Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Citrate

Citrate

Citrate is a key metabolic intermediate involved in the citric acid cycle, a central pathway for energy production in cells.
It plays a crucial role in cellular respiration, serving as a precursor for various biomolecules.
Citrate has a diverse range of biological functions, including buffering cellular pH, regulating enzyme activity, and contributing to the mineralization of bone.
Understanding the dynamics and regulation of citrate metabolism is essential for researchers studying topics such as energy metabolism, mitochondrial function, and metabolic disorders.
PubCompare.ai offers a powerful AI-driven platform to optimize citrate research, helping scientists locate the best protocols from scientific literature, pre-prints, and patents, and enhace reproducibility and accuaracy in their citrate studies.

Most cited protocols related to «Citrate»

1
Crystallization of H1R-T4L in Pichia pastoris
H1R-T4L was expressed in yeast Pichia pastoris. Ligand binding assays were performed as described in Methods. Pichia pastoris membranes were solubilized using 1% (w/v) n-dodecyl-β-D-maltopyranoside and 0.2% (w/v) cholesteryl hemisuccinate, and purified by immobilized metal ion affinity chromatography (IMAC). After IMAC, the C-terminal GFP was cleaved by Tobacco Etch virus (TEV) protease. Then the sample mixture was passed through IMAC to remove the cleaved His-tagged GFP and TEV protease. Receptor crystallization was performed by lipidic cubic phase (LCP) method. The protein-LCP mixture contained 40% (w/w) receptor solution, 54% (w/w) monoolein, and 6% (w/w) cholesterol. Crystals were grown in 40-50 nl protein-laden LCP boluses overlaid by 0.8 μl of precipitant solution (26-30% (v/v) PEG400, 300 mM ammonium phosphate, 10 mM MgCl2, 100 mM Na-citrate pH 4.5 and 1 mM doxepin) at 20 °C. Crystals were harvested directly from LCP matrix and flash frozen in liquid nitrogen. X-ray diffraction data were collected at 100 K with a beam size of 10 × 10 microns on the microfocus beamline I24 at the Diamond Light Source (UK). Data collection, processing, structure solution and refinement are described in Methods.
Shimamura T., Shiroishi M., Weyand S., Tsujimoto H., Winter G., Katritch V., Abagyan R., Cherezov V., Liu W., Han G.W., Kobayashi T., Stevens R.C, & Iwata S. (2011). Structure of the human histamine H1 receptor complex with doxepin. Nature, 475(7354), 65-70.
Publication 2011
ammonium phosphate Biological Assay Cholesterol cholesterol-hemisuccinate Chromatography, Affinity Citrate Crystallization Cuboid Bone Diamond Doxepin Freezing Komagataella pastoris Ligands Lipids Magnesium Chloride Metals monoolein Nitrogen polyethylene glycol 400 Proteins Saccharomyces cerevisiae TEV protease Tissue, Membrane TNFSF14 protein, human X-Ray Diffraction
2
Optimizing Growth Conditions for M. extorquens
We first tested whether we could reliably measure M. extorquens exponential growth rates using a robotic measurement system under similar conditions to those used by previous investigators with E. coli[3] (link). AM1 cultures were grown in a Microtest 96-well tissue culture treated plates (Falcon-35-3072) using buffered medium comprised of 14.5 mM of K2HPO4, 18.8 mM of NaH2PO4, 8 mM ammonium sulfate, 20 µM calcium chloride and the C7 metal mix that was left unchelated (i.e., no citrate) with 17 mM methylamine·HCL added to the base medium. The mixture was aliquoted in 160 µL portions into wells of a 96-well plate. The growth curves from the initial tests in 96 well plates showed huge deviations from the exponential model and were exceptionally noisy. We concluded that 96-well plates were inadequate for sustained exponential growth of M. extorquens. We re-evaluated this conclusion at the end of this project, after optimizing our strains and media, by again growing M. extorquens in MP media and in 96-well plates (Fig S1). Although exponential growth could then be achieved, relative to a 48-well plate grown simultaneously with the same inoculum, the average estimated growth rate was 7% slower and the std. error was 50% larger.
