Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Citral

Citral

Citral is a naturally occurring acyclic monoterpene aldehyde found in the essential oils of various plants, including lemongrass, lemon, and other citrus fruits.
It is known for its distinctive lemon-like aroma and has been widely used in the food, fragrance, and cosmetic industries.
Citral exhibits a range of biological activities, including antioxidant, anti-inflammatory, and antimicrobial properties, making it a valuable compound for research and development.
PubCompare.ai, an AI-driven platform, can enhance the reproducibility and accuracy of your Citral research by helping you locate protocols from literature, pre-prints, and patents, and leveraging AI-driven comparisons to identify the best protocols and prodcuts.
This powerful tool can improve your research outcomes and advance the understanding of Citral's potential applications.

Most cited protocols related to «Citral»

1
Antifungal Activity and Cell Wall Targeting
Cited 8 times
The assay was performed using medium with and without sorbitol (control) to evaluate possible mechanisms involved in the antifungal activity of the test product on the yeast cell wall. The sorbitol was added to the culture medium in a final concentration of 0.8 M. The assay was performed by microdilution method in 96-well plates in a “U” (Alamar, Diadema, SP, Brazil). The plates were sealed aseptically, incubated at 35°C, and readings were taken at 2 and 7 days. Based on the ability of sorbitol to act as a fungal cell wall osmotic protective agent, the higher MIC values observed in the medium with added sorbitol compared to the standard medium implicated the cell wall as one of the possible cell targets for the product tested [36 (link)]. Amphotericin B was used as the control drug. The assay was performed in duplicate and expressed as the geometric mean of the results.
Leite M.C., Bezerra A.P., de Sousa J.P., Guerra F.Q, & Lima E.D. (2014). Evaluation of Antifungal Activity and Mechanism of Action of Citral against Candida albicans. Evidence-based Complementary and Alternative Medicine : eCAM, 2014, 378280.
Full text: Click here
Publication 2014
Amphotericin B Antifungal Agents Biological Assay Cell Wall Osmosis Protective Agents Sorbitol Yeast, Dried
2
Ergosterol Binding Assay for Antifungal Evaluation
Cited 7 times
To assess if the product binds to the fungal membrane sterols, this experiment was performed according to the method described by Escalante et al. [37 (link)], with some modifications. The ergosterol was prepared at the time of test execution, where it was first pulverized (with the help of a pre-sterilized porcelain mortar and pestle) and dissolved in DMSO (no more than 10% of final volume), and Tween 80 at 1%, in accordance with the desired concentration and volume. The formed emulsion was then homogenized, heated to augment the solubility, and diluted with the liquid culture medium.
