Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > 6-carboxyfluorescein

6-carboxyfluorescein

6-carboxyfluorescein is a fluorescent dye commonly used in biochemical and biomedical research.
It serves as a tracer, labeling agent, and signaling molecule in various experimental applications.
PubCompare.ai's AI-driven platform can optimize your 6-carboxyfluorescein research by identifying the most effective protocols from literature, preprints, and patents.
Leverage our analyss to locate the best products and procedures for your 6-carboxyfluorescein experiments, helping you achieve robust and reliable results.
Streamline your research with our user-friendly tools and expert insights.

Most cited protocols related to «6-carboxyfluorescein»

1
Quantifying Pfmdr1 Copy Number via qPCR
Cited 39 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2004
5-carboxy-X-rhodamine 6-carboxyfluorescein 6-carboxytetramethylrhodamine Biological Assay Buffers Clone Cells DNA-Directed DNA Polymerase factor A Fluorescence Gene Amplification Genome Glycerin Kinetics Magnesium Chloride Multiplex Polymerase Chain Reaction Oligonucleotide Primers prisma Real-Time Polymerase Chain Reaction Tubulin
2
Quantitative RT-PCR Analysis of c-MYB Expression
Cited 27 times
Total RNA was isolated from cells harvested after 24, 72 and 96 h using an RNeasy mini Kit (Qiagen Scientifics, MD) according to the manufacturer's instructions. Reverse transcription was carried out with an Iscript reverse transcription kit (BioRad, Hercules, CA). The resulting cDNA was used as a template for QRT-PCR, which was performed using TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA) and iCycler iQ Real-Time PCR Detection System (BioRad).
For c-MYB PCR the following primers were used: forward, dGAAGGTCGAACAGGAAGGTTATCT; and reverse, dGTAACGCTACAGGGTATGGAACA.
The c-MYB probe was labeled with reporter dye: 6-carboxyfluorescein (FAM) at the 5′ end and Black Hole quencher at 3′ end. The probe sequence was dTCAAAAGCCAGCCAGCCAGCAGTG.
The GAPDH was employed as a reporter gene for QRT-PCR. The product was obtained with the following primers: forward, dGACAGTCAGCCGCATCTTCTT; and reverse, dCCAATACGACCAAATCCGTTGAC.
The GAPDH probe was labeled with reporter dye: 6-carboxyfluorescein (FAM) at 5′ end and Black Hole quencher at 3′ end.
The probe sequence was dCGTCGCCAGCCGAGCCACATCG.
All reactions were performed in triplicates with 1 µl of cDNA. The volume of reaction mixture was 15 µl. The reaction mixture was pre-incubated at 50°C for 2 min. PCR cycling conditions were as follows: denaturation 95°C for 10 min, followed by 39 cycles 92°C for 15 s, 60°C for 45 s.
Analysis of QRT-PCR data was based on comparison of the target transcript PCR signal in a treatment group to signal measured in an untreated control. Analysis was done using the 2−ΔΔCT method as described by Levak and Schmittgen (31 (link)).
Kalota A., Karabon L., Swider C.R., Viazovkina E., Elzagheid M., Damha M.J, & Gewirtz A.M. (2006). 2′-Deoxy-2′-fluoro-β-d-arabinonucleic acid (2′F-ANA) modified oligonucleotides (ON) effect highly efficient, and persistent, gene silencing. Nucleic Acids Research, 34(2), 451-461.
Publication 2006
6-carboxyfluorescein c-myb Genes Cells DNA, Complementary GAPDH protein, human Genes, Reporter Oligonucleotide Primers Reverse Transcription
3
Leptospira Detection via Targeted PCR
Cited 17 times
The primers and probes were designed from alignments of available Leptospira spp. 16S rDNA partial sequences obtained from the GenBank nucleotide sequence database (data not shown). The program used was Primer Express™ (Perkin-Elmer, Applied Biosystems, USA). The ability of the primers and probe to identify leptospiral sequences was initially assessed using the BLAST program [20 (link)] against the National Center for Biotechnology Information (NCBI) sequence database. The primers were synthesized by Geneworks Pty. Ltd., Australia and the probe by Pacific Oligos Pty Ltd, Australia.
