemann/ikmb_amplicon_processing/blob/master/dada2_16S_workflow_with_AR.R. Resulting ASVs underwent taxonomic annotation using the Bayesian classifier provided in DADA2 and using the Ribosomal Database Project (RDP) version 16 release. One sample with less than 10,000 sequences was not considered for further analysis. ASVs classified as “Chloroplast” were removed. Alpha diversity was estimated with Shannon index and Beta diversity was estimated from Bray-Curtis dissimilarity (phyloseq R package). Differential abundance analysis was performed with the linear model function LinDA (34 (link)) in the MicrobiomeStat package, which can be found at https://CRAN.R-project.org/package=MicrobiomeStat.
Schwarz A., Philippsen R., Piticchio S.G., Hartmann J.N., Häsler R., Rose-John S, & Schwarz T. (2023). Crosstalk between microbiome, regulatory T cells and HCA2 orchestrates the inflammatory response in a murine psoriasis model. Frontiers in Immunology, 14, 1038689.
Full text: Click here
Publication 2023
Animals Bacteria Chloroplasts DNA Primers Gene Library Genetic Diversity Genome Head Oligonucleotide Primers Pathogenicity Ribosomes RNA, Ribosomal, 16S Tail
3
Construction of Inducible CRISPR/Cas9 System
The plasmid pgRNA was assembled using type IIS restriction enzymes‐based assembly method, Golden Gate,[28] for which DNA primers were designed using J5 Device Editor.[29] Inducible gRNA plasmids were constructed for guiding CRISPR/Cas9 to the target locus between ddpX and dosP on the chromosome of E. coli MG1655. The backbone of pgRNA was PCR amplified from pACYC184‐M,[30] and the gRNA with its promoter was amplified from the plasmid pRed_Cas9_ΔpoxB300.[31] The plasmid pgRNA(N20PAM) was constructed using the same method. Plasmid pRedCas9 for the inducible expression of λ‐Red and Cas9 was modified from pRed_Cas9_ΔpoxB300 and assembled using the Golden Gate method.
Wang P., Zhao D., Li J., Su J., Zhang C., Li S., Fan F., Dai Z., Liao X., Mao Z., Bi C, & Zhang X. (2023). Artificial Diploid Escherichia coli by a CRISPR Chromosome‐Doubling Technique. Advanced Science, 10(7), 2205855.
Full text: Click here
Publication 2023
Chromosomes Clustered Regularly Interspaced Short Palindromic Repeats DNA Primers DNA Restriction Enzymes Escherichia coli Medical Devices pgRNA Plasmids Vertebral Column
4
Quantification of Human IPF Cells in Mouse Lungs
Mice were euthanized 4 weeks after adoptive transfer of human cells, and the lungs were harvested. The lungs were digested, and genomic DNA was isolated using a PureLink Genomic DNA Mini Kit according to the manufacturer’s instructions (Invitrogen). Real-time PCR was used to quantify human IPF cells in the mouse lungs by measuring the amount of human-specific DNA sequence using human specific primers per a previously published protocol (44 (link)). PCR assay was performed for 40 cycles using the human genomic DNA-specific primers (forward: 5′-ATGCTGATGTCTGGGTAGGGTG-3′; reverse: 5′-TGAGTCAGGAGCCAGCGTATG-3′). Genomic DNA from 1 × 106 IPF MPCs was used as reference control in qPCR.
Yang L., Gilbertsen A., Xia H., Benyumov A., Smith K., Herrera J., Racila E., Bitterman P.B, & Henke C.A. (2023). Hypoxia enhances IPF mesenchymal progenitor cell fibrogenicity via the lactate/GPR81/HIF1α pathway. JCI Insight, 8(4), e163820.
Full text: Click here
Publication 2023
Adoptive Cell Transfer Biological Assay Cells DNA, A-Form DNA Primers DNA Sequence Genome Genome, Human Homo sapiens Lung Mesenchymal Stem Cells Mus Oligonucleotide Primers Real-Time Polymerase Chain Reaction
5
Generation of Complemented T. gondii Atg8 Cell Lines
Tachyzoites of the T. gondii cKD TgAtg8 cell line (12 (link)), as well as derived transgenic parasites generated in this study, were maintained by serial passage in a human foreskin fibroblast (HFF; American Type Culture Collection; CRL 1634) cell monolayer grown in Dulbecco’s modified Eagle’s medium (DMEM; Gibco), supplemented with 5% decomplemented fetal bovine serum, 2-mM l-glutamine, and a cocktail of penicillin-streptomycin at 100 μg/mL.
Complemented cell lines were generated by insertion of an additional TgAtg8 copy at the uracil phosphoribosyltransferase (UPRT) locus in the cKD TgAtg8 mutant (12 (link)). The pGFP-TgAtg8 plasmid (64 (link)) was used as a template with primers ML2463 and ML2464, and the products were self-ligated to generate p-GFP-TgAtg8Δ68-76 excluding amino acids 68 to 76 (QCAQNSGLP). A 1.5-kbp sequence corresponding to the promoter region of TgAtg8 was obtained by PCR from genomic DNA with primers ML2429 and ML2430 and cloned with NsiI upstream of the GFP-TgAtg8 or GFP-TgAtg8ΔLoop fragment in its respective plasmid. These were then used as a PCR template to amplify, with primers ML2624 and ML2625, a cassette containing the TgAtg8 promoter followed by the sequence coding for GFP-fused wild-type (WT) or truncated TgAtg8. These cassettes were cloned using NotI and XmaI into the pUPRT-TUB-Ty plasmid (65 (link)) to yield the pUPRT-GFP-TgAtg8 and pUPRT-GFP-TgAtg8ΔLoop plasmids, respectively. These plasmids were then linearized with KpnI and BamHI prior to transfection into the cKD TgAtg8 cell line (12 (link)) together with a plasmid expressing Cas9 and a UPRT-specific guide RNA under the control of a U6 promoter (66 (link)). Then transgenic parasites were selected with 5 μM fluorodeoxyuridine and cloned by limiting dilution. Primers are listed in Table S1.
Walczak M., Meister T.R., Nguyen H.M., Zhu Y., Besteiro S, & Yeh E. (2023). Structure-Function Relationship for a Divergent Atg8 Protein Required for a Nonautophagic Function in Apicomplexan Parasites. mBio, 14(1), e03642-21.
Full text: Click here
Publication 2023
Amino Acids Animals, Transgenic Cell Lines Cells DNA Primers Eagle Fetal Bovine Serum Fibroblasts Floxuridine Foreskin Genome Glutamine Homo sapiens Oligonucleotide Primers Open Reading Frames Parasites Penicillins Plasmids Streptomycin Technique, Dilution Transfection U6 small nuclear RNA uracil phosphoribosyltransferase

