> Chemicals & Drugs > Nucleic Acid > RNA primers

← RNA II

RNA primers

RNA primers are short sequences of ribonucleic acid that serve as starting points for DNA synthesis in various biological processes.
These primers play a crucial role in reverse transcription, PCR amplification, and other molecular biology techniques.
They enable the replication and study of RNA molecules, facilitating research in areas such as gene expression, disease diagnostics, and therapeutic development.
RNA primers are designed to be complementary to specific target sequences, ensuring efficient and accurate nucleic acid amplification.
Proper selection and optimization of RNA primers is essential for reproducible and reliable results in RNA-based experiments.

Most cited protocols related to «RNA primers»

Quantitative Real-Time PCR for mRNA Expression

Cited 14 times

Total RNA was extracted using Trizol reagents (15596018, Invitrogen). Five hundred ng of DNA-free total RNA was utilized to perform the reverse transcription with the 2-step RT-PCR kit (Takara Bio Inc., Japan) [10 (link)]. The PCR reaction mixture contained 1× SYBR Master Mix (Applied Biosystem, 4309155, Foster City, CA), 500 ng RNA along with 200 nM primers. The ABI Prism 7300 Fast Real-Time quantitative PCR system (Shanghai, China) was utilized for PCR reactions. The ^ΔΔCt method was applied to quantify mRNA expression Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was tested as an internal control. Primers were described in our previous studies [6 (link), 10 (link)] and in published literatures [31 (link)].

Gong Y.Q., Huang W., Li K.R., Liu Y.Y., Cao G.F., Cao C, & Jiang Q. (2016). SC79 protects retinal pigment epithelium cells from UV radiation via activating Akt-Nrf2 signaling. Oncotarget, 7(37), 60123-60132.

Full text: Click here

Publication 2016

Glyceraldehyde-3-Phosphate Dehydrogenases Oligonucleotide Primers prisma Reverse Transcriptase Polymerase Chain Reaction Reverse Transcription RNA, Messenger RNA primers trizol

Quantifying Viral RNA Expression and Packaging

Cited 6 times

To test the relative levels of transfer vector RNAs expressed within the cytoplasm and packaged into the viral particles, a real time PCR custom expression assay was developed using the minor groove binding (MGB)/FAM and MGB/VIC chemistry from Applied Biosystems, USA. Additionally, the ABI real time PCR assays use ROX as an internal fluorescence reference dye to which the target reporter dye signal (either FAM or VIC, in our case) is normalized to during data analysis, to correct for fluorescence fluctuations caused by changes in concentration or volume. The PCR primers were designed to anneal within a region at the beginning of the MMTV U5 region (nt 1192–1259), a 68 nt region common to all the constructs, enabling their relative quantitative assessment using the same probe/primer combination concomitantly. The sequence of the probe and primers were as follows: Probe (MTV-1LTR-SITEM1 FAM): TCGCCATCCCGTCTCC (16-mer; nt 1214–1229); Forward primer (MTV-1LTR-SITEF): CGTCTCGTGTGTTTGTGTTTGTGTCTGT (22-mer; nt 1192–1213); Reverse primer (MTV-1LTR-SITER): CCTCTGGAAAGTGAAGGATAAGTGA (25-mer; nt 1259-1235). The assay was validated in silico using the Primer Express tool as well as the ABI design pipeline bioinformatic tools that ensure specificity, reproducibility, and amplification efficiency of the assay performance. Further validation of the PCR amplification efficiency was conducted by testing the assay using the online web tool “pcrEfficiency” [74] (link) that confirmed it to be over 100%. As an endogenous control, the optimized ß-actin MGB VIC-labeled assay (no 4326315E with limited primer concentration) from ABI was used (Applied Biosystems, USA).
To determine which method to use for the Relative Quantification analysis, the standard curve or the comparative (ΔΔCt) method, a 10- and serial 2-fold dilutions of a cDNA prepared from 293T cells expressing DA24 were tested in non-multiplex RT-PCRs in triplicates assuming conservatively that 1 ug of input RNA results in ∼100 ng of single stranded cDNA using random hexamers as primers and MMLV RT (Promega; Figure 3A and 3B). The resultant Ct values were plotted on a scatter plot against the pg of cDNA tested in each dilution in triplicates to generate standard curves for both assays (Figure 3C and 3D). This was followed by calculating the ΔCt values (Ct values from MMTV assay – Ct value of ß-actin endogenous control) which were plotted against the input cDNA to determine the slope of the curve (Figure 3E).
For the final relative quantification analysis, each viral RNA sample was tested in triplicates in multiple assays using the Taqman Universal Master Mix (Applied Biosystems and the 7500 Real Time PCR System (Applied Biosystems, USA), while the cytoplasmic RNA was tested in duplicates. As mentioned earlier for the cytoplasmic RNA fractions, 1/5^th of the total viral RNA preparations were first DNase-treated, confirmed for the absence of DNA by PCR using vector RNA specific primers, and then reverse transcribed into cDNA, as previously described [73] (link). Equal amounts of the resulting cDNAs were tested for vector expression in the cytoplasmic fractions as well as their packaging in the viral particles using the real time PCR assay and the following cycling conditions: an initial denaturation step of 10 minutes at 94°C followed by 40 cycles of denaturation and annealing/extension steps at 95°C for 15 secs and 60°C for 1 min. The relative packaging efficiency for each mutant transfer vector RNA was determined after normalization of the data with the endogenous control, ß-actin, as well as the control for transfection efficiency, luciferase expression.