The PCR primers Lepto F (5'171 CCCGCGTCCGATTAG 3') and Lepto R (5'258 TCCATTGTGGCCGRA/GACAC3') were located between the positions 171 and 258 of the rrs (16S) gene with an expected product size of 87 bp product. The probe [5'205(FAM) CTCACCAAGGCGACGATCGGTAGC228 3' (TAMRA)] had the fluorescent reporter dye, 6-carboxy-fluorescein (FAM) located at the 5' end of the probe and the quencher 6-carboxy-tetramethyl-rhodamine (TAMRA) located at the 3' end.
Smythe L.D., Smith I.L., Smith G.A., Dohnt M.F., Symonds M.L., Barnett L.J, & McKay D.B. (2002). A quantitative PCR (TaqMan) assay for pathogenic Leptospira spp. BMC Infectious Diseases, 2, 13.
Publication 2002
2',5'-oligoadenylate 6-carboxyfluorescein Base Sequence DNA, Ribosomal Fluorescent Dyes Genes Leptospira Nucleotides Oligonucleotide Primers tetramethylrhodamine
4
Quantitative PCR and Plaque Assays for Viral Detection
Cited 8 times
Quantitative PCR was done with gene-specific primers and 6FAM-TAMRA (6-carboxyfluorescein–N,N,N’,N’-tetramethyl-6-carboxyrhodamine) probes26 (link) or inventoried gene expression kits from Applied Biosystems (6FAM-MGB (6-carboxyfluorescein–minor groove binder) probes). Plaque-forming assays of tissues or plasma were done as described26 (link). Plasma (100 µl) diluted 10- to 100-fold with sterile PBS or 30–100 µg (total protein) of tissue lysates triturated in sterile PBS was applied to confluent Vero cells. Plaques were visualized with Neutral Red (Sigma-Aldrich) after 3 d of infection.
Wang P., Arjona A., Zhang Y., Sultana H., Dai J., Yang L., LeBlanc P.M., Doiron K., Saleh M, & Fikrig E. (2010). Caspase-12 controls West Nile virus infection via the viral RNA receptor RIG-I. Nature immunology, 11(10), 912-919.
Publication 2010
6-carboxyfluorescein Biological Assay Gene Expression Genes Infection Oligonucleotide Primers Plasma Proteins Senile Plaques Sterility, Reproductive Tissues Vero Cells
5
Quantitative RT-PCR for KanR RNA
Cited 7 times
cDNAs were synthesized at 60°C in 20-µL reactions containing 200 nM TeI4c-MRF RT, RT buffer (75 mM KCl, 10 mM MgCl2, 20 mM Tris-HCl at pH 7.5, 1 mM DTT), 1 mM dNTPs, and 5 × 108 copies of 1.2-kb KanR RNA (Promega) with annealed primer P078 (5′-GGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAAC). After a 2-min preincubation in reaction medium containing all other components at 60°C, reactions were initiated by adding 1 mM dNTPs, incubated at 60°C for 30 min, and terminated by freezing on dry ice.
