The largest database of trusted experimental protocols

BI 2536

BI 2536 is a potent and selective inhibitor of the Polo-like kinase 1 (PLK1) enzyme, which plays a critical role in cell division and proliferation.
This small-molecule compound has shown promise in preclinical studies for the treatment of various types of cancer, including solid tumors and hematological malignancies.
BI 2536 exerts its anti-cancer effects by disrupting the normal function of PLK1, leading to cell cycle arrest and apoptosis in rapidly dividing cancer cells.
Reserach on BI 2536 is an active area of investigation, with ongoing clinical trials evaluating its safety and efficacy in different cancer settings.
Understanding the mechanisms of action and optimizing the research protocols for BI 2536 is crucial for advancing its development as a potential cancer therapeautic.

Most cited protocols related to «BI 2536»

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
ABCB1 protein, human ABCC1 protein, human BI 2536 Biological Assay Cells fluorexon MK 0571 pheophorbide a tariquidar
HeLa cells, Rpe1 cells, and tsBN2 cells were maintained as described previously16 (link),22 (link). Clonal cell lines stably expressing GFPLAP fusions were generated as described previously23 (link),24 (link). HeLa cells expressing mouse DHC-GFP were obtained from MitoCheck25 (link). GFP-LGN and DHC-GFP cell lines functionally complement depletion of the corresponding endogenous protein based on dynein recruitment and spindle orientation respectively (Fig. S5e, f; data not shown). To inactivate RCC1, tsBN2 cells were cultured at 39.7°C for 1.5-3 hrs. mCherry-Ran T24N and mCherry-membrane targeting constructs (“Mem” from Neuormodulin; Clontech) were tested following transient transfection using Effectene (Qiagen). To generate the NuMA NLS mutant, the NLS sequence QQRKR was removed by PCR. For drug treatment, HeLa cells were incubated for 1-3 hrs with drugs at the following concentrations: STLC: 10 μM; Nocodazole: 100 nM (high dose), or 10-20 nM (low dose); ZM447439, 2 μM; BI2536, 10 μM; MG132, 20 μM; Thymidine, 2 mM.
RNAi experiments were conducted using RNAi MAX transfection reagent (Invitrogen) according to the manufacturer’s guidelines. Pools of 4 pre-designed siRNAs against LGN-GPMS2 (GAACUAACAGCACGACUUA, CUUCAGGGAUGCAGUUAUA, ACAGUGAAAUUCUUGCUAA, UGAAGGGUUCUUUGACUUA), p150-DCTN1 (CUGGAGCGUGUAUCGUAA, GAAGAUCGAGAGACAGUUA, GCUCAUGCCUCGUCUCAUU, CGAGCUCACUACUGACUUA), DHC-DYNC1H1 (GAUCAAACAUGACGGAAUU, CAGAACAUCUCACCGGAUA, GAAAUCAACUUGCCAGAUA, GCAAGAAUGUCGCUAAAUU), siRNAs targeting NuMA (GGCGUGGCAGGAGAAGUUCUU)9 (link) the three Gαi isoforms (CCGAAUGCAUGAAGCAUGUU, CUUGAGCGCCUAUGACUUGUU)8 (link), and a non-targeting control were obtained from Dharmacon. For RNAi rescue experiments withLGN, a single siRNA (GAACUAACAGCACGACUUA) was used and target sequence on the plasmid was mutated to be insensitive to this siRNA.
