Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Acetate

Acetate

Acetate, a simple organic anion, is a versatile compound with diverse applications in research and industry.
It serves as a key metabolite in various biological processes, including energy production, lipid synthesis, and histone acetylation.
Acetate can be derived from the breakdown of carbohydrates, fats, and proteins, and it plays a crucial role in cellular homeostasis.
In research, acetate is commonly used as a substrate or buffer component in a wide range of experiments, from cell culture to enzymatic assays.
Optimizing the use of acetate in research can be challenging, as the most accurate and reproducible protocols may be scattered across literature, preprints, and patents.
PubCompare.ai, an AI-driven platform, offers a solution to this problem by enabling researchers to effortlessly locate the best protocols and products to advance their acetate studies.
With its cutting-edege technology and AI-powered comparisons, PubCompare.ai can help streamline your research and achive better results.

Most cited protocols related to «Acetate»

1
Simulating Partial and Contaminated Genomes
Cited 1829 times
Simulated genomes were generated from an initial set of 3604 draft genomes within IMG identified as being of high quality (see Supplemental Methods). To help alleviate bias toward well-sampled lineages, 280 of the 3604 high-quality draft genomes with identical phylogenetic marker genes were not used during the generation of simulated genomes. Simulated genomes were generated at varying degrees of completeness and contamination using three distinct random sampling models. Under the random fragment model, each contig comprising a genome was fragmented into nonoverlapping windows of a fixed size between 5 and 50 kbp. This size range was selected because it approximates the contig lengths of genomes recovered from metagenomic data or single-cell genomics: The mean N50 of the GEBA-MDM single-cell genomes, Wrighton acetate-amended aquifer population genomes, and Sharon infant gut population genomes is ∼28 kbp, ∼17 kbp, and ∼ 12 kbp, respectively. In order to generate genomes at a desired level of completeness and contamination, fragments were sampled without or with replacement, respectively. Windows were sampled until a simulated genome had completeness and contamination equal to or just greater than the target values. Generation of simulated genomes was limited to draft genomes as finished genomes were used to determine appropriate lineage-specific marker sets suitable for evaluating genomes (Fig. 3).
The 2430 draft reference genomes comprised of 20 or more contigs were used to simulate partial and contaminated genomes reflecting the characteristics of assembled contigs. Under this random contig model, genomes were generated by randomly removing contigs until the simulated genome reached or fell below a target completeness level. Contamination was introduced by randomly adding contigs with replacement from a single randomly selected genome until the desired level of contamination was reached or exceeded. These 2430 draft genomes were also used to generate genomes reflecting the limitations of metagenomic binning methods that rely on the statistical properties of contigs (e.g., tetranucleotide signature, coverage) to establish putative population genomes. To simulate this, partial genomes were generated by randomly removing contigs with a probability inversely proportional to their length until the simulated genome reached or fell below a target completeness level. Contamination was introduced by randomly selecting another draft reference genome and adding contigs from this genome with a probability inversely proportional to length until the desired level of contamination was reached or exceeded.
Parks D.H., Imelfort M., Skennerton C.T., Hugenholtz P, & Tyson G.W. (2015). CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Research, 25(7), 1043-1055.
Publication 2015