In contrast, we found that 48-well plates did allow for adequate mixing and consistent exponential growth (Fig 1D). We therefore altered the robotic system by installing new custom-built racks so that it could use 48-well plates (CoStar-3548) instead of 96-well plates. In contrast to the 96-well plates where the medium did not appear to move within the well, the media in the 48-well plates rhythmically swirled around. We also tested a second type of 48-well plate, from the Cellstar line made by Greiner Bio-One (Catalog #677 102). Surprisingly, although medium in the CoStar plates visibly swirled while shaking, the meniscus in the Cellstar plates, as in the 96-well plates, stayed at approximately the same level and did not appear to move; correspondingly, cultures grew much more poorly in Cellstar plates. For all future work in this paper, we grew the cultures in CoStar plates in 640 µL per well with the incubator shaking at 650 RPM, as growth and the swirling of the liquid appeared to be as good or better than the range of other values tested.
Delaney N.F., Kaczmarek M.E., Ward L.M., Swanson P.K., Lee M.C, & Marx C.J. (2013). Development of an Optimized Medium, Strain and High-Throughput Culturing Methods for Methylobacterium extorquens. PLoS ONE, 8(4), e62957.
Publication 2013
Calcium chloride Citrate Meniscus Metals methylamine potassium phosphate, dibasic Strains Sulfate, Ammonium Tissues
3
Validating PocketMatch on Diverse Protein-Ligand Datasets
PocketMatch has been validated on a variety of datasets – PDBBind, a set of tetrameric proteins and a curated dataset containing known similarities of four ligand types (Table 1). To eliminate noise in the datasets, sites corresponding to small ligands with less than 6 non-hydrogen atoms and covalently bound ligands were not considered here. The PDBBind dataset [25 (link)] contains a comprehensive curated set of 1091 protein-ligand complexes determined crystallographically. Using this, two sub-datasets were derived – Table 1-i: A dataset which has only one ligand site for one ligand type in each protein, amounting to 786 proteins and 893 sites and Table 1-ii: A dataset in which ligands suggested to contribute to noise by Jackson and co-workers [14 (link)] were removed, but all sites for all ligand types were considered, amounting to 456 proteins and 1146 sites corresponding to 289 ligand types. Tetramers (Table 1-iv), obtained from PQS server, containing 3768 proteins has been curated to yield a dataset of 1525 proteins having 11301 sites has been chosen for studying the sensitivity of PocketMatch with respect to recognizing known highly similar sites. Another dataset representing multiple sites for four known ligands was curated (Table 1-iii). 51 sites from 27 different proteins in PDBBind for Citrate (CIT), Methotrexate (MTX), Indinavir (MK1) and phosphoglycerate (PGA) were chosen for the dataset. A distance metric measuring the dis-similarity between these sites was computed using PocketMatch and their clustering was studied.
Yeturu K, & Chandra N. (2008). PocketMatch: A new algorithm to compare binding sites in protein structures. BMC Bioinformatics, 9, 543.
Publication 2008
Citrate Hydrogen-6 Hypersensitivity Indinavir Ligands Methotrexate Proteins Staphylococcal Protein A Tetrameres Workers
4
Measuring Metabolic Flux Dynamics in Cell Cultures