Mustafa F., Al Amri D., Al Ali F., Al Sari N., Al Suwaidi S., Jayanth P., Philips P.S, & Rizvi T.A. (2012). Sequences within Both the 5′ UTR and Gag Are Required for Optimal In Vivo Packaging and Propagation of Mouse Mammary Tumor Virus (MMTV) Genomic RNA. PLoS ONE, 7(10), e47088.

Full text: Click here

Publication 2012

Actins Biological Assay Cloning Vectors Cytoplasm Deoxyribonuclease I DNA, Complementary Fluorescence Fluorescent Dyes HEK293 Cells Luciferases Mouse mammary tumor virus Oligonucleotide Primers Promega Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction RNA, Viral RNA primers Technique, Dilution Transfection Transfer RNA Virion

Cloning and Manipulation of Plant Constructs for Transient Expression

Cited 6 times

For the agroinfiltration assays, genes were cloned into the BIN61S binary vector between the 35S promoter and terminator sequences. Binary vectors contain all cis sequences required for Agrobacterium-mediated plant transformation or transient expression (37 (link)). P14 was previously described (38 (link)). Brief descriptions of cloning of unpublished constructs are given here, whereas primer sequences are available as Supplementary Figure 1.
To create binary PHA clone, PHA fragment was PCR amplified with PHA1-F/PHA2-R primers from common bean, cloned first to pBluescript KS, and then it was moved into BIN61S. PCR-based in vitro mutagenesis (PHA1mut-F/PHA2mut-R primers) of PHA was carried out with QuikChange Mutagenesis Kit (Stratagene) to create PHA-m. PHA-s, which contains the ORF of PHA-m from ATG to PTC, was PCR amplified from PHA-m (PHA1-F/PHA2mut-R primers), and then cloned into BIN61S. UPF1 was RT–PCR amplified (Stratagene, ProSTAR^®ULTRA HF RT–PCR System) from Arabidopsis thaliana leaf RNA with UPF1-F/UPF1-R primers, cloned into pBluescript KS (KSUPF1), and then UPF1 was moved into BIN61S. UPF1DN was obtained by introducing point mutations into KSUPF1 with R863C-F/R863C-R primers, and then the mutant fragment was cloned into BIN61S. To create GFP binary construct, GFP fragment lacking the endoplasmic retention signal was PCR amplified from 35SGFP construct (39 (link)) with mGFP4-F/mGFP4-R primers and cloned to BIN61S. abc, bc, c, b and a fragments were PCR amplified from PHA-m with PHAB1-F/PHAX1-R, PHAB2-F/PHAX1-R, PHAB3-F/PHAX1-R, PHAB2-F/PHAX2-R, PHAB1-F/PHAX3-R primers, respectively. These PCR products were cloned just downstream of the stop codon of binary GFP vector. P-G700, P-G500 and P-G300 PCR fragments were generated with GUS-F/GUS700-R, GUS-F/GUS500-R, GUS-F/GUS300-R primers, and then these fragments were cloned into PHA-s. ST-LS1 (referred to as Ls in this manuscript) intron was PCR amplified with Ls-F and Ls-R primers from GUS-intron construct (40 (link)), it was cloned into pBluescript KS (KSLs), and then it was moved downstream of GFP-c. To create P-99Ls, Ls fragment was cloned from KSLs into PHA-s-78 binary vector, which contained PHA-s ORF + 78 nt downstream of PTC. To obtain P-28Ls, PHA-s was cloned to KSLs and then PHA-sLs fragment was moved into BIN61S. To obtain P-28 and P-99 constructs, RT–PCR products were generated with pFF-R and pKS KpnI primers from RNA samples isolated from P-28Ls and P-99Ls infiltrated leaves, and then these fragments were cloned into BIN61S. λN fragment was PCR amplified with LN-F and LN-R primers from λN construct (41 (link)) and cloned into BIN61S. To obtain λN-UPF1, UPF1 from KSUPF1 was cloned into λN binary clone. BoxB tethering target sequence, which contains five direct repeats of boxB, was PCR amplified from 5boxB plasmid (41 (link)) with 5BB-F/5BB-R primers, and then it was cloned into the 3′-UTR region of GFP-c and PHA-s-78 binary constructs (GFP3′boxB and P-3′boxB). To create GFP5′boxB and P-5′boxB 5′-UTR tethering target plasmids, boxB was cloned into the 5′-UTR region of GFP and PHA-s binary vectors.