Acetate Aquifers Genes Genome Infant Metagenome
2
Preparation of cDNA for Illumina Sequencing
Cited 159 times
Preparation of cDNA followed the procedure described in Mortazavi et al.2 (link), with minor modifications as described below. Prior to fragmentation, a 7 uL aliquot (∼ 500 pgs total mass) containing known concentrations of 7 “spiked in” control transcripts from A. thaliana and the lambda phage genome were added to a 100 ng aliquot of mRNA from each time point. This mixture was then fragmented to an average length of 200 nts by metal ion/heat catalyzed hydrolysis. The hydrolysis was performed in a 25 uL volume at 94°C for 90 seconds. The 5X hydrolyis buffer components are: 200 mM Tris acetate, pH 8.2, 500 mM potassium acetate and 150 mM magnesium acetate. After removal of hydrolysis ions by G50 Sephadex filtration (USA Scientific catalog # 1415-1602), the fragmented mRNA was random primed with hexamers and reverse-transcribed using the Super Script II cDNA synthesis kit (Invitrogen catalog # 11917010). After second strand synthesis, the cDNA went through end-repair and ligation reactions according to the Illumina ChIP-Seq genomic DNA preparation kit protocol (Illumina catalog # IP102-1001), using the paired end adapters and amplification primers (Illumina Catalog # PE102-1004). Ligation of the adapters adds 94 bases to the length of the cDNA molecules.
Trapnell C., Williams B.A., Pertea G., Mortazavi A., Kwan G., van Baren M.J., Salzberg S.L., Wold B.J, & Pachter L. (2010). Transcript assembly and abundance estimation from RNA-Seq reveals thousands of new transcripts and switching among isoforms. Nature biotechnology, 28(5), 511-515.
Publication 2010
Acetate Anabolism Bacteriophage lambda Buffers Chromatin Immunoprecipitation Sequencing DNA, Complementary DNA Chips Filtration Genome Hydrolysis Ions Ligation magnesium acetate Metals Oligonucleotide Primers Potassium Acetate RNA, Messenger sephadex Tromethamine
3
Improved Salt Bridge Interactions in CHARMM36
Cited 119 times
Another refinement in the C36m FF concerns improved description of salt bridge interactions involving guanidinium and carboxylate functional groups with a pair-specific non-bonded LJ parameter (NBFIX term in CHARMM) between the guanidinium nitrogen in arginine and the carboxylate oxygen in glutamate, aspartate as well as the C terminus. This salt bridge interaction was found to be too favorable in the CHARMM protein force fields as indicated by the overestimation of the equilibrium association constant of a guanidinium-acetate solution ,33 , 34 as well as the underestimation of its osmotic pressure (personal communication, Benoit Roux). The added NBFIX term increases the Rmin from the 3.55 Å based on the Lorentz-Berthelot rule to a larger value of 3.637 Å (Shen and Roux, personal communication), which we subsequently showed to improve the agreement with the experimental osmotic pressure of guanidinium acetate solutions (Supplementary Figure 19). We noted that the NBFIX approach employed here differs from Piana et al’s work27 where the CHARMM22 charges of the Arg, Asp and Glu side chains were reduced in magnitude, with both approaches leading to weaker and more realistic salt-bridge interactions. The NBFIX term makes sure only the specific interaction between Arg and Asp/Glu is modified, while the interaction of these residues with other amino acids, water, or ions are kept the same as in the C36 FF. Again, our aim is to improve the C36 FF with minimal changes in the model.
Huang J., Rauscher S., Nawrocki G., Ran T., Feig M., de Groot B.L., Grubmüller H, & MacKerell AD J.r. (2016). CHARMM36m: An Improved Force Field for Folded and Intrinsically Disordered Proteins. Nature methods, 14(1), 71-73.
Publication 2016
Acetate Amino Acids Arginine Aspartate aspartylglutamate Glutamate Guanidine Ions Nitrogen Osmotic Pressure Oxygen Proteins Sodium Chloride
4
Lipidomic Profiling by High-Resolution MS
Cited 47 times
