Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Nucleic Acid > Ribonucleotides

Ribonucleotides

Ribonucleotides are the basic building blocks of ribonucleic acid (RNA), which plays a crucial role in genetic information transfer and protein synthesis within cells.
These nucleotid molecules consist of a ribose sugar, a phosphate group, and one of four nitrogenous bases: adenine, guanine, cytosine, or uracil.
Ribonucleotides are essential for a variety of biological processes, including RNA synthesis, cellular signaling, and energy metabolism.
Understanding the structure, function, and regulation of ribonucleotides is crucial for advancinig research in fields such as molecular biology, genetics, and biochemistry.
Researchers can leverage the power of AI-powered platforms like PubCompare.ai to optimize their ribonucleotide research protocols, enhance reproducibility, and identify the most effective approaches and products for their studies.
This cutting-edge technology can help take the guesswork out of ribonucleotide research and accelerate scientific discoveries.

Most cited protocols related to «Ribonucleotides»

1
Multiplex PCR and In Vitro Transcription for MALDI-TOF MS
Cited 18 times
The target regions were PCR-amplified from human genomic DNA using primers that incorporate the T7 [5′-CAG TAA TAC GAC TCA CTA TAG GGA GA] promoter sequence. For each target region, two sets of primers were designed to incorporate the T7 promoter sequence either to the forward or to the reverse strand. The following PCR primers were used for uniplex and multiplex reactions. Primer sequences are provided with the T7 promoter tag:

MP1_T7_FOR CAGTAATACGACTCACTATAGGGAGAAGGCTGAGCTATTGCGAGAATAAGGAGATG

MP1_10_REV AGGAAGAGAGCGTGTTTGCTGTGCTTGATTG

MP1_T7_REV CAGTAATACGACTCACTATAGGGAGAAGGCTCGTGTTTGCTGTGCTTGATTG

MP1_10_FOR AGGAAGAGAGGAGCTATTGCGAGAATAAGGAGATG

MP2_T7_FOR CAGTAATACGACTCACTATAGGGAGAAGGCTCAAAATAACCAACAACCTCTTCCAG

MP2_10_REV AGGAAGAGAGGCAGAGCTCACAAGGATGGTTAC

MP2_T7_REV CAGTAATACGACTCACTATAGGGAGAAGGCTGCAGAGCTCACAAGGATGGTTAC

MP2_10_FOR AGGAAGAGAGCAAAATAACCAACAACCTCTTCCAG

MP3_T7_FOR CAGTAATACGACTCACTATAGGGAGAAGGCTGAAGCTCAAGTTTAAAGAAGCGTTG

MP3_10_REV AGGAAGAGAGAGCTGATTCCCCTTCAAGACTATTT

MP3_T7_REV CAGTAATACGACTCACTATAGGGAGAAGGCTAGCTGATTCCCCTTCAAGACTATTT

MP3_10_FOR AGGAAGAGAGGAAGCTCAAGTTTAAAGAAGCGTTG

The following PCR primer pairs were used for the CFTR multiplex of exon 10, 21 and 24:

CFTR_ex10_T7_FOR CAGTAATACGACTCACTATAGGGAGAAGGCTTCAGTTTTCCTGGATTATGC

CFTR_ex10_10MER_REV AGGAAGAGAGTTGGCATGCTTTGATGACGC

CFTR_ex10_T7_REV CAGTAATACGACTCACTATAGGGAGAAGGCTTTGGCATGCTTTGATGACGC

CFTR_ex10_10MER_FOR AGGAAGAGAGTCAGTTTTCCTGGATTATGC

CFTR_EX21_T7_FOR CAGTAATACGACTCACTATAGGGAGAAGGCTGAGGTTCATTTACGTCTTTTGTG

CFTR_EX21_10MER_REV AGGAAGAGAGCATAAAAGTTAAAAAGATGATAAGACTTAC

CFTR_EX21_T7_REV CAGTAATACGACTCACTATAGGGAGAAGGCTCATAAAAGTTAAAAAGATGATAAGACTTAC

CFTR_EX21_10MER_FOR AGGAAGAGAGGAGGTTCATTTACGTCTTTTGTG

CFTR_ex24_T7_FOR CAGTAATACGACTCACTATAGGGAGAAGGCTTTTCTTCTTCTTTTCTTTTTTGCTATAG

CFTR_ex24_10MER_REV AGGAAGAGAGCCCTTTCAAAATCATTTCAGTTA

CFTR_ex24_T7_REV CAGTAATACGACTCACTATAGGGAGAAGGCTCCCTTTCAAAATCATTTCAGTTA

CFTR_ex24_10MER_FOR AGGAAGAGAGTTTCTTCTTCTTTTCTTTTTTGCTATAG

The PCR reactions were carried out in a total volume of 5 μl using 1 pmol of each primer, 40 μM dNTP, 0.1 U Hot Star Taq DNA polymerase (Qiagen), 1.5 mM MgCl2 and buffer supplied with the enzyme (final concentration 1×). The reaction mix was pre-activated for 15 min at 95°C. The reactions were amplified in 45 cycles of 95°C for 20 s, 62°C for 30 s and 72°C for 30 s followed by 72°C for 3 min. Unincorporated dNTPs were dephosphorylated by adding 1.7 μl H2O and 0.3 U Shrimp Alkaline Phosphatase. The reaction was incubated at 37°C for 20 min.
Typically, 2 μl of the PCR reaction was directly used as template in a 4-μl transcription reaction. Twenty units of T7 R&DNA polymerase (Epicentre, Madison, WI) were used to incorporate either dCTP or dTTP in the transcripts. Ribonucleotides were used at 1 mM and the dNTP substrate at 2.5 mM; other components in the reaction were as recommended by the supplier. Following the in vitro transcription, RNase was added to cleave the in vitro transcript. The mixture was then further diluted with H2O to a final volume of 27 μl. Conditioning of the phosphate backbone prior to MALDI-TOF MS was achieved by the addition of 6 mg CLEAN Resin (Sequenom Inc., San Diego, CA). Further experimental details have been described elsewhere (1 (link),2 (link)).
Ehrich M., Böcker S, & van den Boom D. (2005). Multiplexed discovery of sequence polymorphisms using base-specific cleavage and MALDI-TOF MS. Nucleic Acids Research, 33(4), e38.
Publication 2005
2'-deoxycytidine 5'-triphosphate Alkaline Phosphatase Buffers CFTR protein, human DNA-Directed DNA Polymerase Endoribonucleases Enzymes Exons Genome, Human Magnesium Chloride Oligonucleotide Primers Phosphates Resins, Plant Ribonucleotides Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization Taq Polymerase thymidine 5'-triphosphate Transcription, Genetic Vertebral Column
2
Yeast Total RNA Extraction and Quantification
Cited 16 times
A single colony of strain S288C was inoculated into 10 ml of YPD (1%(w/v) yeast extract/2%(w/v) Bacto peptone/2%(w/v) glucose) and grown with shaking at 30°C for overnight. To prepare cells under a rich condition, they were resuspended in 100 ml of YPD at an OD600 of 0.1 and grown at 30°C for 6 hrs. To prepare cells under a poor condition, the cells grown overnight in YPD media were washed with ddH2O, resuspended in 100 ml of SD (0.67%(w/v) yeast nitrogen base without amino acids/2%(w/v) glucose) at an OD600 of 0.5, and grown at 30°C for 6 hrs. The cells were collected by centrifugation, resuspended in ddH2O, aliquoted in microtubes (400 μl), frozen in liquid nitrogen, and stored at -80°C until use. The number of cells was directly counted using a hematocytometer.
Total RNA was extracted using a hot-phenol method [12 (link)] with some modifications. To the 400-μl cell suspension described above, 100 μl of 5× lysis buffer (50 mM Tris-HCl, pH 7.5/50 mM EDTA/2.5%(w/v) SDS) and 500 μl of water-saturated phenol were added and mixed well on a shaker at 65°C for 1 hr. The tubes were chilled on ice for 5 min and centrifuged for phase separation. While the aqueous phase was saved in another tube, the phenol phase was mixed with 500 μl of 1× lysis buffer and shaked at 65°C for 1 hr. The second aqueous phase was combined with the first one and extracted once with water-saturated phenol and once with chloroform. The RNAs was precipitated by adding isopropanol to the aqueous phase, rinsed with 75%(v/v) ethanol, and dissolved in ddH2O. To remove contaminating genomic DNA, the RNA was treated with RNase-free DNase I (Promega) and purified with TRIzol reagent (Invitrogen) according to the manufacturer's instruction. The concentration of RNA was determined by measuring OD260 on spectrophotometer based on an assumption that one OD260 unit corresponds to 40 ng/μl of RNA.