Publication 2012
BI 2536 Cell Lines Cells Clone Cells Dynein ATPase Effectene Elp1 protein, human HeLa Cells MG 132 Mus Nocodazole NUMA1 protein, human Pharmaceutical Preparations Plasmids Protein Isoforms Proteins RNA, Small Interfering RNA Interference Thymidine Tissue, Membrane Transfection Transients ZM 447439
Cells were grown at 37 °C in a humidified atmosphere with 5% CO2 in DMEM (HeLa, 293-ampho) or 1:1 DMEM:F12 media (RPE1) from Invitrogen supplemented with 10% fetal bovine serum (Atlanta Biologicals), 1X penicillin-streptomcyin and non-essential amino acids (Invitrogen), and 2 mM L-glutamine (Invitrogen). Cells used for live imaging or immunofluorescence were grown on no. 1.5 glass coverslips (Fisher Scientific) coated with Poly-D-lysine (Sigma). 293-ampho cells were transfected according to a calcium phosphate protocol to generate retroviruses. Virus-containing media was supplemented with 4 µg/mL polybrene (Sigma) and applied to target cells, followed by selection with puromycin (Sigma). Nocodazole (Sigma), MG132 (Boston Biochem), ZM447439 (Tocris Bioscience), BI2536 (Selleck Biochemicals) and Hesperadin (synthesized in the Kapoor lab) were dissolved in DMSO. For siRNA treatments, 1.7 × 105 RPE1 cells were transfected with 150 pmol siRNA and 7.5 µL Lipofectamine RNAi Max (Invitrogen) following the manufacturer’s reverse transfection protocol and immediately plated onto no 1.5 glass coverslips. In all experiments, cells were fixed or lysed 42–46 h post-transfection (Fisher Scientific). An siRNA targeting mCherry (5’-GCUCCAAGGCCUACGUGAAUU-3’) was used for control transfections.
To generate B56 family siRNA pools, two individual siRNAs from Dharmacon smart pools for each B56 gene determined to be effective in reducing protein levels of endogenous and/or GFP-tagged B56 genes were chosen. siRNAs were mixed at equimolar ratios, with the exception of B56ε siRNA, which was included at 1.5-fold relative to the other siRNAs. siRNAs used in the B56 family pools are: B56α: GCUCAAAGAUGCCACUUCA (pool 1), and UGAAUGAACUGGUUGAGUA (pool 2); B56β: CGCAUGAUCUCAGUGAAUA (pool 1), and GAACAAUGAGUAUAUCCUA (pool 2); B56γ: GGAUUUGCCUUACCACUAA (pool 1), and GGAAGAUGAACCAACGUUA (pool 2); B56δ: UCCAUGGACUGAUCUAUAA (pool 1), and UGACUGAGCCGGUAAUUGU (pool 2); B56ε: UUAAUGAACUGGUGGACUA (pool 1), and GCACAGCUGGCAUAUUGUA (pool 2).
Publication 2011
Amino Acids, Essential Atmosphere BI 2536 Biological Factors Calcium Phosphates Cells Fetal Bovine Serum Genes, Reporter Glutamine HeLa Cells hesperadin Immunofluorescence Lipofectamine Lysine MG 132 Nocodazole Penicillins Poly A Polybrene Proteins Puromycin Retroviridae RNA, Small Interfering RNA Interference Sulfoxide, Dimethyl Transfection Virus ZM 447439
Cells were grown at 37 °C in a humidified atmosphere with 5% CO2 in DMEM (HeLa, 293-ampho) or 1:1 DMEM:F12 media (RPE1) from Invitrogen supplemented with 10% fetal bovine serum (Atlanta Biologicals), 1X penicillin-streptomcyin and non-essential amino acids (Invitrogen), and 2 mM L-glutamine (Invitrogen). Cells used for live imaging or immunofluorescence were grown on no. 1.5 glass coverslips (Fisher Scientific) coated with Poly-D-lysine (Sigma). 293-ampho cells were transfected according to a calcium phosphate protocol to generate retroviruses. Virus-containing media was supplemented with 4 µg/mL polybrene (Sigma) and applied to target cells, followed by selection with puromycin (Sigma). Nocodazole (Sigma), MG132 (Boston Biochem), ZM447439 (Tocris Bioscience), BI2536 (Selleck Biochemicals) and Hesperadin (synthesized in the Kapoor lab) were dissolved in DMSO. For siRNA treatments, 1.7 × 105 RPE1 cells were transfected with 150 pmol siRNA and 7.5 µL Lipofectamine RNAi Max (Invitrogen) following the manufacturer’s reverse transfection protocol and immediately plated onto no 1.5 glass coverslips. In all experiments, cells were fixed or lysed 42–46 h post-transfection (Fisher Scientific). An siRNA targeting mCherry (5’-GCUCCAAGGCCUACGUGAAUU-3’) was used for control transfections.