Samples were analyzed by direct infusion in a QExactive mass spectrometer (Thermo Fisher Scientific) equipped with a TriVersa NanoMate ion source (Advion Biosciences). Five microliters were infused with gas pressure and voltage set to 1.25 psi and 0.95 kV, respectively. The delivery time was set to 4 min and 55 s with contact closure delay of 20 s to avoid initial spray instability. Polarity switch from positive to negative mode was set at 135 s after contact closure. Samples were analyzed in both polarities in a single acquisition.
The MS acquisition method starts with positive ion mode by acquiring the m/z 402–412 in MS + mode at Rm/z = 200 = 140 000 to monitor the [Chol + NH4+]+ ion for 12 s. All individual scans in every segment are the average of 2 microscans. Automatic gain control (AGC) was set to 5 × 105 and maximum ion injection time (IT) was set to 200 ms. Then we scan the m/z 550–1000 in MS + (Rm/z = 200 = 140 000) with lock mass activated at a common background (m/z = 680.48022) for 18 s. AGC was set to 106 and IT was set to 50 ms. This is followed by a MSMS + (Rm/z = 200 = 17 500) data independent analysis triggered by an inclusion list for 105 s. The inclusion list contains all the masses from 500.5 to 999.75 with 1 Da intervals. AGC was set to 105 and IT was set to 64 ms. The isolation width was set to 1.0 Da, first mass of MSMS acquisition was 250 Da and normalized collision energy was set to 20%. Both MS+ and MSMS+ data are combined to monitor SE, DAG, and TAG ions as ammonium adducts. After polarity switch to negative ion mode, a lag of 15 s before acquisition was inserted to allow spray stabilization. Then, we scan for the m/z 400–650 in FTMS − (Rm/z = 200 = 140 000) for 15 s with lock mass activated at a common background (m/z = 529.46262) to monitor LPG, LPA, LPI, LPS, and LPE as deprotonated anions and LPC and LPC O– as acetate adducts. AGC was set to 106 and IT was set to 50 ms. We then scan the m/z 520–940 in FTMS − (Rm/z = 200 = 140 000) for 15 s with lock mass activated at a common background (m/z = 529.46262). AGC was set to 106 and IT was set to 50 ms. Finally, we scan MSMS- (Rm/z= 200 = 17 500) by data independent analysis triggered by an inclusion list for 90 s. This inclusion list contains all the masses from 590.5 to 939.5 with 1 Da intervals. AGC was set to 105 and IT was set to 64 ms. Isolation width was set to 1.0 Da, first mass of MSMS acquisition was 150 Da, and normalized collision energy was set to 35%. Both MS and MSMS data were combined in order to monitor PC, PC O–, HexCer, Cer, SM as acetate adducts and PS, PG, PA, PE, PE O–, and PI as deprotonated anions.
Surma M.A., Herzog R., Vasilj A., Klose C., Christinat N., Morin-Rivron D., Simons K., Masoodi M, & Sampaio J.L. (2015). An automated shotgun lipidomics platform for high throughput, comprehensive, and quantitative analysis of blood plasma intact lipids. European Journal of Lipid Science and Technology, 117(10), 1540-1549.
Full text: Click here
Publication 2015
Acetate Ammonium Anions isolation Obstetric Delivery Pressure Radionuclide Imaging
5
Culturing of C. reinhardtii Strains
Cited 43 times
C. reinhardtii wild-type strains CC-3269, CC-425, CC-125, and CC-1690 were cultured under 50 – 100 μmol m−2 s−1 illumination in Tris-Acetate-Phosphate (TAP) and Tris-Phosphate (TP) media with the specified trace element supplements. These strains may be obtained from the Chlamydomonas Resource Center at the University of Minnesota. For metal-free studies, all glassware was freshly washed in 6N hydrochloric acid and medium was made in Milli-Q (MILLIPORE) water (Quinn and Merchant, 1998 (link)).
Kropat J., Hong-Hermesdorf A., Casero D., Ent P., Castruita M., Pellegrini M., Merchant S.S, & Malasarn D. (2011). A revised mineral nutrient supplement increases biomass and growth rate in Chlamydomonas reinhardtii. The Plant journal : for cell and molecular biology, 66(5), 770-780.
Publication 2011
Acetate Chlamydomonas Dietary Supplements Hydrochloric acid Lighting Metals Phosphates Strains Trace Elements Tromethamine