The MIC of citral against C. albicans was determined by using broth microdilution techniques according to the guidelines of the CLSI for yeasts (M27-A2) [27 ], in the presence and absence of exogenous ergosterol (Sigma-Aldrich, São Paulo, SP, Brazil) added to the assay medium, in different lines of the same microplate. Briefly, a solution of citral was doubly diluted serially with RPMI-1640 (volume = 100 μL) containing plus ergosterol at a concentration of 400 μg/mL. A volume of 10 μL of yeast suspension (0,5 McFarland) was added to each well. Finally, we realized the same procedure for amphotericin B, whose interaction with membrane ergosterol is already known, which served as a control drug. The plates were sealed and incubated at 35°C. The plates were read after 24 h of incubation and MIC was determined as the lowest concentration of test agent inhibiting the visible growth. This assay was carried out in duplicate and the geometric mean values were calculated. Thus, this binding assay reflected the ability of compound to bind with the ergosterol.
Leite M.C., Bezerra A.P., de Sousa J.P., Guerra F.Q, & Lima E.D. (2014). Evaluation of Antifungal Activity and Mechanism of Action of Citral against Candida albicans. Evidence-based Complementary and Alternative Medicine : eCAM, 2014, 378280.
Full text: Click here
Publication 2014
Amphotericin B Biological Assay Candida albicans citral Dental Porcelain Emulsions Ergosterol Phytosterols Sulfoxide, Dimethyl Tissue, Membrane Tween 80 Yeast, Dried Yeasts
3
Evaluating Plasma Membrane Integrity in P. digitatum
Cited 5 times
Plasma membrane integrity of the P. digitatum cells with citral (0 or 1/2MIC) were analyzed by propidium iodide (PI) staining coupled with fluorescence microscopy (Liu et al., 2010 (link)) with minor modifications. The 2-day-old mycelia from 50 mL PDB were collected and centrifuged at 4,000 g for 10 min. The collected mycelia were stained with 10 μg/mL of PI for 15 min at 30°C. Residual dyes were removed by washing twice with PBS (pH 7.0). Samples were observed with an ECLIPSE TS100 microscope (Nikon, Japan), and the fluorescence value was determined by a F97 PRO fluorescence spectrophotometer (Lengguang Technology, Shanghai, China). These experiments were also performed with antioxidant Cys at a concentration of 10 μM.
OuYang Q., Tao N, & Zhang M. (2018). A Damaged Oxidative Phosphorylation Mechanism Is Involved in the Antifungal Activity of Citral against Penicillium digitatum. Frontiers in Microbiology, 9, 239.
Full text: Click here
Publication 2018
Antioxidants Cells citral Dyes Fluorescence Microscopy Microscopy, Fluorescence Mycelium Plasma Plasma Cells Plasma Membrane Propidium Iodide Tissue, Membrane
4
Citral-Induced Transcriptional Profiling of Ergosterol Biosynthesis Genes in Penicillium digitatum
Cited 5 times
RNA was extracted from P. digitatum cells exposure to citral at various concentrations (0 and 1/2MIC) for 0, 30, 60, and 120 min using the Trizol reagent (Invitrogen, USA) following the manufacturer’s instructions. Two micrograms of DNA-free RNA were used for reverse transcription by M-MLV (Promega, USA) with oligo dT18. RTFQ-PCR was performed on a BIO-RAD CFX Connect Thermal Cycler using FastStart Universal SYBR Green Master (Roche, Switzerland). All primer pairs for expression assays are listed in Table 1. RTFQ-PCR was programmed as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s, 60 °C for 1 min. The 2-△△CT method was used to quantify the value of every sample using actin gene as an internal reference [27 (link)].