To generate B56 family siRNA pools, two individual siRNAs from Dharmacon smart pools for each B56 gene determined to be effective in reducing protein levels of endogenous and/or GFP-tagged B56 genes were chosen. siRNAs were mixed at equimolar ratios, with the exception of B56ε siRNA, which was included at 1.5-fold relative to the other siRNAs. siRNAs used in the B56 family pools are: B56α: GCUCAAAGAUGCCACUUCA (pool 1), and UGAAUGAACUGGUUGAGUA (pool 2); B56β: CGCAUGAUCUCAGUGAAUA (pool 1), and GAACAAUGAGUAUAUCCUA (pool 2); B56γ: GGAUUUGCCUUACCACUAA (pool 1), and GGAAGAUGAACCAACGUUA (pool 2); B56δ: UCCAUGGACUGAUCUAUAA (pool 1), and UGACUGAGCCGGUAAUUGU (pool 2); B56ε: UUAAUGAACUGGUGGACUA (pool 1), and GCACAGCUGGCAUAUUGUA (pool 2).
Publication 2011
Amino Acids, Essential Atmosphere BI 2536 Biological Factors Calcium Phosphates Cells Fetal Bovine Serum Genes, Reporter Glutamine HeLa Cells hesperadin Immunofluorescence Lipofectamine Lysine MG 132 Nocodazole Penicillins Poly A Polybrene Proteins Puromycin Retroviridae RNA, Small Interfering RNA Interference Sulfoxide, Dimethyl Transfection Virus ZM 447439
General laboratory chemicals were obtained from Sigma-Aldrich and Thermo Fisher Scientific. Antibodies to Cep55 (1–222 aa), Cep55 pS436 (peptide antigen, ALNEpSLVE; sheep only), MKlp1 (24–146 aa), Vps4 (1–129 aa), and MKlp2 (63–193 aa) were raised in sheep and rabbit using peptides or hexahistidine-tagged human proteins expressed in and purified from bacteria. Specific antibodies were purified using the antigens conjugated to Affigel-15, eluted with 0.2 M glycine, pH 2.8, then dialyzed against PBS before storage at −80°C. Rabbit antibodies to Plk1, astrin, PRC1, PRC1 pT602, and MKlp1 pS911 have been described previously (Neef et al., 2003 (link), 2006 (link), 2007 (link); Thein et al., 2007 (link)). Commercially available antibodies were used to α-tubulin (mouse DM1A; Sigma-Aldrich), Plk1 (mouse SC-17783; Santa Cruz Biotechnology, Inc.), aurora B (mouse AIM1; BD), and cyclin B1 (mouse GNS3; Millipore). Kinase inhibitors were obtained from Sigma-Aldrich (5 mM flavopiridol 1,000× stock and 1 mM GW843862 1,000× stock), Tocris Bioscience (100 mM ZM447439 10,000× stock), and Axon Medchem (1 mM BI2536 1,000× stock).
Publication 2010
Affi-Gel 15 alpha-Tubulin Antibodies Antigens astrin AURKB protein, human Axon Bacteria BI 2536 Caffeine CCNB1 protein, human Domestic Sheep flavopiridol Glycine His-His-His-His-His-His inhibitors KIF20A protein, human Laboratory Chemicals Mice, House NR4A2 protein, human Peptides Phosphotransferases PLK1 protein, human Rabbits ZM 447439

Most recents protocols related to «BI 2536»

The Animal Ethics Committee of Monash University approved all animal handling and experimental protocols, which were conducted in accordance with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes. C57BL/6J mice were obtained from Monash Animal Research Platform and housed under controlled environmental conditions with free access to water and food.
