1,3,6,8-pyrene tetrasulfonate

In vitro transcription of DNA templates was carried out with 20–40 U of T7 RNA polymerase per reaction and α-³²P UTP (800 Ci·mmol⁻¹; 10 mCi·ml⁻¹). Probes for TS and GFP siRNA were generated by in vitro transcription reactions from plasmid templates [500 μg ml⁻¹ of pTSa linearized with Sal1 or pKSGFP5 as described in (11 (link))]. These reactions were supplemented with 100 μM unlabelled UTP and carried out at 37°C. Where oligonucleotide or ‘mirVana’ templates were used, the only source of UTP was from the radioactively labelled solution ([final] = ∼3 μM). Templates to make probes for mmu-mir-292-as, mmu-mir-294, hsa-mir-21, hsa-mir-16 were prepared using the mirVana™ miRNA Probe Construction Kit (Ambion, USA) with oligonucleotides aagtgccgccaggttttgagtgtcctgtctc (mmu-mir-292as), aaagtgcttcccttttgtgtgtcctgtctc (mmu-mir-294), tagcagcacgtaaatattggcgcctgtctc (hsa-mir-16) and tagcttatcagactgatgttgacctgtctc (hsa-mir-21) respectively according to the manufacturer's instructions. Resulting templates were used for RNA probe synthesis following manufacturer's instructions. The probes for ath-mir-159b and pi-R1 were prepared by annealing oligonucleotides aagagctcccttcaatccaaacctatagtgagtcgtatta (ath-mir-159) or tgacatgaacacaggtgctcagatagctttcctatagtgagtcgtatta (pi-R1) with the oligonucleotide taatacgactcactatagg. These were used at 250 nM as templates for in vitro transcription with α-³²P UTP by T7 RNA polymerase at 22°C.
All in vitro transcriptions were treated with TurboDNAse® (Ambion) prior to addition to the hybridization solution to eliminate the DNA template.
End-labelling of oligonucleotides: (1 pmol per labelling) with or without LNA modifications were carried out with T4 polynucleotide kinase and γ³²P ATP (6000 Ci·m mol⁻¹; 10 mCi·ml⁻¹). Pre-designed LNA oligonucleotides for hsa-mir-21 and hsa-mir-16 were obtained from Exiqon (Denmark). Unmodified oligonucleotide probe sequences were 5′ tcaacatcagtctgataagcta 3′ (hsa-mir-21) and 5′ cgccaatatttacgtgctgcta 3′ (hsa-mir-16) (Sigma).

The preparation procedure of DES has been described in detail in our previous study,⁵⁸ and it can be found in ESI.† Experiments of selecting catalyst were carried out, and results showed that DES (BAC–PTSA) prepared by BAC and PTSA with a molar ratio of 1 exhibited the best catalysis effect for PVB synthesis. The detailed results and the characterization of DES are shown in ESI.†

To evaluate the catalytic performance of DES, BAC–PTSA and HCl were used as the catalyst to synthesize PVB, and the dosage of the catalyst was determined by the pH of the system (adjusted to ∼1.5). For these two catalysts, the dosage of SDS (m_SDS/m_PVA) is 0.01 and 0.03, respectively, and the samples obtained are named PVB–DES and PVB–HCl, respectively. The AD values of the samples were determined to be almost identical (∼80%). The SEM images of the two samples are shown in Fig. 2. Interestingly, despite the much lower amount of surfactant, PVB products with the smaller particle size were obtained with the presence of DES. Specifically, the d_p was measured to be ∼6.6 μm (PVB–HCl) and ∼4.2 μm (PVB–DES) respectively. The results indicated that DES played a dual role in catalysis and dispersion in the synthesis of PVB, and it was selected as the catalyst to synthesize PVB in this study.

PVA (MW 24 000–24 500 g mol⁻¹, hydrolysis degree of 99.0%) and ethanol (99.5%) were supplied by Shanghai Macklin Biochemical Co., Ltd. n-Butanal (99.5%) was got from Shanghai Mairuier Chemical Technology Co., Ltd. Benzyltrimethylammonium chloride (BAC, 98.0%) was got from Shanghai Di Bo Chemical Co., Ltd. p-Toluenesulfonic acid monohydrate (PTSA, 99.0%) was got from Shanghai Aladdin Biochemical Technology Co., Ltd. Sodium dodecyl sulfonate (SDS, 97.0%) and sodium hydroxide (NaOH, 98.0%) was supplied by Sinopharm Chemical Reagent Co., Ltd. Hydrochloric acid (HCl, 36–38%) and hydroxylamine hydrochloride (98.5%) were bought from Shanghai Titan Scientific Co., Ltd.