Total amount of cellular RNAs was also determined using selective extraction of ribonucleotides by NaOH [13 (link)] with some modifications. To the 400-μl cell suspension, 100 μl of 1.2 N perchloric acid (PCA) was added and the obtained mixture was placed in ice-cold water for 1 hr. Following centrifugation, the supernatant was removed and the cell pellet was washed again with 500 μl of 0.25 N PCA. Following careful removal of residual PCA solution, the cell pellet was resuspended in 300 μl of 0.3 N NaOH and incubated at 37°C for 1 hr. After neutralization with adding 150 μl of 1.2 N PCA, the concentration of RNA was determined from OD260 and a standard curve obtained from the measurement of various known amounts of purified yeast RNA subjected to the same NaOH/PCA treatment.
Miura F., Kawaguchi N., Yoshida M., Uematsu C., Kito K., Sakaki Y, & Ito T. (2008). Absolute quantification of the budding yeast transcriptome by means of competitive PCR between genomic and complementary DNAs. BMC Genomics, 9, 574.
Full text: Click here
Publication 2008
Amino Acids, Basic Bacto-peptone Buffers Cells Centrifugation Chloroform Cold Temperature Deoxyribonucleases Edetic Acid Ethanol Freezing Genome Glucose Ice Isopropyl Alcohol Nitrogen Perchloric Acid Phenol Promega Ribonuclease, Pancreatic Ribonucleotides Saccharomyces cerevisiae Strains trizol Tromethamine
3
Leukemia Cell Culture Protocol
Cited 13 times
Primary leukemia cells (Supplementary Table 1) were cultured on OP9 stroma cells in Alpha MEM without ribonucleotides and deoxyribonucleotides, supplemented with 20% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 IU/ml penicillin, and 100 μg/ml streptomycin. Human ALL cell lines were maintained in RPMI with GlutaMAX containing 20% FBS, 100 IU/ml penicillin, and 100 μg/ml streptomycin. Mouse BCR-ABL1-transformed ALL cells were maintained in IMDM with GlutaMAX containing 20% FBS, 100 IU/ml penicillin, 100 μg/ml streptomycin, and 50 μM 2-mercaptoethanol. Cell cultures were kept at 37°C in a humidified incubator under a 5% CO2 atmosphere.
Duy C., Hurtz C., Shojaee S., Cerchietti L., Geng H., Swaminathan S., Klemm L., Kweon S.M., Nahar R., Braig M., Park E., Kim Y.M., Hofmann W.K., Herzog S., Jumaa H., Koeffler H.P., Yu J.J., Heisterkamp N., Graeber T.G., Wu H., Ye B.H., Melnick A, & Müschen M. (2011). BCL6 enables Ph+ acute lymphoblastic leukemia cells to survive BCR-ABL1 kinase inhibition. Nature, 473(7347), 384-388.
Publication 2011
2-Mercaptoethanol alpha minimal essential medium Atmosphere Cell Culture Techniques Cell Lines Cells Cultured Cells Deoxyribonucleotides Glutamine Homo sapiens Leukemia Mus Penicillins Pyruvate Ribonucleotides Sodium Streptomycin
4
Affymetrix microarray analysis of prostate cells
Cited 9 times
MACS-sorted prostate cell lysates in RLT buffer were stored at -80C for no more than a month. Total cellular RNA was prepared with an RNaqueous kit (Ambion, Austin, TX). Quality and concentration of RNA was determined by using an Agilent 2100 Bioanalyzer with a RNA Nano Labchip assay (Agilent Technologies, Palo Alto, CA). Only RNA samples that were of sufficient concentration and showed no degradation were used for array hybridization.
Gene expression by sorted cells was analyzed with Human Genome U133 Plus 2.0 GeneChips (Affymetrix, Santa Clara, CA). Five separate biological replicates of each sorted cell population were assayed to produce a data set of 20 chips. The GeneChips were prepared, hybridized, and scanned according to the protocols provided by Affymetrix. Briefly, 200 ng of total RNA was reverse transcribed with a poly(T) primer containing a T7 promoter and the cDNA was made double-stranded. An in vitro transcription was performed to produce unlabeled cRNA. Next, 1st strand cDNA was produced from a random primed reaction. cDNA was made double stranded in a reaction with a poly(T) primer containing a T7 promoter. Finally, an in vitro transcription was performed with biotinylated ribonucleotides to produce biotin labeled cRNA. Labeled cRNA was then hybridized with the GeneChips. The chips were washed and stained with streptavidin-PE using an Affymetrix FS-450 fluidics station. Data was collected with an Affymetrix GeneChip Scanner 3000.
Oudes A.J., Campbell D.S., Sorensen C.M., Walashek L.S., True L.D, & Liu A.Y. (2006). Transcriptomes of human prostate cells. BMC Genomics, 7, 92.
Full text: Click here
Publication 2006
austin Biopharmaceuticals Biotin Buffers Cells Complementary RNA Crossbreeding DNA, Complementary DNA Chips Gene Chips Gene Expression Genome, Human Oligonucleotide Primers Poly A Prostate Ribonucleotides Streptavidin Transcription, Genetic
5
Sanger Sequencing: A Pioneering DNA Technique
Cited 8 times
