CDTA

The tcdA, tcdB, and tcdAB C. difficile mutants were made using targetron technology and utilizing appropriately retargeted derivatives of plasmid pDLL1 and conjugative matings from a B. subtilis BS34A donor strain, as previously described (23 (link)). For isolation of the double toxin mutant, antibiotic selection could not be used, and so this strain was detected by PCR screening for both the tcdA- and tcdB-specific insertion of the targetron. The targetron element inserted after nucleotide 4068 of the sense strand for tcdA, nucleotide 1587 of the sense strand for tcdB, and nucleotide 421 of the sense strand for cdtA. The tcdAB double toxin mutant was constructed using tcdB mutant 1 as the parent strain. To verify that the targetron insertions had occurred as anticipated, PCR using the following oligonucleotide primers were used: for tcdA, EBS-universal (sigma) and JRP3602 (TAAATGTACTACCTACAATAACAGAGGG); for tcdB, EBS-universal and JRP1592 (GTGGCCCTGAAGCATATG); and for cdtA, EBS-universal and JRP1744 (GGGAAAGAAAAGAAGCAGAAAG). Strain numbers were assigned as follows: for tcdA mutant 1, DLL3043; for tcdA mutant 2, DLL3045; for tcdB mutant 1, DLL3101; for tcdB mutant 2, DLL3102; and for the tcdAB mutant, DLL3121.
Each mutant was also confirmed by Southern hybridization analysis as described previously, using an ermB-specific PCR product (47 (link)), a tcdB- or tcdA-specific PCR product (9 (link)), or a cdt-specific PCR product amplified using primers JRP1746 (GGAAGACGAAGATTTGGATACA) and JRP2505 (GGTTTTAGCTCAGACATAGGGA).
To confirm the correct toxin production profiles in each mutant and wild-type strain, TcdA-, TcdB-, and CdtA-specific Western blot analyses were performed as described previously (9 (link), 13 (link)), except that toxins were precipitated from culture supernatants using chloroform-methanol (8 (link)), and Vero and HT29 cell cytotoxicity and neutralization assays were also performed as described previously (9 (link)).
Complementation of the tcdA and tcdB genes was attempted; however, despite multiple attempts, it did not prove possible to clone the intact tcdA or tcdB gene into an appropriate shuttle plasmid that would facilitate conjugative transfer into C. difficile.

Secreted CDTa/b was assessed by Western blot analysis of 48-hour culture-free supernatants exactly as described previously [17 (link)], using an HRP-Chicken anti-Clostridium difficile Binary Toxin Subunit A or B antibody (Gallus-Immunotech, Shirley, MA).

Strains and plasmids used in this study are listed in Table 1, whereas primers are listed in Table 2. The genes encoding cdtA and cdtB were deleted from C difficile R20291ΔpyrE using allelic-exchange technology [16 (link)]. To achieve this, left and right homology arms corresponding to the regions annealing immediately upstream and downstream of cdtA/B were amplified by polymerase chain reaction (PCR) using cdtAB LAF/RAR and cdtAB RAF/RAR primer sets, respectively. The homology arms were then spliced together by overlap-extension (SOEing) PCR by means of their overlapping 20-base pair (bp) homologous regions before cloning the ensuing product into pMTL-YN4 using flanking SbfI-AscI restriction sites, thus generating the knockout cassette (KOC) pMTL-YN4-cdtAB KOC. The plasmid was then conjugated into C difficile R20291ΔpyrE exactly as previously described, and transconjugants were selected on the basis of thiamphenicol resistance [17 (link)]. Thereafter, single crossover integrants (SCOs) were identified by 2 parallel PCR screens using cdtAB diag F/YN4 primers for left arm recombinants and YN4 F/cdtAB diag R primers for right arm recombinants, respectively (data not shown). To select for double crossover recombinants, SCO integrants were harvested, diluted 1 × 10⁻³, and cultured onto C difficile minimal medium (CDMM) [18 (link)] containing 500 µg/mL 5-fluoroorotic acid and 1 µg/mL uracil, to force plasmid loss through the counter-selection marker pyrE and to select for double crossover mutants before confirming plasmid loss on the basis of thiamphenicol sensitivity. The intended deletions were confirmed by PCR analysis using cdtAB diag F/R primers. The deletion mutant generated an approximately 4-kbp product, while its wild-type (WT) counterpart generated a 4.6-kbp product (Figure 1A). Finally, the pyrE allele was restored to WT using pMTL-YN2 exactly as described previously [17 (link)].
Strains differentially producing CDTa or CDTb were generated by the integration of either cdtA or cdtB at the pyrE locus, under the control of cdtA promoter P_cdtA. First, cdtA coupled with its native promoter was amplified by PCR using P_cdtA F and cdtA R primers, the product of which was cloned into pMTL-YN2C by means of flanking NotI-BamHI restriction sites, thus generating the complementation cassette pMTL-YN2C-P_cdtA-cdtA. In a similar fashion, pMTL-YN2C-P_cdtA-cdtB was generated by amplifying P_cdtA using P_cdtA F/P_cdtA LAR primers, and cdtB was generated using cdtB RAF/cdtB RAR primers, before SOEing the products together and cloning them into pMTL-YN2C by means of flanking NotI-SalI restriction sites. The CDTb-encoding construct could only be generated with a single-nucleotide polymorphism in the promoter region of P_cdtA using an A-G substitution at position-124 relative to the start codon. The resultant plasmids were applied in parallel, to individually integrate the respective CDT constructs at the pyrE locus of R20291ΔpyrEΔcdtAB concomitant with the repair of pyrE, after successful conjugation and selection for uracil prototrophs on CDMM lacking uracil. The PCR analysis using primer pyrE WT F, coupled with either cdtA R or cdtB RAR, demonstrated effective knock-in at the pyrE locus (Figure 1B), thus generating strains R20291ΔcdtAB*P_cdtA-cdtA and R20291ΔcdtAB*P_cdtA-cdtB.