3'-deoxy-5-(cyanine dye 5)uridine 5'-trisphosphate

For the self versus self hybridizations, custom cDNA microarray experiments proceed as follows. Altogether, three microarray hybridizations were performed using custom printed cDNA microarray slides from the same print batch. Labelling, hybridization and washing were done as described previously by Monni et al. [40 (link)] and Järvinen et al. [20 (link)]. Briefly, total RNA was extracted from cell lines BT-474, HBL-100, and MCF-7 and labelled with Cy3-dUTP and Cy5-dUTP (Amersham Biosciences, Piscataway, NJ). The custom printed cDNA microarrays comprised of 11,520 clones from Incyte Genomics IRAL cDNA library and 1,136 clones from Research Genetics library. Microarrays were printed on poly-l-lysine coated slides using an Omnigrid arrayer (GeneMachines) as described previously [20 (link)]. Microarrays were scanned with an Agilent laser confocal scanner (Agilent Technologies, Palo Alto, CA) and gridded using the DEARRAY software developed by Chen et al. [29 (link)]. For the four breast cancer cell lines, custom cDNA microarray experiments were provided in a separate contribution by Järvinen et al. [20 (link)] and detailed protocols are described in that work. The relevant genes in our study were verified using RT-PCR in a parallel study by Hyman et al. [35 (link)].

A total of 851 BAC clones from the RH map were also localized by multi-color FISH analysis. DNA from each clone was prepared from 2.5 ml cultures using a BAC RealPrep (Qiagen, Valencia, CA) protocol. Two hundred nanograms from each sample were labeled using nick translation to incorporate one of five fluorochromes, Spectrum Red/Orange/Green dUTP (Vysis, Downers Grove, IL), diethylaminomethylcoumarin (DEAC)-5-dUTP (NEN/Perkin Elmer Life Sciences, Boston, MA), or Cy5-dUTP (Amersham Biosciences, Piscataway, NJ). Typically, 25 ng of each of five differentially labeled probes were pooled and precipitated in the presence of 15 μg of sonicated genomic dog DNA as competitor. Chromosome preparation, probe hybridization and post hybridization washes were performed as described previously [35 (link),36 (link)]. Chromosomes were counterstained in 80 ng/ml 4', 6-diamidino-2-phenylindole (DAPI) and mounted in anti-fade solution (Vectashield, Vector Laboratories, Burlingame, CA). Images were acquired and processed using a multi-color FISH workstation comprising a fluorescence microscope (Axioplan 2ie, Zeiss) equipped with narrow pass filter sets and a cooled CCD camera (CoolSnapHQ, Photometrics, Tuscon, AZ) both driven by dedicated software (SmartCapture 2.3.1 Digital Scientific, Cambridge, U.K.). The digital image of each DAPI stained metaphase spread was processed using a high-pass spatial filter to reveal enhanced DAPI bands. Clones were assigned to a chromosome region according to the DAPI banded nomenclature of Breen et al. [35 (link),36 (link)]. Refinement of probe order along the length of each chromosome was made by subsequent rehybridization to elongated canine chromosome preparations and/or by reference to interphase FISH analysis. Additional information may be found at .

A custom SNP microarray designed in our previous studies was used to detect the genomic alterations in diploid strains [31 (link),43 (link)]. In brief, the control DNA extracted from the heterozygous strain JSC24-2 was labeled with Cy3-dUTP, and the experimental DNA was labeled with Cy5-dUTP. The labeled DNA was mixed and competitively hybridized at 62°C. A GenePix scanner and GenePix Pro-6.1 software were used to examine the ratio of hybridization of the control and experimental DNA. The designs of the array are on the Gene Expression Omnibus (GEO) dataset, with the accession number of GPL20144.