The founding methods in DNA sequencing were the Sanger dideoxy synthesis (Sanger & Coulson, 1975 (link); Sanger, Nicklen, & Coulson, 1977 (link)) (UNIT 7.4) and Maxam-Gilbert chemical cleavage (Maxam & Gilbert, 1980 (link)) (UNIT 7.5) methods. The Maxam-Gilbert method is based on chemical modification of DNA and subsequent cleavage of the DNA backbone at sites adjacent to the modified nucleotides. Sanger sequencing uses specific chain-terminating nucleotides (dideoxy nucleotides) that lack a 3′-OH group. Thus no phosphodiester bond can be formed by DNA polymerase, resulting in termination of the growing DNA chain at that position. The ddNTPs are radioactively or fluorescently labeled for detection in “sequencing” gels or automated sequencing machines, respectively. Although the chemistry of the original Maxam-Gilbert method has been modified to help eliminate toxic reagents, the Sanger sequencing by synthesis (SBS) dideoxy method has become the sequencing standard.
The Sanger sequencing method was developed in 1977 and is described in detail in Unit 7.4. Although relatively slow by current NGS standards, improvements in the Sanger chain termination methodology, automation, and commercialization have enabled it to remain the most appropriate sequencing method for many current applications. Specifically, the replacement of ultrathin “slab gels” with multichannel capillary electrophoresis, the development of automated refillable reusable capillaries, and “electrokinetic” sample loading have all contributed to the enhanced speed and ease of the Sanger process. The most significant innovations in Sanger sequencing have been: (1) the development of fluorescent (terminator) dyes, (2) the use of thermal-cycle sequencing to reduce the quantity of required input DNA and thermostable polymerases to efficiently and accurately incorporate the terminator dyes into the growing DNA strands, and (3) software developments to interpret and analyze the sequences. The leader in automated Sanger sequencing is Applied Biosystems (AB) (now part of ThermoFisher). The current commercialized AB sequencers all utilize fluorescent dyes and capillary electrophoresis (CE). The machines vary in capacity, from 4 capillaries (SeqStudio Genetic Analyzer), to 8–24 (3500 Series Genetic Analyzer), to 48–96 (3700 Series Genetic Analyzer) for DNA sequencing or fragment analysis protocols. All of these sequencers generate 600–1000 bases of accurate sequence. Although a variety of Sanger-sequencing-based sequencing machines have been introduced over the years, including instruments from Licor, Amersham, MilliGen, Perkin Elmer and Dupont, all of them except the AB machines have been discontinued.
The Sanger sequencing technology remains very useful for applications where high throughput is not required. Many DNA sequencing core facilities and sequencing-for-profit companies provide Sanger sequencing services. The most common uses are for individual sequencing reactions using a specific DNA primer on a specific template, for example to verify plasmid constructs or PCR products. Now that molecular biology kits and reagents for DNA purification and relatively inexpensive high quality synthetic primers are available from many vendors, even relatively large Sanger sequencing projects can be completed in a reasonable time frame and cost.
In addition to sequencing DNA, another useful application of capillary electrophoresis on the AB machines has been the development of methods for assaying the activity of selected enzymes acting upon fluorescently labeled DNA substrates, by analysis, for example, of DNA fragment size (Greenough et al., 2016 (link)). Capillary electrophoresis can also be used to simultaneously analyze multiple substrates, products and/or reaction intermediates in a single reaction using different fluorescent labels (Greenough et al., 2016 (link)). For example, CE was used in high-throughput studies of DNA polymerase and DNA ligase kinetics and coupled enzyme pathways including Okazaki fragment processing and ribonucleotide excision repair (Greenough, Kelman, & Gardner, 2015 (link); Schermerhorn & Gardner, 2015 (link)). AB CE is also useful in glycobiology for analyzing fluorescently labeled glycans (Callewaert, Geysens, Molemans, & Contreras, 2001 (link); Laroy, Contreras, & Callewaert, 2006 (link))
Slatko B.E., Gardner A.F, & Ausubel F.M. (2018). Overview of Next Generation Sequencing Technologies. Current protocols in molecular biology, 122(1), e59.
Publication 2018
Anabolism Base Sequence Capillaries Cytokinesis Dideoxynucleotide Triphosphates DNA-Directed DNA Polymerase DNA Cleavage DNA Ligases DNA Primers Dyes Electrophoresis, Capillary enzyme activity Enzymes Excision Repair Fluorescent Dyes Gels Innovativeness Kinetics Nucleotides Oligonucleotide Primers Plasmids Polysaccharides Reading Frames Reproduction Ribonucleotides Vertebral Column