To quantitate KanR cDNA, 25-µL reactions were done in triplicate in 96-well plates with optical caps with each well containing 5 µL of cDNA (corresponding to 1.25 × 107 copies of kanR RNA, 2X TaqMan Gene Expression Master Mix [Life Technologies], primer-probe mix [200 nM FAM-BFQ1 probe], and 300 nM forward and reverse primers) Primer set 188–257: Forward P09 kan-188F, 5′-GGGTATAAATGGGCTCGCG; Reverse P030 kan-257R, 5′-CGGGCTTCCCATACAATCG; Taqman probe P031 kan-213T, 5′-(6FAM, 6-carboxyfluorescein)-TCGGGCAATCAGGTGCGACAATC/3IABkFQ/(Iowa Black Fluorescence Quencher). Primer set 562–634: Forward P001 kan-562F 5′-CGCTCAGGCGCAATCAC; Reverse P002 kan-634R 5′-CCAGCCATTACGCTCGTCAT; Taqman probe P003 kan-581T 5′-(6-FAM)-ATGAATAACGGTTTGGTTGATGCGAGTGA (TAMRA, tetramethyl-6-carboxyrhodamine) (de Rozieres et al. 2004 (link)). Plasmid pET9a (EMD Chemicals) was used to generate a standard curve to quantitate KanR cDNA levels. qPCR was performed on the 7900HT Fast Real-Time PCR System (Applied Biosystems), using the 9600 emulation mode protocol (50°C for 2 min, 95°C for 10 min, then 45 cycles at 95°C for 15 sec, and 60°C for 60 sec). Data were collected and analyzed by using Life Technologies SDS Versions 2.3 software, and cycle thresholds for cDNA samples were plotted against the standard curve to determine copy number equivalents.
Mohr S., Ghanem E., Smith W., Sheeter D., Qin Y., King O., Polioudakis D., Iyer V.R., Hunicke-Smith S., Swamy S., Kuersten S, & Lambowitz A.M. (2013). Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing. RNA, 19(7), 958-970.
Publication 2013
6-carboxyfluorescein Buffers DNA, Complementary Dry Ice Fluorescence Gene Expression Magnesium Chloride Oligonucleotide Primers Plasmids Promega Tromethamine Vision

Most recents protocols related to «6-carboxyfluorescein»

1
PARP1-DNA Binding Assay by DSB-FA
The effects of the tested compounds on PARP1‐DNA binding were determined by the DSB fluorescence polarization (FA) model as described previously (Chen et al, 2019a (link)). Briefly, the binding reactions were carried out in a buffer containing 12 mM HEPES (pH 8.0), 60 mM KCl, 0.12 mM EDTA, 5.5 μM β‐mercaptoethanol, 8 mM MgCl2, 0.05 mg/ml BSA and 4% glycerol. Reactions contained a 10 nM DNA probe and 250 nM purified His‐PARP1 protein with DMSO or thioparib. The sequence of the DNA strand used in the assay was 5′‐GGGTTGCGGCCGCTTGGG‐3′ that carried 6‐carboxyfluorescein on the 5′‐terminus, and it was annealed to its complementary DNA strand. The reaction was started with 1 mM NAD+ and the data were collected at 60 min with a Synergy H1 microplate reader (BioTek, Winooski, VT).
Wang L., Wang P., Chen X., Yang H., Song S., Song Z., Jia L., Chen H., Bao X., Guo N., Huan X., Xi Y., Shen Y., Yang X., Su Y., Sun Y., Gao Y., Chen Y., Ding J., Lang J., Miao Z., Zhang A, & He J. (2023). Thioparib inhibits homologous recombination repair, activates the type I IFN response, and overcomes olaparib resistance. EMBO Molecular Medicine, 15(3), e16235.
Full text: Click here
Publication 2023
2-Mercaptoethanol 6-carboxyfluorescein Biological Assay Buffers DNA, Complementary DNA Probes DNA Sequence Edetic Acid Fluorescence Polarization Glycerin HEPES Magnesium Chloride PARP1 protein, human Poly (ADP-Ribose) Polymerase-1 Sulfoxide, Dimethyl
2
Measuring Intracellular pH in Bacteria
Intracellular pH was measured using the fluorescent pH indicator 2,7-bicarboxyethyl-5,6-carboxyfluorescein-acet-oxymethylester (BCECF-AM) according to the manufacturer’s protocol (Burgess and Han, 2010 (link); Chakraborty et al., 2017 (link)). Bacterial suspensions (OD 2.0) were incubated with 20 μM BCECF-AM at 37 °C for 60 min. After loading, the cells were washed three times with PBS buffer and remained in the same solution. A pH calibration curve was constructed using BCECF-AM with a pH calibration buffer kit containing a pH range of 4.5, 5.5, 6.5, and 7.5, and valinomycin (10 μM) and nigericin (10 μM), which equilibrated the intracellular and extracellular pH of bacteria. Intracellular pH was recorded by determining the fluorescence ratio (F490 nm/F440 nm) of the emission wavelength at 535 nm for excitation wavelengths of 490 and 440 nm using a multimode microplate reader (Tecan Infinite M200). Bacterial photographs were detected using inverted fluorescence microscopy (Nikon Microsystems).