Primer pair sequences designed for validation of differentially expressed genes in CK30 and T30 treatment P. digitatum using Real-time Fluorescence Quantitative PCR (RTFQ-PCR)

Gene IDGene namePrimer sequence (5′-3′, forward/reverse)
Unigene6144ActinTGCGCTGAACCGAACTGCCGTCGGGAGCCTCGAAGCGCTC
Unigene8313ERG7GCGCTGGCGATTGGTCGATG
CAGGCCCAGTTTCCGGGCTCC
Unigene8539ERG11CCATCGACCTCGTCCCCGCC
TCGCGCTTGCGGTTTTGGGG
Unigene6797ERG6CGCGTGATGCCGCCTTCAAC
TGAGCCTTGCGGGCCTCACG
Unigene5828ERG3CAGGCCATGGCCGCAATGCC
GGTGCAGGCCACGGTGGATCC
Unigene8125ERG5TCTCGCCATTGGCGGATGCG
TCTCGCCATTGGCGGATGCG
OuYang Q., Tao N, & Jing G. (2016). Transcriptional profiling analysis of Penicillium digitatum, the causal agent of citrus green mold, unravels an inhibited ergosterol biosynthesis pathway in response to citral. BMC Genomics, 17, 599.
Full text: Click here
Publication 2016
Actins Biological Assay Cells citral Fluorescence Genes Oligonucleotide Primers Oligonucleotides Promega Real-Time Polymerase Chain Reaction Reverse Transcription SYBR Green I trizol
5
Modeling Growth Curves of C. sakazakii
Cited 5 times
The growth curves in TSB at 37°C were determined as previously described [17 ]. C. sakazakii strain ATCC 29544 was grown to an OD600 value of 0.1 in TSB, then 125 μL of the culture was transferred into each well of a 96-well microtiter plate (Nunc, Copenhagen, Denmark). Citral was added to the cultures to obtain final concentrations of 1/16MIC, 1/8MIC, 1/4MIC, 1/2MIC, and MIC, and TSB was used as a negative control. Bacteria were further cultured at 37°C, and cell growth was monitored at 600 nm using a multimode plate reader (Tecan, Infinite™ M200 PRO, Männedorf, Switzerland).
The model used to fit growth curves to the data as-obtained was comprised of a modified Gompertz equation as follows:
ODt=A+(B−A)exp{−exp[−μ(t−M)]}
λ=M−(1/μ), and umax=(B−A)μ/e
where ODt is optical density at 600 nm (OD600) at time t, t is the time (in hours) that had elapsed since incubation, B is the maximum OD600, A is the initial OD600, M is the time (in hours) of the inflexion point in the exponential phase of model function, μ is the relative growth rate at time M, λis the lag time (i.e., the time until the lag period ended,) and μmax is the maximum growth rate achieved (ΔOD600 per hour.) The model was evaluated for goodness of fit according to the coefficient of determination R2.
Shi C., Song K., Zhang X., Sun Y., Sui Y., Chen Y., Jia Z., Sun H., Sun Z, & Xia X. (2016). Antimicrobial Activity and Possible Mechanism of Action of Citral against Cronobacter sakazakii. PLoS ONE, 11(7), e0159006.
Full text: Click here
Publication 2016
Bacteria Cells citral M-200 Strains

Most recents protocols related to «Citral»

1
Quantification of Citral in Australian Lemongrass Extracts
Not available on PMC !
Water and methanol extracts of Australian native lemongrass were used to determine the citral content. The HPLC-PDA method was used to determine citral content in extracts using the instrumental method described previously [37] (link). A reverse-phase Waters ® HSS-T3 column (150 mm × 2.1 mm i.d; 1.8 µm, Waters, Sydney, NSW, Australia), maintained at 25 • C, was used to separate the compounds with mobile phases consisting of 0.1% formic acid in Milli-Q water (mobile phase A) and 0.1% formic acid in acetonitrile (mobile phase B). The gradient program applied at the flow rate of 0.2 mL/min was as follows: 5% B-1 min, 70% B-4.3 min, isocratic elution at 70% B until 8 min, 95% B-10 min, isocratic at 95% B until 12 min, and ramped back to the original condition at 5% B for 4 min before the next injection. The injection volume was 2 µL. The sample extracts were scanned at a UV wavelength ranging from 200 to 400 nm, and the absorbance value of citral at 233 nm (maxima absorbance) was extracted for data analysis using Chromeleon CDS ver 7.2 software (Thermo Fisher Scientific, Brisbane, QLD, Australia). External calibration curves of citral standard, consisting of 2 isomers: neral and geranial, were prepared in methanol at different concentrations ranging from 21.49 to 1074.5 mg/L). The linear equations obtained for the first peak assigned to neral citral (y = 0.2309x -0.5152, r 2 = 0.9986) and the second peak, geranial citral (y = 0.1872x -0.5809, r 2 = 0.9987) were used to quantify the level of neral citral and geranial citral in the sample extracts, respectively. In addition, the total citral level of the extracts was also calculated as the sum of the amount of neral and geranial.
Zhou Y., Akter S., Phan A.D.T., Bobasa E.M., Damyeh M.S., Sivakumar D., & Sultanbawa Y. (2024). Australian Native Lemongrass (Cymbopogon ambiguus A. Camus): An Underestimated Herbal Plant. AppliedChem, 4(2), 212-223.
Publication 2024
2
Citral's Antimicrobial Efficacy against G. vaginalis