For in vitro maturation, GV oocytes were collected in M2 (Sigma) containing 200 µM 3-isobutyly-1-methylxanthine (IBMX). Culture was performed in drops of M16 medium (Sigma) under mineral oil (Sigma) at 37°C in a humidified atmosphere of 5% CO2 in air. For collection of MII-stage oocytes, mice were superovulated by sequential intraperitoneal injections of 10IU pregnant mare's serum gonadotropin (PMSG, Intervet) and 10IU human chorionic gonadotropin (hCG, Intervet) at timed intervals before oocyte collection. BI2536 (Sigma-Aldrich) and Volasertib (Selleckchem) were reconstituted in DMSO and used at 5 µM concentration in experiments. CD reconstituted in DMSO and used at 10 µM final concentration. All control groups were treated with DMSO as a vehicle control.
Publication 2023
Animal Ethics Committees Animals Atmosphere BI 2536 Food Human Chorionic Gonadotropin methylxanthine Mice, House Mice, Inbred C57BL Oil, Mineral Oocyte Retrieval Ovum Pregnant Mare Serum Gonadotropins Sulfoxide, Dimethyl volasertib
The animal experiment was approved by the Animal Care Committee of the First Affiliated Hospital of Soochow University. Code of Ethics: The First Affiliated Hospital of Soochow University 2018 Code of Ethics No. 117. To evaluate whether BI2536 and TMZ inhibit tumor growth in vivo, U87 stem cells were used to establish a nude mouse model. Female BALB/c nude mice (4 weeks, 15–17 g) were purchased from the Shanghai Experimental Animal Center of the Chinese Academy of Sciences (Shanghai, China). In order to establish an intracranial model, 5 × 104 U87 stem cells were stereotactically injected into mice. The mice were randomly divided into four groups with 6 mice in each group. BI2536 was dissolved in 30% PEG-400, 0.5% Tween-80, 5% propylene glycol, and TMZ was dissolved in 5% DMSO + 30% PEG300 + ddH2O. During the survival period, mice were injected intraperitoneally with PBS, BI2536 (50 mg/kg/day), TMZ (20 mg/kg/day) or BI2536 (50 mg/kg/day) combined with TMZ (20 mg/kg/day))period. Animal research is conducted in accordance with internationally recognized guidelines and national regulations. The brain was extracted and fixed in 10% formalin, and then embedded in paraffin for immunohistochemistry.
Publication 2023
Animal Care Committees BI 2536 Brain Cardiac Arrest Chinese Females Formalin Immunohistochemistry Mice, Inbred BALB C Mice, Nude Mus Neoplastic Stem Cells Paraffin Embedding polyethylene glycol 300 polyethylene glycol 400 Propylene Glycol Stem Cells Sulfoxide, Dimethyl Tween 80
The HaloTag7-FKBP sequence was fused to a P2A-EGFP and cloned into a lentiviral expression vector and introduced into the HEK293 cell using polybrene (8μg/mL) mediated lentiviral transduction. Clonal selection was performed using 1μg/mL Puromycin. A GFP-infected HEK293 line was used as a negative control. In order to induce membrane localization of the fusion protein, an MGSSKSKPK sequence was added to the N-terminus, and an N-terminal PKKKRKV sequence used for nuclear localization. The 293_AktH and 293_HBTKL cell lines were generated similarly. All cell lines were maintained in DMEM (Gibco) supplemented with 10% heat inactivated FBS (Gibco), 1% penicillin-streptomycin (Gibco), and 1ug/mL Puromycin as needed. Cells were cultured in a 37°C incubator with 5% CO2. Compounds were dissolved in DMSO and all treatments performed in complete medium unless specified otherwise. TAMRA-CA was purchased from Promega (G8251). JQ-1 (HY-13030), BI-2536 (HY-50698), Dinaciclib (HY-10492) were purchased from MedChemExpress.