Most recents protocols related to «Ribonucleotides»

1
Metabolic Profiling of Cultured Cells
Cells were cultured in 6-well plates to ~85% confluence and washed with 2 mL ice cold 1X Phosphate-Buffered Saline (PBS). The cells were then harvested in 300 µL freezing 80% acetonitrile (v/v) into 1.5 mL tubes and lysed by Bullet Blender (Next Advance) at 4 °C followed by centrifugation at 21,000 × g for 5 min at 4 °C. The supernatant was dried by speedvac and reconstituted in 7.5 µL of 66% acetonitrile and 2 µL was separated by a ZIC‐HILIC column (150 × 2.1 mm, EMD Millipore) coupled with a Q Exactive HF Orbitrap MS (Thermo Fisher) in negative detection mode. Metabolites were eluted within a 45 min gradient (buffer A: 10 mM ammonium acetate in 90% acetonitrile, pH = 8; buffer B: 10 mM ammonium acetate in 100% H2O, pH = 8). The MS was operated by a full scan method followed by targeted selected ion monitoring and data-dependent MS/MS (tSIM/dd-MS2). MS settings included full scan (120,000 resolution, 350–550 m/z, 3 × 106 AGC and 50 ms maximal ion time), tSIM scan (120,000 resolution, 1 × 105 AGC, 4 m/z isolation window and 50 ms maximal ion time) and data-dependent MS2 scan (30,000 resolution, 2 × 105 AGC, ~50 ms maximal ion time, HCD, Stepped NCE (50, 100, 150), and 10 s dynamic exclusion). Data were quantified using Xcalibur software (Thermo Fisher Scientific) and normalized by cell numbers. Ribonucleotide and deoxyribonucleotides were validated by authentic standards.
Brown A., Pan Q., Fan L., Indersie E., Tian C., Timchenko N., Li L., Hansen B.S., Tan H., Lu M., Peng J., Pruett-Miller S.M., Yu J., Cairo S, & Zhu L. (2023). Ribonucleotide reductase subunit switching in hepatoblastoma drug response and relapse. Communications Biology, 6, 249.
Full text: Click here
Publication 2023
1-(trimethylsilyl)-1H-imidazole acetonitrile ammonium acetate Buffers Cells Centrifugation Cold Temperature Deoxyribonucleotides isolation Phosphates Radionuclide Imaging Ribonucleotides Saline Solution Tandem Mass Spectrometry
2
Genetic Manipulation of MOLT-3 Cells
MOLT-3 cells were obtained from the ATCC. To obtain MOLT-3 cells lacking LCK, preassembled ribonucleotide complexes consisting of purified Cas9 (Synthego) and chemically modified synthetic sgRNA (target sequence: 5′-GCTCCGCGTCCTTGCGGCTC-3′) (Synthego) were delivered into MOLT-3 cells via nucleofection using the Cell Line Nucleofector kit V with the Nucleofector II device (Lonza). Clones obtained by limiting dilution were screened by Western blotting with anti-LCK antibody 3A5 (Santa Cruz Biotechnology; sc-433). Protein loading was assessed with anti-actin antibody (Santa Cruz Biotechnology; sc-47778).
MOLT-3 cells lacking PAK2 were obtained by transiently transfecting a plasmid expressing an sgRNA targeting PAK2 (target sequence, 5′-GATTTCGTATGATCCGGTCG-3′) by nucleofection, along with a plasmid expressing Cas9. Clones obtained by limiting dilution were screened by Western blotting with anti-PAK2 (Cell Signaling Technology; 2608) and anti-actin antibodies. To obtain MOLT-3 cells lacking all group I PAKs, Cas9/sgRNA complexes targeting PAK1 (target sequence, 5′-AGGCACCGTGTACACAGCAA-3′) were delivered into PAK2 KO MOLT-3 cells by nucleofection. Clones obtained by limiting dilution were screened by Western blotting with anti-PAK1 (Cell Signaling Technology; 2602) and anti-actin antibodies.
MOLT-3 double-KO cells lacking SERINC3 and SERINC5 (MOLT-3 S3/5 double-KO cells) have been described (26 (link)). To obtain MOLT-3 cells lacking SERINC3, SERINC5, and CD4 (M3 triple-KO cells), Cas9/sgRNA complexes targeting CD4 (target sequence, 5′-GAGGTGCAATTGCTAGTGTT-3′) were delivered into MOLT-3 S3/5 double-KO cells by nucleofection. Clones obtained by limiting dilution were screened by flow cytometry after staining with anti-CD4 antibody (BioLegend; 300502) and PE-conjugated secondary antibody (Jackson ImmunoResearch; 115-116-146).
M3 triple-KO/CD4 and M3 triple-KO/CD4ΔCT cells were obtained by retroviral transduction of M3 triple-KO cells with pCXbsrCD4 and pCXbsrCD4ΔCT, respectively, followed by selection with blasticidin (5 μg/mL). The ectopic expression of CD4 or CD4ΔCT was confirmed by flow cytometry. To examine the effects of Nef on CD4 surface levels, M3 triple-KO/CD4 and M3 triple-KO/CD4ΔCT cells were transduced with empty MSCVpuro or MSCVpuroNefLAI, followed by selection with puromycin (1 μg/mL). To facilitate the entry of R5-tropic viruses, M3 triple-KO/CD4ΔCT cells were transduced with pCX4pur-synCCR5, followed by selection with puromycin (1 μg/mL).
M3 triple-KO cells expressing reduced amounts of the μ2 subunit of AP-2 (AP2M1) were obtained by delivering Cas9/sgRNA complexes targeting AP2M1 (target sequence, 5′-CGATGTCATCTCGGTAGACT-3′) into M3 triple-KO cells by nucleofection. Clones obtained by limiting dilution were screened by Western blotting with anti-AP50 (BD Biosciences; 611351) and anti-actin antibodies. To restore AP2M1 expression, clones expressing reduced amounts of AP2M1 were transduced with pCX4purAP2M1, followed by selection with puromycin (1 μg/mL).
Olety B., Usami Y., Wu Y., Peters P, & Göttlinger H. (2023). AP-2 Adaptor Complex-Dependent Enhancement of HIV-1 Replication by Nef in the Absence of the Nef/AP-2 Targets SERINC5 and CD4. mBio, 14(1), e03382-22.
Full text: Click here
Publication 2023
Actins Anti-Antibodies Antibodies, Anti-Idiotypic Cell Lines Cells Clone Cells Ectopic Gene Expression Flow Cytometry Immunoglobulins Medical Devices Molting PAK1 protein, human Plasmids Proteins Protein Subunits Puromycin Retroviridae Ribonucleotides Technique, Dilution Virus Internalization
3
In Vitro Transcription and RNA Purification