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2024
3
Citral Minimal Inhibitory Concentration against Yeast
The minimal inhibitory concentration (MIC) was determined as the lowest concentration of citral (3,7-dimethyl-2,6-octadienal, geranial and neral mixture), (Sigma Aldrich, St. Louis, MO, USA), inhibiting visible growth of the tested microorganism. citral stock solution was first prepared with a concentration of 40 μL/mL. Stock solution was then diluted with sterile water and 1% DMSO, giving a succession of concentrations ranging from 0.078 to 20 μL/mL [17 (link)]. Overnight culture of the wild-type yeast S. cerevisiae Σ1278b was used to prepare the microbial inoculation used for the test, reaching an OD of 0.2. Aliquots of 100 μL of diluted inoculation at desired cell concentration were added to each well in the 96-well micro-dilution polystyrene plate, which already contained 100 μL of the citral dilution. The plates were then incubated at 30 °C for 24 h. DMSO alone (at 1% concentration) and sterile water was used as positive control. Each experiment was repeated twice. The preculture and dilutions of the parental strain were prepared with an inoculum solution of YEPD (2% bacto-peptone, 1% yeast extract, and 2% glucose) reaching an OD of circa 0.2 (about 150 μL of the preculture for 10 mL of the prepared medium) in YEPD at 30 °C for 24 h.
El Harati R., Fancello F., Multineddu C., Zara G, & Zara S. (2024). Screening and In Silico Analyses of the Yeast Saccharomyces cerevisiae Σ1278b Bank Mutants Using Citral as a Natural Antimicrobial. Foods, 13(10), 1457.
Full text: Click here
Publication 2024
4
Citral Inhibits Gardnerella vaginalis Biofilms

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2024
5
Preparation of Citral-loaded Chitosan Particles

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2024

Top products related to «Citral»