Labeled DMEM medium was prepared from DMEM without glucose or glutamine (Sigma) by addition of 10 mM HEPES and the appropriate forms (labeled or unlabeled) of glucose and glutamine to a final concentration of 4.5 g l−1 glucose and 0.584 g l−1 glutamine (labeled glucose and labeled glutamine from Cambridge Isotope Laboratories), followed by sterile filtration. For kinetic flux profiling experiments, samples were switched to fresh unlabeled medium 1 h before the switch into 13C-labeled medium. This minimized metabolome perturbations at the time of the isotope switch resulting from removal of accumulated metabolic waste products. Metabolome quenching and extraction were conducted as previously described18 (link). Absolute metabolite quantitation involved extended labeling of cellular metabolites with uniformly labeled [13C]glucose and [13C]glutamine and extraction in the presence of known concentrations of unlabeled standards (for details, see refs. 23 (link),27 (link) and Supplementary Methods).
Uptake of glucose and glutamine and excretion of all measured metabolites (excretion of pyruvate, lactate, alanine and glutamate were found to be significant) was determined from medium samples taken over an 8-h time period, centered at 48 h after infection. Glucose was measured by enzyme assay (E00715251, R-Biopharm). The other compounds were measured by LC-MS/MS, with inclusion of isotopic internal standards for glutamine, glutamate, pyruvate, lactate and alanine.
Estimation of the relative carbon flux between glycolysis and the PPP was carried out using [1,2-13C]glucose as described38 (link), with 4 h of incubation in labeled medium and detection of labeled forms of lactate by LC-MS/MS. Estimation of the relative carbon flux between pyruvate dehydrogenase and pyruvate carboxylase was carried out based on the passage of labeled carbon from [3-13C]glucose into malate, aspartate and citrate over 6 h (for details, see Supplementary Methods).
Munger J., Bennett B.D., Parikh A., Feng X.J., McArdle J., Rabitz H.A., Shenk T, & Rabinowitz J.D. (2008). Systems-level metabolic flux profiling identifies fatty acid synthesis as a target for antiviral therapy. Nature biotechnology, 26(10), 1179-1186.
Publication 2008
Alanine Aspartate Carbon Carbon Cycle Cells Citrate Enzyme Assays Filtration Glucose Glutamates Glutamine Glycolysis HEPES Infection Isotopes Kinetics Lactates malate Metabolome Oxidoreductase Pyruvate Pyruvate Carboxylase Sterility, Reproductive Tandem Mass Spectrometry
5
Efficient Production and Delivery of dsRNA
For production of dsRNA to CeCENP-C (ggaaatgtacggagcgaaaa, acattgttggtgggtccaat) and CeINCENP (ggatgaaagagctcgagaagaa, ttctgacattctcacggacaac) the primers in parentheses with tails containing T3 and T7 promoters were used to amplify regions from genomic N2 DNA and the cDNA yk329a11, respectively. PCR reactions were cleaned (QIAGEN GmbH) and used as templates for 25 μl T3 and T7 transcription reactions (Ambion), which were combined and cleaned using an RNeasy kit (QIAGEN). RNA eluted with 50 μl of H2O was mixed with 25 μl of 3× injection buffer (IX = 20 mM KPO4, pH 7.5, 3 mM K-Citrate, pH 7.5, 2% PEG 6000) and annealed by incubating at 68°C for 10 min followed by 37°C for 30 min. DsRNA for CeCENP-A was made similarly, except cDNA yk325d10 digested with EcoRI (XhoI) was used to template the T7 (T3) reactions. For fixed assays, adult wild-type hermaphrodites injected with dsRNA were placed at 20°C for 24 h before fixation. For live fluorescence assays, young roller adults were injected and kept at 24.5°C for 22–30 h.
Oegema K., Desai A., Rybina S., Kirkham M, & Hyman A.A. (2001). Functional Analysis of Kinetochore Assembly in Caenorhabditis elegans. The Journal of Cell Biology, 153(6), 1209-1226.
Publication 2001
Adult Biological Assay Buffers Citrate Deoxyribonuclease EcoRI DNA, Complementary Fluorescence Genome Hermaphroditism Oligonucleotide Primers Polyethylene Glycol 6000 RNA, Double-Stranded Tail Transcription, Genetic Young Adult