All RNA samples were prepared by T7 RNA polymerase (RNAP)-based in vitro transcription following well-established protocols [65 (link)]. In brief, transcriptions were carried out in 40 mM Tris-HCl (pH 8 at 37 °C), 1 mM spermidine, 0.01% Triton-X100, 80 mg/mL polyethylene glycol, 0.3 μM DNA templates (Integrated DNA Technology), 1 mM DTT, 2 U/µL thermostable inorganic pyrophosphatase (New England Biolabs, Ipswich, MA, USA), 5–15 mM ribonucleotide 5′-triphosphates (rNTPs), 5–15 mM MgCl2, and 0.1 mg/mL T7 RNAP. The reactions were first optimized for appropriate rNTP and MgCl2 concentrations at the small (50 µL) and medium (500 µL) scales before carrying out large-scale (5 mL) reactions. All transcriptions proceeded for 3 h at 37 °C. After transcription, the samples were extracted with acid phenol:chloroform, ethanol precipitated, purified by preparative denaturing polyacrylamide gel electrophoresis, and electroeluted. The samples were then dialyzed five times against UltraPure water and folded by heating for 2 min at 95 °C, snap-cooling on ice, and slowly equilibrating to room temperature.
Olenginski L.T., Kasprzak W.K., Attionu S.K., Shapiro B.A, & Dayie T.K. (2023). Virtual Screening of Hepatitis B Virus Pre-Genomic RNA as a Novel Therapeutic Target. Molecules, 28(4), 1803.
Full text: Click here
Publication 2023
bacteriophage T7 RNA polymerase Chloroform Ethanol hydroxybenzoic acid Magnesium Chloride Polyacrylamide Gel Electrophoresis Polyethylene Glycols Proton Translocating Pyrophosphatase Ribonucleotides Spermidine Transcription, Genetic triphosphate Triton X-100 Tromethamine
4
Quantifying Biomass Protein and RNA Content
Biomass samples for the estimation of the protein and RNA content were collected by centrifugation, washed with 0.9% NaCl, and stored at −70 °C before use.
The protein content in the biomass was estimated using a Bio-Rad DC Protein Assay kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions.
To separate two nucleic acids, RNA and DNA, the Schmidt−Tannhauser method was used [66 ]. At first, biomass samples were incubated with ice-cold 0.25 N HClO4 (1 mL) at 0 °C for 30 min to remove the low-weight cytoplasmic metabolites. During incubation, the test tubes containing the samples were gently mixed 2–3 times. Then, the biomass was collected at 8000× g for 3 min and incubated in 0.5 mL of 1 N KOH at 37 °C for 1 h, to hydrolyse the RNA to the monomers. The test tubes were mixed 2–3 times using a vortex. Then, the hydrolysed RNA was separated from the protein and DNA by adding ice-cold 3N HClO4 (0.5 mL) followed by centrifugation at 13,000× g for 5 min at 0 °C. The UV spectra of the obtained supernatants were recorded using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The RNA concentration (g/L) in the solution was calculated using the following formula [67 ,68 (link)]: C=OD270−OD290×10.30.19
where 0.19 is value of the (OD270−OD290) difference, which corresponds to nucleic acid hydrolysate with a nucleic acid phosphate concentration of 1 mg/L, and 10.3 is the average coefficient to transfer the phosphate amount to the ribonucleotides amount.
Malykh E.A., Golubeva L.I., Kovaleva E.S., Shupletsov M.S., Rodina E.V., Mashko S.V, & Stoynova N.V. (2023). H+-Translocating Membrane-Bound Pyrophosphatase from Rhodospirillum rubrum Fuels Escherichia coli Cells via an Alternative Pathway for Energy Generation. Microorganisms, 11(2), 294.
Full text: Click here
Publication 2023
Biological Assay Centrifugation Cold Temperature Cytoplasm Normal Saline Nucleic Acids Phosphates Proteins Ribonucleotides
5
Berberine Modulates Inflammatory Pathways
Berberine (633-65-8) was purchased from Chengdu Puth Biotechnology (China) with a purity of more than 98%. We also used: fetal bovine serum (FBS) (L20711 BI Transgen biotech, Australia); Dulbecco’s Modified Eagle Medium (DMEM) (2049231, BIOIND, Israel); Cell Counting Kit-8 (CCK-8) (DCM7126, Beijing Lambolid Trading, China); lipopolysaccharide (12190801, Beijing Trading, China); and TRIzol reagent (182806, Semel Fishi Technology, USA). MMP-1 (L2104850), MMP-3 (L201014164), RANKL (L201216066), and TNF-α (L201215056) were all purchased from Wuhan Yunkun Technology (China). We also used one-step removal of premixed reagent for first chain synthesis of genomic cDNA (U9126, Tiangen biochemical Technology, China) and PerfectStart Green qPCR SuperMix (+ Dye Ⅰ /+ Dye Ⅱ) (O10529, Beijing full Gold Biotechnology, China) in the RT-qPCR. Phosphorylase inhibitor (TargetMol, USA), bicinchoninic acid (BCA) protein concentration determination kit (Beijing Soleibao Technology, China), Oncogene homologue (GTPase Hras, HRAS) antibody (Beijing Boosen Biotechnology, China), cyclic adenine ribonucleotide dependent transcription factor 2 (ATF-2) antibody (Affinity, China), p-ATF-2 antibody (Affinity), p38 antibody (Beijing Boosen Biotechnology), p-p38 antibody (Affinity), MAPK1/2 antibody (Affinity); p-MAPK1/2 antibody (Affinity), FOXO3 antibody (Affinity), p-FOXO3 antibody (Affinity), HIF-1 α Antibody (Affinity), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (Proteintech, China), and sheep anti-rabbit-peroxidase (Beijing Boosen Biotechnology) were used in the western blot experiment.
Li Z., Chen M., Wang Z., Fan Q., Lin Z., Tao X., Wu J., Liu Z., Lin R, & Zhao C. (2023). Berberine inhibits RA-FLS cell proliferation and adhesion by regulating RAS/MAPK/FOXO/HIF-1 signal pathway in the treatment of rheumatoid arthritis. Bone & Joint Research, 12(2), 91-102.
Publication 2023
Adenine Anabolism Berberine bicinchoninic acid Cyclic AMP Response Element-Binding Protein A DNA, Complementary Domestic Sheep Eagle Fetal Bovine Serum Genome Glyceraldehyde-3-Phosphate Dehydrogenases Gold HNF1B protein, human HRAS protein, human Hypoxia-Inducible Factor 1 Immunoglobulins Interstitial Collagenase Lipopolysaccharides MAPK1 protein, human Matrix Metalloproteinase 3 Oncogenes Peroxidase Phosphorylases Proteins Rabbits Ribonucleotides TNFSF11 protein, human trizol Tumor Necrosis Factor-alpha Western Blotting