Most recents protocols related to «Acetate»

1
Quantifying Lipid Synthesis in Primary Sebocytes
Not available on PMC !

Example 3

Human primary sebocytes (Zenbio, RTP, NC) were plated at confluence on 96 well Scintiplates and allowed to adhere overnight. Cells were treated with the SCD1 inhibitor Compound A prepared in media containing the LXR agonist and insulin and cultured overnight. The DGAT inhibitor A922500 (2 μM) was included as a positive control. The following day 14C-acetate was added to each well and the plate was gently mixed. Cells were placed in the incubator at 37° C. for 4 hours total. After 2 hours of incubation the Cell Titer Blue (CTB) assay was started, 10 μl of CTB reagent was added to each well and incubated for the remaining 2 hours at 37° C. Following the 4 hour incubation, the RFU was determined using the SpectraMax Gemini EM under the following parameters: 560ex/590em with a 570 cutoff, top read. The medium was removed and cells were washed 3× with PBS. All of the PBS was removed from the wells and the plates were allowed to air dry. The plate was read in the MicroBeta TriLux counter and data was analyzed as CPM and normalized to CTB readout. Data is shown in FIG. 2.

US11865113B2. Methods of treating a patient afflicted with non-alcoholic steatohepatitis (NASH) (2024-01-09). Lipidio Pharmaceuticals Inc. [US]. Inventors: Nigel R. A. Beeley [US], J. Gordon Foulkes [US], Kieran George Mooney [US], Charles Rodney Greenaway Evans [GB], Keith Arthur Johnson [US], Howard G. Welgus [US], Celia P. Jenkinson [US].
Full text: Click here
Patent 2024
Acetate Biological Assay Cells Homo sapiens Insulin N,N,N-triethyl-11-(4-methyl-2-oxo-2H-chromen-7-yloxy)-11-oxoundecan-1-aminium bromide Psychological Inhibition
2
Targeted siRNA Delivery for Muscle Atrophy
Not available on PMC !

Example 24

For groups 1-12, see study design in FIG. 32, the 21mer Atrogin-1 guide strand was designed. The sequence (5′ to 3′) of the guide/antisense strand was UCGUAGUUAAAUCUUCUGGUU (SEQ ID NO: 14237). The guide and fully complementary RNA passenger strands were assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity. Purified single strands were duplexed to get the double stranded siRNA described in figure A. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linkers. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

For groups 13-18 see study design in FIG. 32, a 21mer negative control siRNA sequence (scramble) (published by Burke et al. (2014) Pharm. Res., 31(12):3445-60) with 19 bases of complementarity and 3′ dinucleotide overhangs was used. The sequence (5′ to 3′) of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 14228). The same base, sugar and phosphate modifications that were used for the active MSTN siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

Antibody siRNA Conjugate Synthesis Using Bis-Maleimide (BisMal) Linker

Step 1: Antibody Reduction with TCEP

Antibody was buffer exchanged with 25 mM borate buffer (pH 8) with 1 mM DTPA and made up to 10 mg/ml concentration. To this solution, 4 equivalents of TCEP in the same borate buffer were added and incubated for 2 hours at 37° C. The resultant reaction mixture was combined with a solution of BisMal-siRNA (1.25 equivalents) in pH 6.0 10 mM acetate buffer at RT and kept at 4° C. overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA. The reaction mixture was treated with 10 EQ of N-ethylmaleimide (in DMSO at 10 mg/mL) to cap any remaining free cysteine residues.

Step 2: Purification

The crude reaction mixture was purified by AKTA Pure FPLC using anion exchange chromatography (SAX) method-1. Fractions containing DAR1 and DAR2 antibody-siRNA conjugates were isolated, concentrated and buffer exchanged with pH 7.4 PBS.

Anion Exchange Chromatography Method (SAX)-1.

Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID×15 cm, 13 um

Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow Rate: 6.0 ml/min

Gradient:

a.% A% BColumn Volume
b.10001
c.81190.5
d.505013
e .40600.5
f.01000.5
g.10002

Anion Exchange Chromatography (SAX) Method-2

Column: Thermo Scientific, ProPac™ SAX-10, Bio LC™, 4×250 mm

Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow Rate: 0.75 ml/min

Gradient:

a.Time% A% B
b.0.09010
c.3.009010
d.11.004060
e.14.004060
f.15.002080
g.16.009010
h.20.009010

Step-3: Analysis of the Purified Conjugate

The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2 (Table 22).