Kertész S., Kerényi Z., Mérai Z., Bartos I., Pálfy T., Barta E, & Silhavy D. (2006). Both introns and long 3′-UTRs operate as cis-acting elements to trigger nonsense-mediated decay in plants. Nucleic Acids Research, 34(21), 6147-6157.

Publication 2006

Agrobacterium Arabidopsis thalianas Biological Assay Cloning Vectors Codon, Terminator Direct Repeat Genes Introns Mutagenesis Oligonucleotide Primers phytohemagglutinin-M Plants Plasmids Point Mutation Retention (Psychology) Reverse Transcriptase Polymerase Chain Reaction RNA primers Terminator Regions, Genetic Transients

Massively Parallel scRNA-Seq of Bronchial Cells

Cited 5 times

Massively parallel scRNA-Seq of human bronchial airway cells was performed using a modified version of the CEL-Seq RNA library preparation protocol (20 (link)). For each of the 12 recruited donors, one frozen 96-well PCR plate containing sorted cells was thawed on ice, and RNA was directly reverse-transcribed (Thermo Fisher, AM1751) from whole-cell lysate using primers composed of an anchored poly(dT), the 5′ Illumina adaptor sequence, a six-nucleotide well-specific barcode, a five-nucleotide unique molecular identifier (UMI), and a T7 RNA polymerase promoter. All primer sequences were listed in extended table S1. Samples were additionally supplemented with ERCC RNA Spike-In Mix (1:1,000,000 dilution; Thermo Fisher, 4456740) for quality control. Complementary DNA generated from each of the 96 wells per plate was pooled, subjected to second-strand synthesis (Thermo Fisher, AM1751), and amplified by in vitro transcription (Thermo Fisher, AM1751). Amplified RNA was chemically fragmented (New England BioLabs, E6150) and ligated to an Illumina RNA 3′ adapter (Illumina, RS-200-0012). Samples were again reverse-transcribed using a 3′ adaptor-specific primer and amplified using indexed Illumina RNA PCR primers (Illumina, RS-200-0012). In total, 1152 samples (1008 epithelial cells, 132 WBCs, and 12 negative controls) were sequenced on an Illumina HiSeq 2500 in rapid mode, generating paired-end reads (15 nucleotides for read 1, 7 nucleotides for index, and 52 nucleotides for read 2).

Duclos G.E., Teixeira V.H., Autissier P., Gesthalter Y.B., Reinders-Luinge M.A., Terrano R., Dumas Y.M., Liu G., Mazzilli S.A., Brandsma C.A., van den Berge M., Janes S.M., Timens W., Lenburg M.E., Spira A., Campbell J.D, & Beane J. (2019). Characterizing smoking-induced transcriptional heterogeneity in the human bronchial epithelium at single-cell resolution. Science Advances, 5(12), eaaw3413.