Most recents protocols related to «Citrate»

1
VEGF-A Expression Saturation in Heart
Not available on PMC !

Example 11

VEGF-A Protein Expression after Modified RNA Injection to the Heart with Citrate Saline Buffer is Saturable and has Similar Pharmacokinetics Across Multiple Species

To compare VEGF-A protein production, 150 μg of VEGF-A modified RNA in a citrate saline buffer and 100 μg of VEGF-A modified RNA using RNAiMax (a lipid-based formulation) as the delivery carrier were injected into a rat heart. After 24 hours, VEGF-A protein levels in the rats with the citrate saline buffer (NTB) was at a comparable level to rats injected with RNAiMax and the pharmacokinetic profile were similar (FIG. 12A). The protein expression was dose limited and saturable, which was seen across species (FIG. 12B). With a ten-fold increase in dose, there was only a 1.6-fold increase in the area under the curve (FIG. 12C).

US11866475B2. Modified RNA encoding VEGF-A polypeptides, formulations, and uses relating thereto (2024-01-09). MODERNATX, INC [US]. Inventors: Leif Karlsson Parinder [SE], Regina Desirée Fritsche Danielson [SE], Kenny Mikael Hansson [SE], Li Ming Gan [SE], Jonathan Clarke [SE], Ann-Charlotte Eva Egnell [SE], Kenneth Randall Chien [SE].
Patent 2024
Buffers Citrate Drug Kinetics Heart Lipids Obstetric Delivery Polypeptides Proteins Rattus norvegicus Saline Solution Staphylococcal Protein A Transcription, Genetic vascular endothelial growth factor A, rat Vascular Endothelial Growth Factors Vision
2
Bromocriptine Salt Stability Comparison
Not available on PMC !

Example 3

Pharmaceutical preparations of bromocriptine mesylate and bromocriptine citrate are exposed to atmospheric conditions (40° C. and 70% relative humidity) and the degradation of the bromocriptine is assessed over time. The degradation of the bromocriptine from the citrate salt compound (bromocriptine citrate) is found to be substantially less than the degradation of the bromocriptine from the mesylate salt compound (bromocriptine mesylate) over a three-month period

While the invention has been described in combination with embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art in light of the foregoing description. Accordingly, it is intended to embrace all such alternatives, modifications and variations as fall within the spirit and broad scope of the appended claims.

US11878974B2. Composition and method for treating metabolic disorders (2024-01-23). VeroScience LLC [US]. Inventors: Anthony H. Cincotta [US].
Patent 2024
Bromocriptine Citrate Humidity Light Mesylate, Bromocriptine Mesylates Pharmaceutical Preparations Salts
3
In Vitro SGSH-Fc Fusion Protein Activity Assay
Not available on PMC !

Example 8

This example provides an alternative in vitro activity assay for SGSH-Fc fusion proteins. The assay is adapted from Karpova et al., J. Inherit. Metab. Dis., 19:278-285 (1996).

The standard reaction mixtures consisted of 10-15 μg of protein and 20 μL MU-α-GlcNS (5 or 10 mmol/L, respectively) in Michaelis' barbital sodium acetate buffer, pH 6.5 (29 mmol/L sodium barbital, 29 mmol/L sodium acetate, 0.68% (w/v) NaCl, 0.02% (w/v) sodium azide; adjusted to pH 6.5 with HCl) and the reaction mixtures were incubated for 17 h at 37° C. MU-α-GcNS is available from Moscerdam Substrates. After the first incubation, 6 μl twice-concentrated McIlvain's phosphate/citrate buffer, pH 6.7, containing 0.02% sodium azide and 10 μl (0.1 U) yeast a-glucosidase (Sigma) in water were added and a second incubation of 24 h at 37° C. was carried out. Long incubations at 37° C. (17-24 h) were carried out in 96-well plates which were sealed airtight with broad sticky tape, limiting evaporation to <15%. Next, 200 μL 0.5 mol/L Na2CO3/NaHCO3, pH 10.7, was added, and the fluorescence of the released 4-methylumbelliferone (MU) was measured on a Fluoroskan (Titertek) fluorimeter. Protein was determined as described previously (van Diggelen et al., Clin. Chim. Acta., 187:131-139 (1990)).