TABLE 22
SAX retention% purity
Conjugatetime (min)(by peak area)
TfR1-Atrogin-1 DAR19.299
TfR1-Scramble DAR18.993

In Vivo Study Design

The conjugates were assessed for their ability to mediate mRNA downregulation of Atrogin-1 in muscle (gastroc) in the presence and absence of muscle atrophy, in an in vivo experiment (C57BL6 mice). Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs and doses, see FIG. 32. Seven days post conjugate delivery, for groups 3, 6, 9, 12, and 15, muscle atrophy was induced by the daily administration via intraperitoneal injection (10 mg/kg) of dexamethasone for 3 days. For the control groups 2, 5, 8, 11, and 14 (no induction of muscle atrophy) PBS was administered by the daily intraperitoneal injection. Groups 1, 4, 7, 10, and 13 were harvested at day 7 to establish the baseline measurements of mRNA expression and muscle weighted, prior to induction of muscle atrophy. At three days post-atrophy induction (or 10 days post conjugate delivery), gastrocnemius (gastroc) muscle tissues were harvested, weighed and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) is calculated and then further normalized relative to the PBS control group by taking a second difference (ΔΔCt).

Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Results

The data are summarized in FIG. 33-FIG. 35. The Atrogin-1 siRNA guide strands were able to mediate downregulation of the target gene in gastroc muscle when conjugated to an anti-TfR mAb targeting the transferrin receptor, see FIG. 33. Increasing the dose from 3 to 9 mg/kg reduced atrophy-induced Atrogin-1 mRNA levels 2-3 fold. The maximal KD achievable with this siRNA was 80% and a tissue concentration of 40 nM was needed to achieve maximal KD in atrophic muscles. This highlights the conjugate delivery approach is able to change disease induce mRNA expression levels of Atrogin-1 (see FIG. 34), by increasing the increasing the dose. FIG. 35 highlights that mRNA down regulation is mediated by RISC loading of the Atrogin-1 guide strands and is concentration dependent.

Conclusions

In this example, it was demonstrated that a TfR1-Atrogin-1 conjugates, after in vivo delivery, mediated specific down regulation of the target gene in gastroc muscle in a dose dependent manner. After induction of atrophy the conjugate was able to mediate disease induce mRNA expression levels of Atrogin-1 at the higher doses. Higher RISC loading of the Atrogin-1 guide strand correlated with increased mRNA downregulation.

US11872287B2. Compositions and methods of treating muscle atrophy and myotonic dystrophy (2024-01-16). Avidity Biosciences, Inc. [US]. Inventors: Andrew John Geall [US], Venkata Doppalapudi [US], David Sai-Ho Chu [US], Michael Caramian Cochran [US], Michael Hood [US], Beatrice Diana Darimont [US], Rob Burke [US], Yunyu Shi [US], Gulin Erdogan Marelius [US], Barbora Malecova [US].
Full text: Click here
Patent 2024
Acetate Anions Antibody Formation Antigens Atrophy Biological Assay Borates Buffers Carbohydrates Chromatography Complementary RNA Complement System Proteins Cysteine Dexamethasone Dinucleoside Phosphates DNA, Complementary Down-Regulation Ethanol Ethylmaleimide Freezing Genes Genes, Housekeeping High-Performance Liquid Chromatographies Immunoglobulins Injections, Intraperitoneal maleimide MicroRNAs Mus Muscle, Gastrocnemius Muscle Tissue Muscular Atrophy Nitrogen Obstetric Delivery Oligonucleotide Primers Pentetic Acid Phosphates Plasma PPIB protein, human Prospective Payment Assessment Commission Real-Time Polymerase Chain Reaction Retention (Psychology) Reverse Transcription RNA, Messenger RNA, Small Interfering RNA-Induced Silencing Complex RNA Interference Sodium Chloride Solvents Stem, Plant STS protein, human Sulfhydryl Compounds Sulfoxide, Dimethyl TFRC protein, human Tissues Transferrin tris(2-carboxyethyl)phosphine Tromethamine
3
Synthesis of Quinolinylated Diazepan Acetate
Not available on PMC !