Li N., Xue L., Mai X., Wang P., Zhu C., Han X., Xie Y., Wang B., Ge Y., Zhang Y, & Sun J. (2023). Transfection of clMagR/clCry4 imparts MR-T2 imaging contrast properties to living organisms (E. coli) in the presence of Fe3+ by endogenous formation of iron oxide nanoparticles. Frontiers in Molecular Biosciences, 10, 1119356.
Full text: Click here
Publication 2023
2',7'-bis-(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester 6-carboxyfluorescein Bacteria Buffers Cells Fluorescence M-200 Microscopy, Fluorescence Nigericin Protoplasm Valinomycin
3
DNA Extraction and SSR Genotyping of Camellia hainanica
The DNeasy Plant Mini Kit (Tiangen Biotech Co. Ltd., Beijing, China) was used to extract the DNA of the leaf sample, and the operation of this application was strictly conducted according to the manufacturer’s instructions. Likewise, a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) and agarose gel assay were used to measure the quality of the DNA samples. Twelve highly polymorphic SSR markers were used to genotype 96 samples of C. hainanica (Table 1). The target DNA fragment was amplified using the fluorescently labelled TP-M13-SSR polymerase chain reaction (PCR) method (Schuelke, 2000 (link)). The universal M13 primers fluorescently labelled with 6-carboxy-x-rhodamine, 6-carboxy-fluorescein, tetramethyl-6-carboxyrhodamine, or 5-hexachloro-fluorescein and the forward primer with a universal M13 primer tail (5-TGTAAAACGACGGC CAGT-3) at the 5′ end were used for the previously described PCR method. The PCR procedure was as follows: denaturation for 2 min at 95 °C; 12 cycles of 30 s at 95 °C, 30 s at 64–59 °C (−0.5 °C per cycle), 1 min at 72 °C; then, 24 cycles of 30 s at 95 °C, 30 s at 65 °C, 1 min at 72 °C, and a extension of 2 min at 72 °C (Cui et al., 2021 (link)). PCR amplification was performed in a Thermal Cycler (Bio-Rad, Hercules, CA, USA), and an ABI 3730XL DNA Analyser (Applied Biosystems, USA) was used for the detection of PCR products. The fluorescence detection data from capillary electrophoresis were used for SSR analysis with the GeneScan™ 500 LIZ® Size Standard as an internal standard, and allele analysis for each SSR locus was performed using GeneMapper version 3.7 (Applied Biosystems, Foster City, CA, USA).
Tong H., Deng H, & Han Z. (2023). Genetic differentiation and genetic structure of mixed-ploidy Camellia hainanica populations. PeerJ, 11, e14756.