Top products related to «DNA Primers»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
3
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
4
Iscript cdna synthesis kit by Bio-Rad
Sourced in United States, Germany, Italy, Canada, United Kingdom, France, Netherlands, Switzerland, Sweden, Belgium, Japan, Australia, China, India, Spain, Denmark, Austria, Norway
The IScript cDNA Synthesis Kit is a reagent kit used for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains all the necessary components to perform this reaction, including a reverse transcriptase enzyme, reaction buffer, and oligo(dT) primers.
5
Qiaquick pcr purification kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, France, Japan, China, Canada, Italy, Australia, Switzerland, Singapore, Sweden, India, Malaysia
The QIAquick PCR Purification Kit is a lab equipment product designed for the rapid purification of PCR (Polymerase Chain Reaction) amplicons. It utilizes a silica-membrane technology to efficiently capture and purify DNA fragments from PCR reactions, removing unwanted primers, nucleotides, and enzymes.
6
High capacity cdna reverse transcription kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia
The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.
7
Qiaamp dna mini kit by Qiagen
Sourced in Germany, United States, France, United Kingdom, Netherlands, Spain, Japan, China, Italy, Canada, Switzerland, Australia, Sweden, India, Belgium, Brazil, Denmark
The QIAamp DNA Mini Kit is a laboratory equipment product designed for the purification of genomic DNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify DNA, which can then be used for various downstream applications.
8
Dneasy blood and tissue kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Canada, Netherlands, Japan, China, France, Australia, Denmark, Switzerland, Italy, Sweden, Belgium, Austria, Hungary
The DNeasy Blood and Tissue Kit is a DNA extraction and purification product designed for the isolation of genomic DNA from a variety of sample types, including blood, tissues, and cultured cells. The kit utilizes a silica-based membrane technology to efficiently capture and purify DNA, providing high-quality samples suitable for use in various downstream applications.
9
Dneasy blood tissue kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, China, Canada, France, Australia, Switzerland, Italy, Belgium, Denmark, Sweden
The DNeasy Blood & Tissue Kit is a DNA extraction and purification kit designed for the efficient isolation of high-quality genomic DNA from a variety of sample types, including whole blood, tissue, and cultured cells. The kit utilizes a silica-based membrane technology to capture and purify DNA, providing a reliable and consistent method for DNA extraction.
10
Qiaquick gel extraction kit by Qiagen
Sourced in Germany, United States, Netherlands, United Kingdom, Japan, Canada, France, Spain, China, Italy, India, Switzerland, Austria, Lithuania, Sweden, Australia
The QIAquick Gel Extraction Kit is a product designed for the purification of DNA fragments from agarose gels. It efficiently extracts and purifies DNA from gel slices after electrophoresis.

More about "DNA Primers"

DNA primers, oligonucleotides, polymerase chain reaction, PCR, molecular biology, genetic research, DNA amplification, DNA synthesis, primer design, PubCompare.ai, TRIzol reagent, RNeasy Mini Kit, IScript cDNA synthesis kit, QIAquick PCR Purification Kit, High-Capacity cDNA Reverse Transcription Kit, QIAamp DNA Mini Kit, DNeasy Blood and Tissue Kit, QIAquick Gel Extraction Kit, RNA extraction, DNA extraction, cDNA synthesis, PCR purification, DNA purification