Example 62

[Figure (not displayed)]

Step 1: tert-butyl 2-(4-(7-chloro-4-(1H-imidazol-1-yl)quinolin-2-yl)-2-oxo-1,4-diazepan-1-yl)acetate. To a solution of 4-(7-chloro-4-(1H-imidazol-1-yl)quinolin-2-yl)-1,4-diazepan-2-one (20 mg) and tert-butyl 2-bromoacetate (30 mg) in anhydrous DMF was added NaH (10 mg, 65% in mineral oil). After stirring 3 hours, the reaction mixture was diluted with EtOAc (10 mL) and carefully quenched with water (5 mL). Isolation of the organic layer and a column chromatography eluting with a gradient of hexanes and EtOAc afforded the desired intermediate tert-butyl 2-(4-(7-chloro-4-(1H-imidazol-1-yl)quinolin-2-yl)-2-oxo-1,4-diazepan-1-yl)acetate (20 mg) (MS: [M+1]+ 456).

Step 2: 2-(4-(7-chloro-4-(1H-imidazol-1-yl)quinolin-2-yl)-2-oxo-1,4-diazepan-1-yl)acetic acid. tert-butyl 2-(4-(7-chloro-4-(1H-imidazol-1-yl)quinolin-2-yl)-2-oxo-1,4-diazepan-1-yl)acetate was further treated with TFA (0.4 mL) in DCM (0.8 mL). Removal of DCM and TFA under reduced pressure and lyophilization afforded the desired product (10 mg)-2-(4-(7-chloro-4-(1H-imidazol-1-yl)quinolin-2-yl)-2-oxo-1,4-diazepan-1-yl)acetic acid (MS: [M+1]+ 400).

US11873291B2. Quinoline cGAS antagonist compounds (2024-01-16). ImmuneSensor Therapeutics, Inc. [US], The Board of Regents of the University of Texas System [US]. Inventors: Jian Qiu [US], Qi Wei [US], Matt Tschantz [US], Heping Shi [US], Youtong Wu [US], Hulling Tan [US], Lijun Sun [US], Chuo Chen [US], Zhijian Chen [US].
Full text: Click here
Patent 2024
Acetate Acetic Acids Anabolism bromoacetate Chromatography Freeze Drying Hexanes imidazole isolation Oil, Mineral Pressure TERT protein, human
4
Solid-Phase Peptide Synthesis
Not available on PMC !

Example 4

Synthesis of Peptides

All peptides were synthesized using standard and well-established solid phase peptide synthesis using the Fmoc-strategy. Identity and purity of each individual peptide have been determined by mass spectrometry and analytical RP-HPLC. The peptides were obtained as white to off-white lyophilizes (trifluoro acetate salt) in purities of >50%. All TUMAPs are preferably administered as trifluoro-acetate salts or acetate salts, other salt-forms are also possible.

US11872270B2. A*03 restricted peptides for use in immunotherapy against cancers and related methods (2024-01-16). Immatics Biotechnologies GmbH [DE]. Inventors: Colette Song [DE], Linus Backert [DE], Heiko Schuster [DE], Daniel Johannes Kowalewski [DE], Oliver Schoor [DE], Jens Fritsche [DE], Toni Weinschenk [DE], Harpreet Singh [DE].
Full text: Click here
Patent 2024
Acetate High-Performance Liquid Chromatographies Immunotherapy Malignant Neoplasms Mass Spectrometry Peptides Salts Sodium Chloride
5
Synthesis of Quinoline-based Piperazine Derivatives
Not available on PMC !

