The largest database of trusted experimental protocols

Edetic Acid

Edetic Acid, also known as ethylenediaminetetraacetic acid (EDTA), is a chelating agent widely used in a variety of applications.
It is a white, crystalline compound that forms stable complexes with metal ions, making it useful for water softening, metal ion removal, and analytical chemistry.
EDTA is commonly used in medical and pharmaceutical settings for the treatment of heavy metal poisoning, as well as in the preparation of certain drugs and cosmetics.
Additionally, it plays a role in laboratory procedures, such as DNA extraction and protein purification.
Researchers in the field of edetic acid can leverage the PubCompare.ai tool to optimize their research protocols, enhancing reproducibility and accuracy through AI-driven protocol comparison and evaluation.
Explore the power of this cutting-edge technology to advance your edetic acid research today.

Most cited protocols related to «Edetic Acid»

Nuclear RNA was prepared from HEK293T (kidney) cells. Briefly, cells were lysed on ice for 5 min in 10 mM Tris-HCl pH 7.5, 10 mM NaCl, 0.2 mM EDTA, 0.05% NP-40, and nuclei were spun at 2,500g for 3 min and then resuspended in QIAzol for RNA isolation using the miRNeasy kit according to the manufacturer’s instructions (Qiagen). The RNA-seq library was created using the Illumina TruSeq RNA Sample Preparation Kit v2 with the standard protocol, and sequenced on one lane of the HiSeq 2000 platform (100 bp, paired-end). Data are available at NCBI as accession number SRP041943. The database of annotated protein coding and noncoding genes (41,409 genes and 171,904 transcripts in total) was produced by merging all annotated genes from the RefSeq database29 (link), the UCSC Browser24 (link) and the Ensembl database30 (link).
Publication 2015
Cell Nucleus Cells DNA Library Edetic Acid Genes isolation Kidney Nonidet P-40 RNA, Nuclear RNA-Seq Sodium Chloride Standard Preparations Tromethamine
The streptavidin alkaline phosphatase method was adapted to detect the viral antigen using a polyclonal anti-ZIKV antibody produced at the Evandro Chagas Institute2 (link). The biotin-streptavidin peroxidase method was used for immunostaining of tissues with antibodies specific for each marker studied. First, the tissue samples were deparaffinized in xylene and hydrated in a decreasing ethanol series (90%, 80%, and 70%). Endogenous peroxidase was blocked by incubating the sections in 3% hydrogen peroxide for 45 min. Antigen retrieval was performed by incubation in citrate buffer, pH 6.0, or EDTA, pH 9.0, for 20 min at 90 °C. Nonspecific proteins were blocked by incubating the sections in 10% skim milk for 30 min. The histological sections were then incubated overnight with the primary antibodies diluted in 1% bovine serum albumin (Supplementary Table S1). After this period, the slides were immersed in 1 × PBS and incubated with the secondary biotinylated antibody (LSAB, DakoCytomation) in an oven for 30 min at 37 °C. The slides were again immersed in 1X PBS and incubated with streptavidin peroxidase (LSAB, DakoCytomation) for 30 min at 37 °C. The reactions were developed with 0.03% diaminobenzidine and 3% hydrogen peroxide as the chromogen solution. After this step, the slides were washed in distilled water and counterstained with Harris hematoxylin for 1 min. Finally, the sections were dehydrated in an increasing ethanol series and cleared in xylene.
Publication 2018
Alkaline Phosphatase Antibodies Antibodies, Anti-Idiotypic Antigens Antigens, Viral azo rubin S Biotin Buffers Citrates Edetic Acid Ethanol Hematoxylin Immunoglobulins Milk, Cow's Peroxidase Peroxide, Hydrogen Peroxides Proteins Serum Albumin, Bovine Streptavidin Tissues Tritium Xylene Zika Virus
Cells were solubilized with lysis buffer [50 mM Tris-HCl (pH7.5), 150 mM NaCl, 5 mM EDTA, 0.5% (v/v) NP-40, 50 mM NaF, 1 mM Na3VO4, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 0.25 mM pAPMSF] and centrifuged at 12,000 × g for 20 min. For co-immunoprecipitation assay, cells were sonicated briefly in lysis buffer before centrifugation. The lysates were subjected to immunoprecipitation, SDS-PAGE, and Western blot analyses as described2 (link).