Publication 2019

Anabolism bacteriophage T7 RNA polymerase Bronchi Cells DNA, Complementary DNA Library Donors Epithelial Cells Freezing Homo sapiens Leukocytes Nucleotides Oligonucleotide Primers Poly T RNA-Seq RNA primers Single-Cell RNA-Seq Technique, Dilution Transcription, Genetic

RNA-Seq Library Preparation Protocol

Cited 5 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2011

cDNA Library DNA, Complementary Electrophoresis endopolyphosphatase Exonuclease Ligation Nucleotides Oligonucleotide Primers Phosphates Phosphoric Monoester Hydrolases Reverse Transcription Ribonuclease H Ribosomal RNA RNA primers triphosphate Urea Whole Transcriptome Sequencing

Most recents protocols related to «RNA primers»

CRISPR/Cas9-mediated gene deletion in Trypanosoma brucei

Clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 genome editing was used to delete candidate genes⁹⁷. PCF TREU927 1339 cells that express T7 RNA polymerase, tet repressor and Cas9 were used^{98 (link)}. Deletion primers and guide RNA primers were designed using the LeishGedit website and used to amplify constructs containing resistance markers with homology arms to the specific genes and specific guide RNAs (primer sequences in Supplementary Table 6). Plasmids pPOTv7-mNG-hyg and pPOTv7-mNG-bsr were used as the template for the deletion constructs. Gene deletion was confirmed by PCR from genomic DNA, using primers in the deleted gene ORF (Supplementary Table 6). Growth was monitored using a Z2 Coulter Counter. For growth curves, cell density was measured every 24 h over a 96 h period, with cells subcultured every 24 h to 2 × 10⁶ cells ml⁻¹. Microscopy was carried out on live cells. Cells were washed two times with Dulbecco’s Modified Eagle Medium (phenol red free) and 500 ng ml⁻¹ Hoechst 33342 was included in the first wash to stain the DNA^{79 (link)}. Micrographs were captured on a Leica DM5500 B epifluorescence microscope with a 100 W mercury arc lamp and either a 63× NA1.4 oil immersion objective and an Andor Neo 5.5 sCMOS camera running in 16-bit high well capacity mode, using Micromanager⁸⁰. mNG fluorescence was captured where applicable using the L5 filter cube, excitation 480/40 nm, dichroic 505 nm and emission 527/30 nm. Using these micrographs, the cell cycle staging for each cell line was analysed by categorizing cells on the basis of the number of kinetoplasts and nuclei.

Billington K., Halliday C., Madden R., Dyer P., Barker A.R., Moreira-Leite F.F., Carrington M., Vaughan S., Hertz-Fowler C., Dean S., Sunter J.D., Wheeler R.J, & Gull K. (2023). Genome-wide subcellular protein map for the flagellate parasite Trypanosoma brucei. Nature Microbiology, 8(3), 533-547.

Full text: Click here

Publication 2023

Arm, Upper bacteriophage T7 RNA polymerase Cell Nucleus Cells Clustered Regularly Interspaced Short Palindromic Repeats Deletion Mutation Eagle Fluorescence Gene Deletion Genes Genome HOE 33342 Mercury Microscopy Oligonucleotide Primers Plasmids RNA RNA primers Stains Submersion tetracycline resistance-encoding transposon repressor protein

RT-qPCR Gene Expression Quantification

Gene expression levels in tissues and cells were measured by real-time fluorescent quantitative PCR quantitative reverse transcription PCR (RT qPCR). TRIzol reagent (Invitrogen, USA) was used to extract total RNA from cells and tissues, and purity and concentration were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). RT reactions and RT-qPCR were performed using the reverse transcription system kit (GenStar, Beijing, China), and the reverse transcription procedure was accomplished in two steps. General Biotech Co., Ltd. (Shanghai, China) provided all of the RNA primers. Supplementary Table S1 listed the mRNA primer sequences for candidate genes and housekeeping genes. The comparative Ct (cycle threshold) was used for the comparison of gene expression, and the relative mRNA expression value was calculated as 40^−ΔCt [38 (link)].

Ge Y., Zhang Y., Yang S., Liu T., Zhang T., Feng Y., Wang C, & Liang G. (2023). The Comprehensive Analysis of N6-Methyadenosine Writer METTL3 and METTL14 in Gastric Cancer. Journal of Oncology, 2023, 9822995.