Publication Preprint 2023
BI 2536 Cell Lines Cells Clone Cells Cloning Vectors dinaciclib HEK293 Cells Membrane Proteins Penicillins Polybrene Promega Puromycin Streptomycin Sulfoxide, Dimethyl Tacrolimus Binding Proteins
To study interaction of L2 with PLK1, protein immunoprecipitation (IP) followed by western blot analysis was performed. 5 × 106 HEK293 cells were seeded on 100 mm dishes and transfected with 20 µg plasmid pL2-3xHA WT or SSTP212AAAA mutant constructs. For co-transfection of pL2-3xHA, p3xFLAG-PLK1, pVps26B-myc and pPBD-myc constructs, 10 µg of each construct were transfected. 24 h post transfection, cells were treated with aphidicolin, nocodazole, or nocodazole and BI2536 for additional 16 h. Cells were lysed in IP lysis buffer (150 mM NaCl, 1% IGEPAL CA-630, 50 mM Tris, 50 mM NaF, pH 7.4) supplemented with protease inhibitor cocktail (Sigma), PhosSTOP (Sigma), 10 mM MgCl2 and 1000 unit benzonase (Millipore), for 30 min at 4 °C in an overhead rotator. Lysates were centrifuged for 20 min with 12000 × g at 4 degrees and pre-clearing was performed with Protein G Agarose (Sigma). Incubation with primary antibodies (HA.11, 1:150; FLAG M2 1:200, c-myc 1:200) was performed for 16 h at 4 °C. Protein G Agarose beads (Sigma) were added for 4 h, and IP was performed according to manufacturer’s instructions. Immunoprecipitated L2 was eluted with 5× Sample Loading buffer (250 mM Tris, 10% SDS, 30% glycerol, 20 mM DTT 0,05% Bromophenol Blue, pH 6.8) and boiling samples at 95 °C for 10 min. Samples were analyzed by SDS-PAGE and western blot.
Publication 2023
Antibodies Aphidicolin Benzonase BI 2536 Bromphenol Blue Buffers Cells G-substrate Glycerin HEK293 Cells Hyperostosis, Diffuse Idiopathic Skeletal Igepal CA-630 Immunoprecipitation Magnesium Chloride Nocodazole Oncogenes, myc Plasmids PLK1 protein, human Protease Inhibitors Proteins SDS-PAGE Sepharose Sodium Chloride Transfection Tromethamine Western Blot
About 6 × 105 HaCaT-GFP-BAP cells were seeded in 24-well plates. The following day, cells were infected with 600, 200, or 67 ng L1/well of HPV16 WT or SSTP212AAAA L2-BirA PsVs. 20 h p.i., samples were rinsed with PBS, surface virus was removed by an alkaline PBS (pH10.6) wash followed by another PBS rinse, and samples were processed for reducing SDS-PAGE followed by Western blot analysis40 (link). L2 was detected by mouse monoclonal anti-L2 (K4) (a kind gift of Martin Müller) and GFP by rabbit anti-GFP (Takara Bio Clonetech). IR-Dye conjugated secondary antibodies anti-mouse and anti-rabbit (LI-COR Biosciences GmbH) were used and blots were imaged on the LI-COR Odyssey Infrared Imaging System.
For inhibition studies, the viral inoculum (2 × 108 viral genome equivalents/well) was not removed from cells, and luciferase assays were performed at 24 h p.i. DMSO carrier or PLK1 inhibitors BI2536 and BI6727 (each at 100 nM final concentration) were added at the time of infection and left for the duration.
Publication 2023
Antibodies BI 2536 Biological Assay Cells HaCaT Cells Human papillomavirus 16 Infection inhibitors Luciferases Mus Patent Ductus Venosus PLK1 protein, human Psychological Inhibition Rabbits SDS-PAGE Sulfoxide, Dimethyl Viral Genome Virus Western Blotting

Top products related to «BI 2536»

Sourced in United States, China, Germany
BI2536 is a small molecule that inhibits the protein kinase PLK1, which is involved in cell division. It has been used as a research tool to study the role of PLK1 in cellular processes.
Sourced in United States, Germany, United Kingdom, Japan, Sao Tome and Principe, Canada, China, Switzerland, France, Poland, Macao, Australia
Nocodazole is a synthetic compound that acts as a microtubule-destabilizing agent. It functions by binding to and disrupting the polymerization of microtubules, which are essential components of the cytoskeleton in eukaryotic cells. This property makes Nocodazole a valuable tool in cell biology research for studying cell division, cell motility, and other cellular processes that rely on the dynamics of the microtubule network.