Publication 2017
Aprotinin Biological Assay Buffers Cells Centrifugation Co-Immunoprecipitation Edetic Acid Immunoprecipitation leupeptin Nonidet P-40 SDS-PAGE Sodium Chloride Tromethamine Western Blot
Genomic DNA was extracted directly from blood samples by standard procedures, and stored long-term in TE−4 (10 mM Tris–HCl, 0.1 mM EDTA, pH 7.5) at 4°C at a concentration of ∼100 ng/µl. DNA stocks were diluted into pure water just prior to setting up QPCR runs. The samples, from 95 Utah individuals (47 females and 48 males, age range 5–94 years), are those analyzed in our previous paper describing telomere length measurement by singleplex QPCR (1 (link)).
Publication 2009
BLOOD Edetic Acid Females Genome Males Telomere Tromethamine
An Escherichia coli K12 strain was grown in standard LB medium, harvested, washed in PBS, and lysed in BugBuster (Novagen Merck Chemicals, Schwalbach, Germany) according to the manufacturer's protocol. HeLa S3 cells were grown in standard RPMI 1640 medium supplemented with glutamine, antibiotics, and 10% FBS. After being washed with PBS, cells were lysed in cold modified RIPA buffer (50 mm Tris-HCl, pH 7.5, 1 mm EDTA, 150 mm NaCl, 1% N-octylglycoside, 0.1% sodium deoxycholate, complete protease inhibitor mixture (Roche)) and incubated for 15 min on ice. Lysates were cleared by centrifugation, and after precipitation with chloroform/methanol, proteins were resuspended in 6 m urea, 2 m thiourea, 10 mm HEPES, pH 8.0. Prior to in-solution digestion, 60-μg protein samples from HeLa S3 lysates were spiked with either 10 μg or 30 μg of E. coli K12 lysates based on protein amount (Bradford assay). Both batches were reduced with dithiothreitol and alkylated with iodoacetamide. Proteins were digested with LysC (Wako Chemicals, GmbH, Neuss, Germany) for 4 h and then trypsin digested overnight (Promega, GmbH, Mannheim, Germany). Digestion was stopped by the addition of 2% trifluroacetic acid. Peptides were separated by isoelectric focusing into 24 fractions on a 3100 OFFGEL Fractionator (Agilent, GmbH, Böblingen, Germany) as described in Ref. 45 (link). Each fraction was purified with C18 StageTips (46 (link)) and analyzed via liquid chromatography combined with electrospray tandem mass spectrometry on an LTQ Orbitrap (Thermo Fisher) with lock mass calibration (47 (link)). All raw files were searched against the human and E. coli complete proteome sequences obtained from UniProt (version from January 2013) and a set of commonly observed contaminants. MS/MS spectra were filtered to contain at most eight peaks per 100 mass unit intervals. The initial MS mass tolerance was 20 ppm, and MS/MS fragment ions could deviate by up to 0.5 Da (48 (link)). For quantification, intensities can be determined alternatively as the full peak volume or as the intensity maximum over the retention time profile, and the latter method was used here as the default. Intensities of different isotopic peaks in an isotope pattern are always summed up for further analysis. MaxQuant offers a choice of the degree of uniqueness required in order for peptides to be included for quantification: “all peptides,” “only unique peptides,” and “unique plus razor peptides” (42 (link)). Here we chose the latter, because it is a good compromise between the two competing interests of using only peptides that undoubtedly belong to a protein and using as many peptide signals as possible. The distribution of peptide ions over fractions and samples is shown in supplemental Fig. S1.
Publication 2014
Acids Antibiotics, Antitubercular Biological Assay Buffers Cells Centrifugation Chloroform Cold Temperature Deoxycholic Acid, Monosodium Salt Digestion Dithiothreitol Edetic Acid Escherichia coli Escherichia coli K12 Glutamine HeLa Cells HEPES Homo sapiens Immune Tolerance Iodoacetamide Ions Isotopes Liquid Chromatography Methanol Peptides Promega Protease Inhibitors Proteins Proteome Radioimmunoprecipitation Assay Retention (Psychology) Sodium Chloride Staphylococcal Protein A Tandem Mass Spectrometry Thiourea Tromethamine Trypsin Urea