Full text: Click here

Publication 2023

Cells Gene Expression Genes Genes, Housekeeping Oligonucleotide Primers Real-Time Polymerase Chain Reaction Reverse Transcription RNA, Messenger RNA primers Tissues trizol

Quantification of MERS-CoV Virion and RNA

To determine virus titers, lungs were weighed and placed in a gentleMACS M Tube (Miltenyi Biotec) containing 2 ml of PBS with 100 units/ml penicillin, 100 units/ml streptomycin (Lonza), 50 µg/ml gentamycin (Sigma-Aldrich), and 0.25 µg/ml Fungizone (Gibco). Lung tissues were homogenized with the gentleMACS dissociator by running program Lung_02 (Miltenyi Biotec, Inc.). Supernatants from homogenized samples were pre-clarified at 300 × g for 1 min and then further centrifuged at 10,000 × g for 5 min. Thereafter, infectious virions in the lung were determined by plaque assay on Huh7 cells (JCRB, No. JCRB0403) as described above and expressed as PFU/g lung for MERS-CoV. The quantification of MERS-CoV viral RNA was performed using lung homogenates lysed with TriPure isolation reagent (Roche Applied Science) in gentleMACS M Tubes (Miltenyi Biotec) according to the manufacturer’s instructions. The subgenomic mRNA PCR primers (forward- GTACCTCTTAATGCCAATTC- and reverse- GAGCCAGTTGCxTTAATTC) and probe (TexasRed/TCTGTCCTGTCTCCGCCAATAC /BHQ2) targeting the nucleocapsid (N) protein gene and the genomic RNA PCR primers (forward- CCGACTCTCTTTAGACTTA- and reverse- ACAGCATGAATGTTGTAC) and probe (FAM/TAACACTTCTTACAGCAGCAACCTC/BHQ1) targeting ORF1a (nsp2-3 cleavage site region) were used. Samples were assayed by TaqMan multiplex real-time PCR using TaqMan Universal Master Mix II and a CFX384 Touch real-time PCR detection system (Bio-Rad). A standard curve was obtained using an in vitro transcript derived from a synthetic plasmid that contained all PCR targets. Each RNA sample was analyzed in triplicate.

Myeni S.K., Bredenbeek P.J., Knaap R.C., Dalebout T.J., Morales S.T., Sidorov I.A., Linger M.E., Oreshkova N., van Zanen-Gerhardt S., Zander S.A., Enjuanes L., Sola I., Snijder E.J, & Kikkert M. (2023). Engineering potent live attenuated coronavirus vaccines by targeted inactivation of the immune evasive viral deubiquitinase. Nature Communications, 14, 1141.

Full text: Click here

Publication 2023

Cells Cytokinesis Dental Plaque Fungizone Gene Products, Protein Genes Genome Gentamicin Infection isolation Lung Middle East Respiratory Syndrome Coronavirus Nucleocapsid nucleoprotein, Measles virus Oligonucleotide Primers Penicillins Plasmids Real-Time Polymerase Chain Reaction RNA, Viral RNA primers Streptomycin Subgenomic RNA Tissues Touch Virion

Methylation Analysis of NT5DC3 Gene

DNA methylation region of NT5DC3 (5mC, CpG island 1) determination and primer design principles: DNA sequence of NT5DC3 (GenBank Reference Sequence: NM_001031701.3) was harvested using NCBI website and MethPrimer (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi) was utilized for CpG island prediction (CpG island 1: 47–295 bp) and primer design. When DNA is subjected to bisulfite conversion, the bisulfite-sensitive unmodified cytosines (C) are converted to uracils (U) and further replaced by thymidines (T) in PCR amplification, while the methylated cytosines (5mC) could survive the bisulfite conversion and remain unchanged. From the primer candidates provided by MethPrimer, one pair with a high GC content and an annealing temperature close to 60 °C was chosen as the general primers for assessing the methylation status of the predicted CpG island 1 of NT5DC3 (Additional file 5: Table S2).
Protocols of DNA methylation site (5mC CpG island 1) detection: Genomic DNA (gDNA) was extracted using a DNeasy Blood & Tissue Kit (QIAGEN). 1 μg gDNA of each sample, respectively, was subjected to bisulfite conversion using a DNA bisulfite conversion kit (QIAGEN) following the manufacturers' instructions. A thermocycler was used for the conversion with the following procedure: 95 °C for 10 min and 64 °C for 60 min. After bisulfite conversion, gDNA was purified and used for PCR analysis. The specific primers used were listed in Additional file 5: Table S2. The methylation rate was calculated using the ΔΔCt method: methylation rate (%) = 100%/2^ΔΔCt.
RNA methylation site of NT5DC3 (m⁶A, 2309) determination and primer design principles: DNA sequence of NT5DC3 (GenBank Reference Sequence: NM_001031701.3) was firstly harvested using the NCBI website, and three kinds of sequence that could undergo m⁶A methylation, namely GGACU(T), GAACU(T) and GAACA, were screened. Furthermore, the m⁶AVar database (http://m6avar.renlab.org/index.html) was utilized for the m⁶A site prediction, and chr12:101471023( +), namely m⁶A 2309, was finally chosen for the following investigation (labeled as site X). The nearest adenine (A) on the 5’ upstream of and at least six bases away from the site X was labeled as site N. The RNA methylation-specific primers for both site X and N were designed, respectively. Site X was regarded methylated if the Ct value in site X PCR detection was larger than that in site N detection.