US11866742B2. Fusion proteins comprising enzyme replacement therapy enzymes (2024-01-09). Denali Therapeutics Inc. [US]. Inventors: Anastasia Henry [US], Mihalis S. Kariolis [US], Cathal S. Mahon [US], Adam P. Silverman [US], Ankita Srivastava [US], Julie Ullman [US].
Patent 2024
Barbital Bicarbonate, Sodium Biological Assay Buffers Citrate Fluorescence Glucosidase Hymecromone Phosphates Proteins Sodium Sodium Acetate Sodium Azide Sodium Chloride Yeast, Dried
4
Bromocriptine Citrate Synthesis
Not available on PMC !

Example 1

Citric acid was dissolved, in separate reaction vessels, in one of either methanol, ethanol, or butanol at about 4 mg per ml at room temperature (solutions 1-3). Free base bromocriptine was dissolved in separate reaction vessels in either methanol, ethanol, or butanol at about 12 mg per 5-30 ml (solutions 4-6). The like organic solutions of citric acid and of bromocriptine (i.e., ethanol-ethanol, methanol-methanol, butanol-butanol) were then mixed in an equi-mole amount of bromocriptine and citrate. The three resulting solutions were stirred for about 2-24 hours on low heat (about 40 C) until the solvent evaporated to dryness. The resulting solid product in each reaction vessel contains bromocriptine citrate.

US11878974B2. Composition and method for treating metabolic disorders (2024-01-23). VeroScience LLC [US]. Inventors: Anthony H. Cincotta [US].
Patent 2024
Blood Vessel Bromocriptine Butyl Alcohol Citrate Citric Acid Ethanol Metabolic Diseases Methanol Moles Solvents
5
Bromocriptine Dissolution Comparison
Not available on PMC !

Example 2

Solid samples of equal amounts of bromocriptine mesylate and bromocriptine citrate added, under various pH conditions, to equal volumes of water or water/organic solutions in different vessels and the dissolution of the bromocriptine samples (aqueous solubility) was assessed over time. Bromocriptine citrate was found to dissolve much more quickly and with significantly greater solubility (increased mg of bromocriptine dissolved per ml of water in the citrate vs mesylate salt form) compared to bromocriptine mesylate.

US11878974B2. Composition and method for treating metabolic disorders (2024-01-23). VeroScience LLC [US]. Inventors: Anthony H. Cincotta [US].
Patent 2024
Blood Vessel Bromocriptine Citrate Mesylate, Bromocriptine Mesylates Sodium Chloride

Top products related to «Citrate»