Example 57

[Figure (not displayed)]

Step 1: Methyl 1-(2-acetoxyacetyl)-4-(7,8-dichloro-4-(1H-imidazol-1-yl)quinolin-2-yl)piperazine-2-carboxylate. Methyl 4-(7,8-dichloro-4-(1H-imidazol-1-yl)quinolin-2-yl)piperazine-2-carboxylate TFA salt (20 mg) in DMF (0.5 mL) and TEA (0.1 mL) was treated with 2-chloro-2-oxoethyl acetate (20 mg) over 4 hours. Aqueous work up with EtOAc/water/sat NaHCO3/brine and purification by column chromatography afforded methyl 1-(2-acetoxyacetyl)-4-(7,8-dichloro-4-(1H-imidazol-1-yl)quinolin-2-yl)piperazine-2-carboxylate (12 mg) (MS: [M+1]+ 506).

Step 2: 4-(7,8-Dichloro-4-(1H-imidazol-1-yl)quinolin-2-yl)-1-(2-hydroxyacetyl)piperazine-2-carboxylic acid. The intermediate was dissolved in MeOH (0.8 mL) and water (0.2 mL) and treated with LiOH—H2O (20 mg) overnight. The reaction mixture was diluted with water (2 mL) and acidified with HOAc (0.02 mL) to precipitate 4-(7,8-dichloro-4-(1H-imidazol-1-yl)quinolin-2-yl)-1-(2-hydroxyacetyl)piperazine-2-carboxylic acid (7 mg) (MS: [M+1]+ 450).

US11873291B2. Quinoline cGAS antagonist compounds (2024-01-16). ImmuneSensor Therapeutics, Inc. [US], The Board of Regents of the University of Texas System [US]. Inventors: Jian Qiu [US], Qi Wei [US], Matt Tschantz [US], Heping Shi [US], Youtong Wu [US], Hulling Tan [US], Lijun Sun [US], Chuo Chen [US], Zhijian Chen [US].
Full text: Click here
Patent 2024
Acetate Acetic Acid Anabolism Bicarbonate, Sodium brine Chromatography imidazole Piperazine piperazine-2-carboxylic acid Piperazine Salt

Top products related to «Acetate»