Full text: Click here
Publication 2023
6-carboxyfluorescein Alleles Biological Assay Electrophoresis, Capillary Fluorescein Fluorescence Genotype Neutrophil Oligonucleotide Primers Plant Leaves Plants Polymerase Chain Reaction Rhodamine Sepharose Tail
4
Quantitative Detection of HSV-1 DNA
Cited 1 time
The viral DNA was extracted using phenol/chloroform solution and precipitated from the organic phase. The procedures were published previously in [28 (link)]. The DNA pellet was washed twice in a solution containing 0.1 M trisodium citrate in 10% ethanol, and then, dissolved in 8 mM NaOH. The concentration of DNA was determined via fluorometer analysis using a Qubit double-stranded DNA (dsDNA) HS (High Sensitivity) Assay Kit according to the manufacturer’s instructions. The amplification of viral DNA was carried out using TaqMan™ Universal Master Mix II (Applied Biosystems™, Foster City, CA, USA) in a 50 µL reaction mixture containing: TaqMan Universal Master Mix II, DNA (100 ng), HSV-1 forward (10 µM) and reverse (10 µM) primers (Fw 5′-catcaccgacccggagagggac; Rev 5′-gggccaggcgcttgttggtgta), and a TaqMan probe (5 µM) (5′-6FAM-ccgccgaactgagcagacacccgcgc-TAMRA, where 6FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine). The amplification was carried out using the Applied Biosystems 7300 Real-Time PCR System (Foster City, CA) under the following conditions: 10 min at 95 °C, 60 s at 95 °C for 40 cycles, 30 s at 60 °C, and 30 s at 72 °C. Absolute quantification Real-Time PCR using a specific TaqMan probe was performed to detect viral DNA. Viral load was derived from the threshold cycle (CT) using the standard curve generated in parallel, and the result is expressed as the concentration in µg of DNA/µL.
Pennisi R., Ben Amor I., Gargouri B., Attia H., Zaabi R., Chira A.B., Saoudi M., Piperno A., Trischitta P., Tamburello M.P, & Sciortino M.T. (2023). Analysis of Antioxidant and Antiviral Effects of Olive (Olea europaea L.) Leaf Extracts and Pure Compound Using Cancer Cell Model. Biomolecules, 13(2), 238.
Full text: Click here
Publication 2023
6-carboxyfluorescein 6-carboxytetramethylrhodamine Biological Assay Chloroform DNA, Double-Stranded DNA, Viral Ethanol Human Herpesvirus 1 Hypersensitivity Oligonucleotide Primers Phenol Real-Time Polymerase Chain Reaction trisodium citrate
5
Optimized SSR Marker Genotyping Protocol
A total of 287 markers were selected from previous studies (Lowe et al., 2002 (link); Wang et al., 2008 (link); Ban, 2009 ; Cheng et al., 2009 (link); Li, 2010 ; Liu et al., 2014 (link); Song et al., 2015 (link); Chen et al., 2017 (link); Liu, 2017 ; Li et al., 2018 (link); He et al., 2021 (link)) (Table S3). The selected SSR markers were labelled with 6-FAM (6-carboxyfluorescein), HEX (hexachlorofluorescein), ROX (6-carboxyl-X-rhodamine; passive reference dye), and TAMRA (5-carboxytetramethylrhodamine) fluorescent dyes at the 5′ end of the forward primer. The total volume of the polymerase chain reaction (PCR) was 20 µL, with a dNTP concentration of 0.20 mmol/L, and concentrations of forward and reverse primers of 0.25 µmol/L, 0.05 U/µL of Taq total genomic DNA polymerase, 1 × PCR buffer (containing Mg2+, 2.5 mmol/l), and 50 ng/µL of DNA, and with the addition of double-distilled H2O up to a total of 20 µL. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 45 seconds, for a total of 35 cycles; followed by extension at 72°C for 10 minutes; and then storage of the PCR reaction at 4°C.
Yin J., Zhao H., Wu X., Ma Y., Zhang J., Li Y., Shao G., Chen H., Han R, & Xu Z. (2023). SSR marker based analysis for identification and of genetic diversity of non-heading Chinese cabbage varieties. Frontiers in Plant Science, 14, 1112748.
Full text: Click here
Publication 2023
5-carboxytetramethylrhodamine 6-carboxyfluorescein Buffers Fluorescent Dyes Genome Neoplasm Metastasis Oligonucleotide Primers Polymerase Chain Reaction Rhodamine Taq Polymerase

Top products related to «6-carboxyfluorescein»

1
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
2
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
3
Carboxyfluorescein succinimidyl ester (cfse) by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Canada, France, China, Australia, Belgium, Denmark, Netherlands, Norway, Italy, Sweden, New Zealand
CFSE (Carboxyfluorescein succinimidyl ester) is a fluorescent dye used for cell proliferation and tracking assays. It binds to cellular proteins, allowing the labeling and monitoring of cell division in various cell types.