1
H 7650 by Hitachi
Sourced in Japan, United States, Germany, United Kingdom, China, France
The Hitachi H-7650 is a transmission electron microscope (TEM) designed for high-resolution imaging of materials. It provides a core function of nanoscale imaging and analysis of a wide range of samples.
2
Ht7700 by Hitachi
Sourced in Japan, United States, Germany, China, United Kingdom
The HT7700 is a high-resolution transmission electron microscope (TEM) designed for materials analysis and characterization. It provides advanced imaging and analytical capabilities for a wide range of applications in materials science, nanotechnology, and life sciences. The core function of the HT7700 is to enable high-resolution, high-contrast imaging and elemental analysis of nanoscale structures and materials.
3
Jem 1400 by JEOL
Sourced in Japan, United States, Germany, United Kingdom, France, Spain
The JEM-1400 is a transmission electron microscope (TEM) produced by JEOL. It is designed to provide high-quality imaging and analysis of a wide range of materials at the nanoscale level. The JEM-1400 offers a maximum accelerating voltage of 120 kV and features advanced optics and detectors to enable detailed examination of samples.
4
Embed 812 by Electron Microscopy Sciences
Sourced in United States, Panama, Australia, Germany
Embed 812 is a high-quality embedding medium used in electron microscopy sample preparation. It is a cross-linking epoxy resin that provides excellent support and preservation of ultrastructural details in biological and material science specimens.
5
Glutaraldehyde by Merck Group
Sourced in United States, Germany, United Kingdom, Italy, Switzerland, India, China, Sao Tome and Principe, France, Canada, Japan, Spain, Belgium, Poland, Ireland, Israel, Singapore, Macao, Brazil, Sweden, Czechia, Australia
Glutaraldehyde is a chemical compound used as a fixative and disinfectant in various laboratory applications. It serves as a cross-linking agent, primarily used to preserve biological samples for analysis.
6
Jem 1230 by JEOL
Sourced in Japan, United States, Germany, United Kingdom, France
The JEM-1230 is a transmission electron microscope (TEM) manufactured by JEOL. It is designed to provide high-quality imaging and analysis of a wide range of materials. The JEM-1230 operates at an accelerating voltage of 120 kV and offers a resolution of 0.2 nanometers.
7
Ultramicrotome by Leica
Sourced in Germany, United States, Austria, Japan, Switzerland, United Kingdom, Canada
The Ultramicrotome is a precision instrument designed for the preparation of ultrathin sections of materials for transmission electron microscopy (TEM) analysis. It employs a diamond knife to slice samples into extremely thin sections, typically less than 100 nanometers thick, enabling the detailed examination of the internal structure and composition of a wide range of materials.
8
Em uc7 by Leica
Sourced in Germany, Austria, United States, Japan, Switzerland, China, France
The Leica EM UC7 is an ultramicrotome designed for cutting ultrathin sections of samples for transmission electron microscopy (TEM) analysis. It features a precision-engineered cutting mechanism that allows for the preparation of high-quality ultrathin sections with thicknesses ranging from 15 to 500 nanometers.
9
H 7500 by Hitachi
Sourced in Japan, United States, Germany, France
The H-7500 is a transmission electron microscope (TEM) manufactured by Hitachi. It is designed for high-resolution imaging and analysis of materials at the nanoscale level. The core function of the H-7500 is to provide researchers and scientists with a powerful tool for studying the structure, composition, and properties of a wide range of samples, including biological, materials, and semiconductor specimens.
10
Jem 1400plus by JEOL
Sourced in Japan, United States, Germany, United Kingdom, India
The JEM-1400Plus is a transmission electron microscope (TEM) manufactured by JEOL. It is designed for high-resolution imaging and analysis of a wide range of samples. The JEM-1400Plus provides stable and reliable performance for various applications in materials science, biological research, and other related fields.

More about "Citrate"

Citrate, a crucial metabolic intermediate, is at the heart of the citric acid cycle, a central pathway for energy production in cells.
This tricarboxylic acid plays a vital role in cellular respiration, serving as a precursor for various biomolecules.
Citrate's diverse functions include buffering cellular pH, regulating enzyme activity, and contributing to bone mineralization.
Understanding the dynamics and regulation of citrate metabolism is essential for researchers studying topics such as energy metabolism, mitochondrial function, and metabolic disorders.
Optimize your citrate research with the power of PubCompare.ai, an AI-driven platform that helps locate the best protocols from scientific literature, pre-prints, and patents.
With robust comparisons, you can enhance reproducibility and accuaracy in your citrate studies.
Experience seamless research with PubCompare.ai - the ultimate tool for citrate optimization.
Explore related topics like the use of techniques such as transmission electron microscopy (TEM) using instruments like the H-7650, HT7700, JEM-1400, and JEM-1400Plus to visualize and analyze cellular structures and organelles involved in citrate metabolism.
Embedding protocols using materials like Embed 812 and fixation methods like glutaraldehyde can also provide valuable insights.
Ultramicrotomy techniques using the EM UC7 ultramicrotome can enable high-resolution sectioning for TEM analysis of citrate-related cellular processes.
Harness the power of these advanced tools and techniques to optimize your citrate research and unlock new discoveries.