1
Ionomycin by Merck Group
Sourced in United States, Germany, United Kingdom, Macao, France, Italy, China, Canada, Switzerland, Sao Tome and Principe, Australia, Japan, Belgium, Denmark, Netherlands, Israel, Chile, Spain
Ionomycin is a laboratory reagent used in cell biology research. It functions as a calcium ionophore, facilitating the transport of calcium ions across cell membranes. Ionomycin is commonly used to study calcium-dependent signaling pathways and cellular processes.
2
Tris acetate gel by Thermo Fisher Scientific
Sourced in United States, United Kingdom
Tris-Acetate gels are a type of electrophoresis gel used for the separation and analysis of proteins and nucleic acids. They provide a matrix for the migration of these biomolecules under an electric field, allowing their separation based on size and charge characteristics.
3
Oleic acid by Merck Group
Sourced in United States, Germany, China, Italy, Japan, France, India, Spain, Sao Tome and Principe, United Kingdom, Sweden, Poland, Australia, Austria, Singapore, Canada, Switzerland, Ireland, Brazil, Saudi Arabia
Oleic acid is a long-chain monounsaturated fatty acid commonly used in various laboratory applications. It is a colorless to light-yellow liquid with a characteristic odor. Oleic acid is widely utilized as a component in various laboratory reagents and formulations, often serving as a surfactant or emulsifier.
4
Sodium hydroxide (naoh) by Merck Group
Sourced in Germany, United States, India, United Kingdom, Italy, China, Spain, France, Australia, Canada, Poland, Switzerland, Singapore, Belgium, Sao Tome and Principe, Ireland, Sweden, Brazil, Israel, Mexico, Macao, Chile, Japan, Hungary, Malaysia, Denmark, Portugal, Indonesia, Netherlands, Czechia, Finland, Austria, Romania, Pakistan, Cameroon, Egypt, Greece, Bulgaria, Norway, Colombia, New Zealand, Lithuania
Sodium hydroxide is a chemical compound with the formula NaOH. It is a white, odorless, crystalline solid that is highly soluble in water and is a strong base. It is commonly used in various laboratory applications as a reagent.
5
Methanol by Merck Group
Sourced in Germany, United States, Italy, India, United Kingdom, China, France, Poland, Spain, Switzerland, Australia, Canada, Sao Tome and Principe, Brazil, Ireland, Japan, Belgium, Portugal, Singapore, Macao, Malaysia, Czechia, Mexico, Indonesia, Chile, Denmark, Sweden, Bulgaria, Netherlands, Finland, Hungary, Austria, Israel, Norway, Egypt, Argentina, Greece, Kenya, Thailand, Pakistan
Methanol is a clear, colorless, and flammable liquid that is widely used in various industrial and laboratory applications. It serves as a solvent, fuel, and chemical intermediate. Methanol has a simple chemical formula of CH3OH and a boiling point of 64.7°C. It is a versatile compound that is widely used in the production of other chemicals, as well as in the fuel industry.
6
Dimethyl sulfoxide (dmso) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, India, Canada, Switzerland, Japan, Australia, Spain, Poland, Belgium, Brazil, Czechia, Portugal, Austria, Denmark, Israel, Sweden, Ireland, Hungary, Mexico, Netherlands, Singapore, Indonesia, Slovakia, Cameroon, Norway, Thailand, Chile, Finland, Malaysia, Latvia, New Zealand, Hong Kong, Pakistan, Uruguay, Bangladesh
DMSO is a versatile organic solvent commonly used in laboratory settings. It has a high boiling point, low viscosity, and the ability to dissolve a wide range of polar and non-polar compounds. DMSO's core function is as a solvent, allowing for the effective dissolution and handling of various chemical substances during research and experimentation.
7
Hydrochloric acid (hcl) by Merck Group
Sourced in Germany, United States, United Kingdom, India, Italy, France, Spain, Australia, China, Poland, Switzerland, Canada, Ireland, Japan, Singapore, Sao Tome and Principe, Malaysia, Brazil, Hungary, Chile, Belgium, Denmark, Macao, Mexico, Sweden, Indonesia, Romania, Czechia, Egypt, Austria, Portugal, Netherlands, Greece, Panama, Kenya, Finland, Israel, Hong Kong, New Zealand, Norway
Hydrochloric acid is a commonly used laboratory reagent. It is a clear, colorless, and highly corrosive liquid with a pungent odor. Hydrochloric acid is an aqueous solution of hydrogen chloride gas.
8
1 octadecene by Merck Group
Sourced in United States, Germany, China, Japan, Poland, Spain, Singapore, United Kingdom, Italy
1-octadecene is a linear alkene with the molecular formula C18H36. It is a colorless, oily liquid that is commonly used as a chemical intermediate in various industrial and laboratory applications.
9
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.

More about "Acetate"

Acetate, a versatile organic anion, plays a crucial role in various biological processes, including energy production, lipid synthesis, and histone acetylation.
It can be derived from the breakdown of carbohydrates, fats, and proteins, and is essential for cellular homeostasis.
Acetate is commonly used as a substrate or buffer component in a wide range of research experiments, from cell culture to enzymatic assays.
Optimizing the use of acetate in research can be challenging, as the most accurate and reproducible protocols may be scattered across literature, preprints, and patents.
PubCompare.ai, an AI-driven platform, offers a solution to this problem by enabling researchers to effortlessly locate the best protocols and products to advance their acetate studies.
Acetate is closely related to other compounds, such as Ionomycin, which is a calcium ionophore often used in cell signaling studies.
Tris-Acetate gels, on the other hand, are a type of electrophoresis gel used to separate and analyze DNA, RNA, and proteins.
Oleic acid, a monounsaturated fatty acid, can also be converted to acetate through metabolic pathways.
Additionally, the use of Sodium hydroxide, Methanol, DMSO, and Hydrochloric acid may be relevant in the context of acetate research, as these chemicals can be used for pH adjustment, solvent preparation, and sample pretreatment. 1-octadecene, a long-chain alkene, and Bovine serum albumin, a common protein used in cell culture media, may also be encountered in acetate-related studies.
By leveraging the cutting-edege technology and AI-powered comparisons of PubCompare.ai, researchers can streamline their acetate studies and achive better results.