Li H., Li C., Zhang B, & Jiang H. (2023). Lactoferrin suppresses the progression of colon cancer under hyperglycemia by targeting WTAP/m6A/NT5DC3/HKDC1 axis. Journal of Translational Medicine, 21, 156.

Full text: Click here

Publication 2023

Adenine BLOOD CpG Islands Cytosine DNA, A-Form DNA Methylation Genome hydrogen sulfite Methylation Oligonucleotide Primers RNA primers Thymidine Tissues Uracil

Nested 12S Metabarcoding for Environmental DNA

Library preparation was carried out following an established 12 S metabarcoding workflow previously developed at the University of Hull, the full protocol applied in this study can be viewed in Appendix S1, however, is summarized below:
Nested metabarcoding of DNA samples using a two‐step PCR protocol was performed at CUT, using multiplex identification (MID) tags in the first and second PCR steps as described in Kitson et al. (2019 (link)). PCR1 was performed in triplicate (3x PCR replicates per sample), amplifying a 106 bp fragment using published 12 S ribosomal RNA (rRNA) primers 12 S‐V5‐F (5′‐ACTGGGATTAGATACCCC‐3′) and 12 S‐V5‐R (5′‐TAGAACAGGCTCCTCTAG‐3′) (Kelly et al., 2014 (link); Riaz et al., 2011 (link)). Alongside DNA extracts PCR‐negative controls (Molecular Grade Water) were used throughout, and positive controls (DNA (0.05 ng μL⁻¹) from the non‐native cichlid Maylandia zebra) were added to each plate outside of the eDNA prep area. All PCR replicates from each plate were pooled together to create sub‐libraries and purified with MagBIND RxnPure Plus magnetic beads (Omega Bio‐tek Inc.), following a double size selection protocol (Quail et al., 2009 (link)). Following this, a second shuttle PCR (PCR2) was performed on the PCR1 cleaned products to bind uniquely indexed Illumina adapters to each sub‐library. A second purification was then carried out on the PCR2 products with the Mag‐BIND RxnPure Plus magnetic beads (Omega Bio‐tek Inc.). Eluted DNA was then stored at 4°C until quantification and normalization. After normalization and pooling, the final library was then purified again (following the same protocol as the second clean‐up), quantified by qPCR using the NEBNext Library Quant Kit for Illumina (New England Biolabs Inc., Ipswich, MA, USA) and diluted to 4 nM. The final library was then loaded (with 10% PhiX) and sequenced on an Illumina MiSeq using a MiSeq Reagent Kit v3 (600 cycle) (Illumina Inc.) at CUT.
Sub‐library sequence reads were demultiplexed to sample level using a custom Python script. Tapirs, a reproducible workflow for the analysis of DNA metabarcoding data (https://github.com/EvoHull/Tapirs), was then used for taxonomic assignment of demultiplexed sequence reads. Reads were quality trimmed, merged, and clustered before taxonomic assignment against a curated national fish reference database. Taxonomic assignment used a lowest common ancestor approach based on basic local alignment search tool (BLAST) matches with minimum identity set at 98%. The full bioinformatics workflow is detailed in Appendix S1.

Griffiths N.P., Wright R.M., Hänfling B., Bolland J.D., Drakou K., Sellers G.S., Zogaris S., Tziortzis I., Dörflinger G, & Vasquez M.I. (2023). Integrating environmental DNA monitoring to inform eel (Anguilla anguilla) status in freshwaters at their easternmost range—A case study in Cyprus. Ecology and Evolution, 13(2), e9800.