Purification: For the detection of the Cy5 molecules, incorporated during RPA, by gel electrophoresis and fluorescence spectroscopy, the RPA products were previously purified using magnetic beads. For this purpose, the Mag-Bind® Total Pure NGS Kit (Omega Bio-Tek; M1378-01) was used according to the manufacturer's instructions. The elution step was performed in 25 µl ddH₂O.
Gel electrophoresis: To view the labelled and unlabelled amplicons, they were separated and analysed according to their size after RPA and appropriate purification on a 2% agarose gel in 1 × TAE buffer (50 × TAE-buffer; PanReac AppliChem; A1691). For detection of all bands and markers, 2 µl peqGreen was added to the gel (VWR; 732–3196). To 15 µl of each DNA-sample, 3 µl of DNA Gel Loading Dye (6 x) (Thermo Fisher Scientific; R0611) was added and electrophoresis was performed at 120 V for 1.5 h. Gene Ruler Low Range DNA Ladder (Thermo Fisher; SM1193) and peqGOLD DNA-ladder mix (VWR; 25–2040) came into use for the size assignment of the gel bands. For the detection of the gels the LS Reloaded Microarray Scanner (Tecan) was used. Here, a custom 3D-printed holder for the gels was used. With this modified method, both the green channel for the recognition of the DNA intercalator (excitation at 532 nm) and the red channel (excitation at 633 nm) for the incorporated Cy5 molecules could be analysed under the same conditions at the same time.
Fluorescent spectroscopy: For the determination of the incorporation rates of Cy5 molecules into the RPA products, 20 µl of each previously purified sample was analysed in FLUOstar Omega (BMG Labtech). Excitation at 620 nm and a 680 nm emission filter were used. For the calibration line needed to calculate the incorporation rates, a Cy5-dUTP dilution series in the range of 2.0–20.0 µM was measured under the same conditions.

RPA and DNA-Template: In this study, RPA was performed using the TwistAMP^® Liquid Basic Kit (TwistDxTM Limited; TALQBAS01) according to the manufacturer's instructions. Any modifications are noted at the appropriate point. Amplification took place for 60 min during the incorporation rate studies and for 40 min during the microarray experiments. The volume of the reaction mixture was 25.5 µl. For the multiplex microarray experiments, genomic DNA prepared and provided by the Robert Koch Institute was used with resistance genes from different pathogens (bla_CTX-M15 [E. coli; 735/14–1], bla_NDM [E. coli; 2/10], bla_VIM [P. aeruginosa; 359/11]; bla_KPC [E. coli; 17/11]) and concentrations up to 1 ng/µl (Table 1). The corresponding concentrations are given in the associated results section. Purified PCR template with a concentration of 1 ng/µl to 1.5 ng/µl was used for the general study of incorporation rates and singleplex RPA.Table 1

List of organisms and primer. Illustration of the organisms used in this study including the target resistance gene and the RPA primer.

Organism	Isolate no	Resistance gene	Primer	Sequence	Fragment [bp]
E. coli	2/10	NDM-1	NDM-R *	CAAGCTGGTTCGACAACGCATTGGCAT	220
			NDM-F *	CAACGGTTTGATCGTCAGGGATGGCGG
P. aeruginosa	359/11	VIM-2	VIM-F *	TGGTCTCATTGTCCGTGATGGTGATGAGTTGCT	191
			VIM-R *	TACGTTGCCACCCCAGCCGCCCGAAGGACATC
E. coli	17/11	KPC-2	KPC-F *	CATTCGCTAAACTCGAACAGGACTTTG	809
			KPC-R *	CCAATAGATGATTTTCAGAGCCTTACTG
E. coli	735/14–1	CTX-M15	CTX-M15-F *	TCACGCTGTTGTTAGGAAGTGTGCCGCTGTATGC	141
			CTX-M15-R *	CGATAAAGTATTTGCGAATTATCTGCTGTGT

The isolate number refers to the nomenclature of the Robert Koch Institute. All primer were synthesized and provided by metabion international AG. (*reference: Warmt et al.^{33 (link)}).

Cy5 labelling: For labelling the amplicons with Cy5 fluorescent label, either 5-(3-aminoallyl)-2'-deoxyuridine-5'-triphosphate (Cy5-dUTP) from Jena Bioscience (NU-803-XX-CY5-S) or primer labelled at the 5'-end from metabion international AG were chosen. Again, the respective concentrations are listed at the corresponding position in the results section.