1
Citral by Merck Group
Sourced in United States, Germany, Italy, United Kingdom, Macao, Sao Tome and Principe, India, Spain, Hungary, China
Citral is a colorless, oily liquid that is commonly used as a flavoring and fragrance ingredient. It is a naturally occurring compound found in various plant oils, such as lemongrass and citrus fruits. Citral is a key component in the production of various chemicals and is widely used in the food, cosmetic, and pharmaceutical industries.
2
Linalool by Merck Group
Sourced in United States, Germany, Italy, United Kingdom, China, Spain, France, Brazil, Switzerland, Poland, Australia, Hungary, Belgium, Sao Tome and Principe
Linalool is a naturally occurring terpene alcohol found in various plant species. It is a colorless to pale yellow liquid with a floral, citrus-like aroma. Linalool is commonly used as a fragrance ingredient in personal care products and as a flavoring agent in food and beverages. Its core function is as a chemical precursor and intermediate in the synthesis of other compounds.
3
Geraniol by Merck Group
Sourced in United States, Germany, United Kingdom, Brazil, Italy, Macao, China, India, Belgium, France
Geraniol is a naturally occurring alcohol compound commonly found in the essential oils of various plant species, such as geraniums, lemongrass, and citronella. It is a colorless or pale yellow liquid with a floral, rose-like aroma. Geraniol is used as a fragrance component in personal care products and as a flavoring agent in food and beverage applications.
4
Eugenol by Merck Group
Sourced in United States, Germany, Spain, Italy, France, United Kingdom, India, China, Brazil, Portugal, Sao Tome and Principe, Poland, Belgium, Canada, Israel, Australia
Eugenol is a clear, colorless to pale yellow liquid organic compound. It is the primary chemical component of clove oil, and is also found in various other essential oils. Eugenol has a characteristic aroma and is commonly used as a fragrance and flavoring agent.
5
Limonene by Merck Group
Sourced in United States, Germany, Italy, United Kingdom, Spain, Mexico, China, Brazil, Switzerland, Canada, Czechia
Limonene is a naturally occurring hydrocarbon found in the rinds of citrus fruits. It is commonly used as a solvent in laboratory settings due to its ability to dissolve a wide range of organic compounds.
6
Dimethyl sulfoxide (dmso) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, India, Canada, Switzerland, Japan, Australia, Spain, Poland, Belgium, Brazil, Czechia, Portugal, Austria, Denmark, Israel, Sweden, Ireland, Hungary, Mexico, Netherlands, Singapore, Indonesia, Slovakia, Cameroon, Norway, Thailand, Chile, Finland, Malaysia, Latvia, New Zealand, Hong Kong, Pakistan, Uruguay, Bangladesh
DMSO is a versatile organic solvent commonly used in laboratory settings. It has a high boiling point, low viscosity, and the ability to dissolve a wide range of polar and non-polar compounds. DMSO's core function is as a solvent, allowing for the effective dissolution and handling of various chemical substances during research and experimentation.
7
Carvacrol by Merck Group
Sourced in United States, Germany, Italy, Spain, Sao Tome and Principe, United Kingdom, Canada, India, Poland, France, Portugal, Brazil
Carvacrol is a monoterpenic phenol compound that is a naturally occurring ingredient found in the essential oils of various plants, such as oregano, thyme, and savory. It is a colorless or pale yellow liquid with a characteristic aroma. Carvacrol exhibits antimicrobial and antioxidant properties, making it a potentially useful compound for various industrial and research applications.
8
Thymol by Merck Group
Sourced in United States, Germany, Spain, Italy, India, United Kingdom, Sao Tome and Principe, Poland, Belgium, France, Portugal, Canada, Israel, Hungary
Thymol is a chemical compound that functions as a preservative and antimicrobial agent. It is a naturally occurring monoterpene phenol derivative found in various essential oils, such as thyme oil. Thymol exhibits antiseptic, antifungal, and antibacterial properties.
9
Geranyl acetate by Merck Group
Sourced in United States, Germany
Geranyl acetate is a colorless, oily liquid chemical compound. It is the acetate ester of the alcohol geraniol. Geranyl acetate is used as a fragrance and flavor ingredient in various consumer products.
10
Myrcene by Merck Group
Sourced in United States, Germany, Italy, United Kingdom
Myrcene is a lab equipment product manufactured by Merck Group. It is a volatile organic compound commonly used as a reference standard for analytical and research applications. The core function of Myrcene is to serve as a calibration and quality control material for various analytical techniques, such as gas chromatography and mass spectrometry.

More about "Citral"

Citral, a naturally occurring acyclic monoterpene aldehyde, is found in the essential oils of various plants such as lemongrass, lemon, and other citrus fruits.
This versatile compound is known for its distinctive lemon-like aroma and has been widely utilized in the food, fragrance, and cosmetic industries.
Citral exhibits a range of beneficial biological activities, including antioxidant, anti-inflammatory, and antimicrobial properties, making it a valuable compound for research and development.
Closely related to other essential oil components like Linalool, Geraniol, Eugenol, Limonene, and Carvacrol, Citral shares many of their desirable characteristics.
To enhance the reproducibility and accuracy of your Citral research, PubCompare.ai, an AI-driven platform, can be a powerful tool.
This platform helps you locate protocols from literature, pre-prints, and patents, and leverages AI-driven comparisons to identify the best protocols and products.
By utilizing this innovative technology, you can improve your research outcomes and advance the understanding of Citral's potential applications.
Whether you're studying the aroma, medicinal properties, or industrial uses of Citral, PubCompare.ai can be a valuable resource.
Its ability to integrate information from various sources, including DMSO, Thymol, Geranyl acetate, and Myrcene, can provide valuable insights and support your research endeavors.
Experience the power of this AI-driven platform and unlock the full potential of Citral in your work.