Top products related to «Ribonucleotides»

1
Lipofectamine rnaimax by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Switzerland, Denmark, Belgium, Italy, Australia, Singapore, Spain, Colombia, Sweden, Netherlands, New Zealand, Poland, Pakistan, Lithuania
Lipofectamine RNAiMAX is a transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and short hairpin RNA (shRNA) into a wide range of cell types. It is a cationic lipid-based formulation that facilitates the uptake of these nucleic acids into the target cells.
2
394dna rna synthesizer by Thermo Fisher Scientific
Sourced in United States
The 394DNA/RNA synthesizer is a laboratory instrument designed for the synthesis of DNA and RNA oligonucleotides. It automates the process of synthesizing these biomolecules, allowing for efficient and consistent production.
3
T7 rna polymerase by New England Biolabs
Sourced in United States, Germany, China, United Kingdom
T7 RNA polymerase is an enzyme that initiates and catalyzes the transcription of DNA to RNA. It is derived from the T7 bacteriophage and is commonly used in in vitro transcription systems to produce RNA from a DNA template.
4
Antarctic phosphatase by New England Biolabs
Sourced in United States, Germany, United Kingdom, Morocco
Antarctic Phosphatase is a thermolabile enzyme that catalyzes the hydrolysis of phosphate groups from various substrates, including nucleic acids and proteins. It is derived from Antarctic bacterial sources and exhibits optimal activity at lower temperatures compared to other phosphatases.
5
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
6
Ribonucleotide solution mix by New England Biolabs
Sourced in United States
The Ribonucleotide solution mix is a laboratory product designed to provide a balanced mixture of the four ribonucleotides (ATP, GTP, CTP, and UTP) for use in various molecular biology applications. This solution mix is suitable for use in in vitro transcription reactions, cDNA synthesis, and other RNA-based experimental procedures.
7
Rnasin by Promega
Sourced in United States, Germany, United Kingdom, France, Switzerland, Sweden, Japan
RNasin is a recombinant ribonuclease inhibitor protein that inhibits RNase activity. It is used to protect RNA from degradation during in vitro procedures.
8
Sybr gold by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Japan, China, Canada, Spain
SYBR Gold is a nucleic acid stain used for the detection and quantification of DNA and RNA in gel electrophoresis and other applications. It is a sensitive, fluorescent dye that binds to nucleic acids, allowing the visualization and analysis of DNA and RNA samples.
9
Triethylamine trihydrofluoride by Merck Group
Triethylamine trihydrofluoride is a colorless crystalline compound. It is a source of fluoride ions for various chemical reactions and processes.
10
Adenosine triphosphate (atp) by Thermo Fisher Scientific
Sourced in United States, Singapore, Germany
ATP is a laboratory instrument designed to measure the presence and quantity of adenosine triphosphate (ATP) in a sample. ATP is a crucial energy-carrying molecule found in all living cells, and its measurement can provide insights into the overall biological activity or contamination levels in a variety of sample types.