4
Taqman universal pcr master mix by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Canada, Switzerland, Italy, Brazil, Spain, France, Australia, Belgium, Lithuania, Austria, China, Czechia
TaqMan Universal PCR Master Mix is a pre-formulated solution designed for real-time PCR applications. It contains all the necessary components, including DNA polymerase, dNTPs, and buffer, required to perform real-time PCR experiments.
5
High capacity cdna reverse transcription kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia
The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.
6
Qiaamp viral rna mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, France, Spain, Japan, China, Netherlands, Italy, Australia, Canada, Switzerland, Belgium
The QIAamp Viral RNA Mini Kit is a laboratory equipment designed for the extraction and purification of viral RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and isolate viral RNA, which can then be used for downstream applications such as RT-PCR analysis.
7
Rneasy kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Netherlands, Canada, France, Japan, China, Italy, Switzerland, Australia, Sweden, India, Singapore, Denmark, Belgium
The RNeasy kit is a laboratory equipment product that is designed for the extraction and purification of ribonucleic acid (RNA) from various biological samples. It utilizes a silica-membrane-based technology to efficiently capture and isolate RNA molecules.
8
Taqman gene expression master mix by Thermo Fisher Scientific
Sourced in United States, Germany, Japan, United Kingdom, Switzerland, Lithuania, Canada, Italy, France, Australia, Austria, Spain
TaqMan Gene Expression Master Mix is a pre-optimized reaction mix designed for quantitative real-time PCR (RT-PCR) analysis of gene expression. It contains all the necessary components, including DNA polymerase, dNTPs, and TaqMan probe, to perform reliable and sensitive gene expression studies.
9
7500 real time pcr system by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, Switzerland, France, Singapore, Spain, Italy, Belgium, Netherlands, Sweden, Lithuania, Portugal
The 7500 Real-Time PCR System is a laboratory instrument designed for the detection and quantification of nucleic acid sequences using the real-time polymerase chain reaction (RT-PCR) technology. The system provides accurate and reliable data for a variety of applications, including gene expression analysis, pathogen detection, and genotyping.
10
Cfx96 detection system by Bio-Rad
Sourced in United States, China, Japan, United Kingdom
The CFX96 detection system is a real-time PCR (polymerase chain reaction) instrument designed for quantitative gene expression analysis, genotyping, and other DNA-based applications. It features a 96-well sample block and can detect up to five fluorescent dyes simultaneously, enabling multi-target analysis.

More about "6-carboxyfluorescein"

6-carboxyfluorescein (6-CF) is a widely used fluorescent dye in biochemistry and biomedical research.
It serves as a tracer, labeling agent, and signaling molecule in various experimental applications. 6-CF is often employed in flow cytometry, cell proliferation assays, and live-cell imaging studies.
Researchers may utilize 6-CF in conjunction with related techniques and reagents, such as the TRIzol reagent for RNA extraction, the RNeasy Mini Kit for purifying RNA, and the CFSE (Carboxyfluorescein succinimidyl ester) dye for cell tracking.
The TaqMan Universal PCR Master Mix and High-Capacity cDNA Reverse Transcription Kit are commonly used for quantitative PCR (qPCR) experiments involving 6-CF-labeled samples.
The QIAamp Viral RNA Mini Kit and RNeasy kit can be employed for RNA isolation and purification, while the TaqMan Gene Expression Master Mix and 7500 Real-Time PCR System or CFX96 detection system are often utilized for gene expression analysis using 6-CF-based probes and assays.
PubCompare.ai's AI-driven platform can optimize your 6-carboxyfluorescein research by identifying the most effective protocols from literature, preprints, and patents.
Leverage our analysis to locate the best products and procedures for your 6-carboxyfluorescein experiments, helping you achieve robust and reliable results.
Streamline your research with our user-friendly tools and expert insights.