Sourced in United States, Germany, China, United Kingdom, Macao, Sao Tome and Principe, France, Canada, Italy, Switzerland, Morocco, Belgium, Japan, Sweden, Australia, Austria, Israel, Spain
MG132 is a proteasome inhibitor, a type of laboratory reagent used in research applications. It functions by blocking the activity of the proteasome, a complex of enzymes responsible for the degradation of proteins within cells. MG132 is commonly used in cell biology and biochemistry studies to investigate the role of the proteasome in various cellular processes.
Sourced in United States, Germany, United Kingdom, Sao Tome and Principe, France, Italy, Japan, China
Thymidine is a nucleoside that is a component of DNA. It serves as a building block for DNA synthesis and is essential for cellular division and growth.
Sourced in Netherlands
BI2536 is a laboratory compound used for research purposes. It functions as a selective inhibitor of the protein kinase PLK1, which plays a role in cell division and proliferation. The core function of BI2536 is to modulate the activity of PLK1 in in vitro and in vivo experimental systems.
Sourced in United States, Germany, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, India, Canada, Switzerland, Japan, Australia, Spain, Poland, Belgium, Brazil, Czechia, Portugal, Austria, Denmark, Israel, Sweden, Ireland, Hungary, Mexico, Netherlands, Singapore, Indonesia, Slovakia, Cameroon, Norway, Thailand, Chile, Finland, Malaysia, Latvia, New Zealand, Hong Kong, Pakistan, Uruguay, Bangladesh
DMSO is a versatile organic solvent commonly used in laboratory settings. It has a high boiling point, low viscosity, and the ability to dissolve a wide range of polar and non-polar compounds. DMSO's core function is as a solvent, allowing for the effective dissolution and handling of various chemical substances during research and experimentation.
Sourced in United States
ZM447439 is a chemical compound used in research applications. It functions as a selective inhibitor of the protein kinase CDK8/19. The product is provided as a powder form and is intended for laboratory use only.
Sourced in United States, Germany, China
Volasertib is a chemical compound used in laboratory research settings. It functions as a kinase inhibitor, specifically targeting the polo-like kinase 1 (PLK1) enzyme. Volasertib is commonly utilized in scientific investigations to study cell cycle regulation and cell division processes.
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States
BI2536 is a small molecule inhibitor that selectively targets the serine/threonine-protein kinase PLK1 (Polo-like kinase 1). It functions as a mitotic kinase that plays a critical role in cell division.

More about "BI 2536"

BI 2536 is a potent and selective inhibitor of the Polo-like kinase 1 (PLK1) enzyme, which plays a crucial role in cell division and proliferation.
This small-molecule compound has shown promise in preclinical studies for the treatment of various types of cancer, including solid tumors and hematological malignancies.
BI 2536 exerts its anti-cancer effects by disrupting the normal function of PLK1, leading to cell cycle arrest and apoptosis in rapidly dividing cancer cells.
Research on BI 2536 is an active area of investigation, with ongoing clinical trials evaluating its safety and efficacy in different cancer settings.
Understanding the mechanisms of action and optimizing the research protocols for BI 2536 is crucial for advancing its development as a potential cancer therapeutic.
BI 2536 is often compared to other mitotic inhibitors, such as Nocodazole and MG132, which also target cell division and proliferation.
Additionally, Thymidine and DMSO are commonly used in BI 2536 research protocols.
The Polo-like kinase inhibitor ZM447439 and the related compound Volasertib are also of interest in the field.
Leveraging advanced AI-driven platforms like PubCompare.ai can help researchers optimize their BI 2536 research protocols by easily locating and comparing protocols from literature, pre-prints, and patents.
This can lead to the identification of the best protocols and products, ultimately accelerating research and driving breakthrough discoveries in the field of BI 2536 and cancer therapeutics.