Full text: Click here

Publication 2023

Cichlids DNA, A-Form DNA, Environmental DNA Library Fishes Python Quail Ribosomes RNA primers Zebras

Top products related to «RNA primers»

Trizol reagent by Thermo Fisher Scientific

Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand

TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.

Rneasy mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway

The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

Trizol by Thermo Fisher Scientific

Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Spain, Australia, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines

TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.

High capacity cdna reverse transcription kit by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia

The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.

Truseq small rna primers by Illumina

Sourced in Netherlands, United States

The TruSeq small RNA primers are a set of oligonucleotide sequences designed for the library preparation and sequencing of small RNA molecules, such as microRNAs, small interfering RNAs, and Piwi-interacting RNAs. The primers are used in the Illumina TruSeq small RNA library preparation workflow to enable the amplification and adapter ligation of small RNA targets prior to sequencing.

Primescript rt reagent kit by Takara Bio

Sourced in Japan, China, United States, France, Germany, Switzerland, Canada, Sweden, Puerto Rico, Singapore

The PrimeScript RT reagent kit is a reverse transcription kit designed for the synthesis of first-strand cDNA from RNA templates. The kit includes RNase-free reagents and enzymes necessary for the reverse transcription process.

Rneasy kit by Qiagen

Sourced in Germany, United States, United Kingdom, Spain, Netherlands, Canada, France, Japan, China, Italy, Switzerland, Australia, Sweden, India, Singapore, Denmark, Belgium

The RNeasy kit is a laboratory equipment product that is designed for the extraction and purification of ribonucleic acid (RNA) from various biological samples. It utilizes a silica-membrane-based technology to efficiently capture and isolate RNA molecules.

Sybr premix ex taq by Takara Bio

Sourced in Japan, China, United States, Switzerland, Germany, Australia, Canada, United Kingdom, France, Singapore, Puerto Rico, Sweden

SYBR Premix Ex Taq is a ready-to-use solution for real-time PCR amplification and detection. It contains all the necessary components, including DNA polymerase, dNTPs, and SYBR Green I dye, for efficient and accurate gene quantification.

Viia 7 real time pcr system by Thermo Fisher Scientific

Sourced in United States, Japan, Germany, China, United Kingdom, Australia, Switzerland, Canada, Netherlands, Belgium, Singapore, Spain, Denmark, Sweden

The ViiA 7 Real-Time PCR System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It provides precise quantification of DNA, RNA, and gene expression levels. The system features multi-color detection capabilities, flexible experiment setup, and intuitive software for data analysis.

Iscript cdna synthesis kit by Bio-Rad

Sourced in United States, Germany, Italy, Canada, United Kingdom, France, Netherlands, Switzerland, Sweden, Belgium, Australia, Japan, China, India, Spain, Denmark, Austria, Norway

The IScript cDNA Synthesis Kit is a reagent kit used for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains all the necessary components to perform this reaction, including a reverse transcriptase enzyme, reaction buffer, and oligo(dT) primers.

More about "RNA primers"

RNA primers are short sequences of ribonucleic acid that serve as essential starting points for DNA synthesis in various biological processes.
These primers play a crucial role in reverse transcription, PCR amplification, and other molecular biology techniques.
They enable the replication and study of RNA molecules, facilitating research in areas such as gene expression, disease diagnostics, and therapeutic development.
RNA primers are designed to be complementary to specific target sequences, ensuring efficient and accurate nucleic acid amplification.
Proper selection and optimization of RNA primers is essential for reproducible and reliable results in RNA-based experiments.
The TRIzol reagent and RNeasy Mini Kit are commonly used for RNA extraction, while the High-Capacity cDNA Reverse Transcription Kit and PrimeScript RT reagent kit are utilized for cDNA synthesis.
TruSeq small RNA primers are often employed in small RNA sequencing, and the SYBR Premix Ex Taq and ViiA 7 Real-Time PCR System are used for quantitative real-time PCR analysis.
The RNeasy kit is another popular tool for purifying and concentrating RNA samples.
The IScript cDNA synthesis kit can also be used to generate high-quality cDNA from RNA templates.
Optimizing RNA primer design and selection is crucial for maximizing research efficiency and achieving consistent results.
PubCompare.ai's AI-powered tools can help researchers locate the best protocols from literature, pre-prints, and patents, enhancing RNA primer research reproducibility.
By leveraging these resources, researchers can unlcok new insights and advance their studies in gene expression, disease diagnostics, and therapeutic development.