More about "Ribonucleotides"

Ribonucleotides are the fundamental building blocks of ribonucleic acid (RNA), a crucial molecule in genetic information transfer and protein synthesis.
These nucleotide molecules consist of a ribose sugar, a phosphate group, and one of four nitrogenous bases: adenine (A), guanine (G), cytosine (C), or uracil (U).
Ribonucleotides play a vital role in a variety of biological processes, including RNA synthesis, cellular signaling, and energy metabolism.
Understanding their structure, function, and regulation is crucial for advancing research in fields such as molecular biology, genetics, and biochemistry.
Researchers can leverage the power of AI-powered platforms like PubCompare.ai to optimize their ribonucleotide research protocols, enhance reproducibility, and identify the most effective approaches and products for their studies.
This cutting-edge technology can help take the guesswork out of ribonucleotide research and accelerate scientific discoveries.
To support ribonucleotide research, researchers may utilize various tools and reagents, such as Lipofectamine RNAiMAX for RNA interference, the 394DNA/RNA synthesizer for nucleic acid synthesis, T7 RNA polymerase for in vitro transcription, Antarctic Phosphatase for dephosphorylation, Lipofectamine 2000 for transfection, Ribonucleotide solution mix for RNA synthesis, RNasin for RNase inhibition, SYBR Gold for nucleic acid staining, and Triethylamine trihydrofluoride for RNA deprotection.
These products and tools can be leveraged to streamline and optimize ribonucleotide research workflows.
By combining the insights from the MeSH term description with the capabilities of AI-powered platforms and the wide range of available research tools, researchers can unlock new avenues for adnvancting our understanding of ribonucleotides and their critical role in biological processes.
This integrated approach can lead to groundbreaking discoveries and accelerate scientific progress in the field.