Most recents protocols related to «Edetic Acid»

Example 6

Compound 3 was generated from the purification process of IL-2 mutein Ala-M1 polymer prodrug 5. During separation of compound 5 on a Capto MMC ImpRes resin the later eluting peak which contains 3 was collected. The collected fraction was diluted with 10 mM succinic acid, pH 5.0 to lower the conductivity to approx. 14 mS/cm and further purified on a Äkta system equipped with a HiScreen Capto Blue column using buffer A (20 mM sodium phosphate, pH 7.5), buffer B (20 mM sodium phosphate, 1 M NaCl, pH 7.5) and a gradient from 0 to 50% buffer B in 6 column volumes. The main peak was collected and concentrated using Amicon Ultra centrifugal device (3 kDa MWCO). The concentrated solution was buffer exchanged to 10 mM Hepes, 150 mM NaCl, 3 mM EDTA, 0.05% polysorbate 20, pH 7.4 by using an Äkta system and a HiPrep 26/10 column and the concentration was adjusted to 0.25 mg/mL to give compound 3.

Patent 2024
Buffers Edetic Acid Electric Conductivity HEPES interleukin-2, polyethylene glycol-modified Medical Devices mutein 2 mutein 5 Polymers Polysorbate 20 Prodrugs Resins, Plant Sodium Chloride sodium phosphate Succinic Acid

Example 1

a. Materials and Methods

i. Vector Construction

1. Virus-Like Particle

As most broadly neutralizing HPV antibodies are derived from the highly conserved N-terminal region of L2, amino acids 14-122 of HPV16 L2 were used to create HBc VLPs. L2 with flanking linker regions was inserted into the tip of the a-helical spike of an HBc gene copy which was fused to another copy of HBc lacking the L2 insert. This arrangement allows the formation of HBc dimers that contain only a single copy of L2, increasing VLP stability (Peyret et al. 2015). This heterodimer is referred to as HBche-L2. A dicot plant-optimized HPV16 L2 coding sequence was designed based upon the sequence of GenBank Accession No. CAC51368.1 and synthesized in vitro using synthetic oligonucleotides by the method described (Stemmer et al., 1995). The plant-optimized L2 nucleotide sequence encoding residues 1-473 is posted at GenBank Accession No. KC330735. PCR end-tailoring was used to insert Xbal and SpeI sites flanking the L2 aa 14-122 using primers L2-14-Xba-F (SEQ ID NO. 1: CGTCTAGAGTCCGCAACCCAACTTTACAAG) and L2-122-Spe-R (SEQ ID NO. 2: G GGACTAGTTGGGGCACCAGCATC). The SpeI site was fused to a sequence encoding a 6His tag, and the resulting fusion was cloned into a geminiviral replicon vector (Diamos, 2016) to produce pBYe3R2K2Mc-L2(14-122)6H.

The HBche heterodimer VLP system was adapted from Peyret et al (2015). Using the plant optimized HBc gene (Huang et al., 2009), inventors constructed a DNA sequence encoding a dimer comprising HBc aa 1-149, a linker (G2S)5G (SEQ ID NO. 39), HBc aa 1-77, a linker GT(G4S)2 (SEQ ID NO. 40), HPV-16 L2 aa 14-122, a linker (GGS)2GSSGGSGG (SEQ ID NO. 41), and HBc aa 78-176. The dimer sequence was generated using multiple PCR steps including overlap extensions and insertion of BamHI and SpeI restriction sites flanking the L2 aa 14-122, using primers L2-14-Bam-F (SEQ ID NO. 3: CAGGATCCGCAACC CAACTTTACAAGAC) and L2-122-Spe-R (SEQ ID NO. 2). The HBche-L2 coding sequence was inserted into a geminiviral replicon binary vector pBYR2eK2M (FIG. 3), which includes the following elements: CaMV 35S promoter with duplicated enhancer (Huang et al., 2009), 5′ UTR of N. benthamiana psaK2 gene (Diamos et al., 2016), intron-containing 3′ UTR and terminator of tobacco extensin (Rosenthal et al, 2018), CaMV 35S 3′ terminator (Rosenthal et al, 2018), and Rb7 matrix attachment region (Diamos et al., 2016).

2. Recombinant Immune Complex

The recombinant immune complex (RIC) vector was adapted from Kim et al., (2015). The HPV-16 L2 (aa 14-122) segment was inserted into the BamHI and SpeI sites of the gene encoding humanized mAb 6D8 heavy chain, resulting in 6D8 epitope-tagged L2. The heavy chain fusion was inserted into an expression cassette linked to a 6D8 kappa chain expression cassette, all inserted into a geminiviral replicon binary vector (FIG. 3, RIC vector). Both cassettes contain CaMV 35S promoter with duplicated enhancer (Huang et al., 2009), 5′ UTR of N. benthamiana psaK2 gene (Diamos et al., 2016), intron-containing 3′ UTR and terminator of tobacco extensin (Rosenthal et al, 2018), and Rb7 matrix attachment region (Diamos et al., 2016).

ii. Agroinfiltration of Nicotiana benthamiana Leaves

Binary vectors were separately introduced into Agrobacterium tumefaciens EHA105 by electroporation. The resulting strains were verified by restriction digestion or PCR, grown overnight at 30° C., and used to infiltrate leaves of 5- to 6-week-old N. benthamiana maintained at 23-25° C. Briefly, the bacteria were pelleted by centrifugation for 5 minutes at 5,000 g and then resuspended in infiltration buffer (10 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.5 and 10 mM MgSO4) to OD600=0.2, unless otherwise described. The resulting bacterial suspensions were injected by using a syringe without needle into leaves through a small puncture (Huang et al. 2004). Plant tissue was harvested after 5 DPI, or as stated for each experiment. Leaves producing GFP were photographed under UV illumination generated by a B-100AP lamp (UVP, Upland, CA).

iii. Protein Extraction

Total protein extract was obtained by homogenizing agroinfiltrated leaf samples with 1:5 (w:v) ice cold extraction buffer (25 mM sodium phosphate, pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 10 mg/mL sodium ascorbate, 0.3 mg/mL PMSF) using a Bullet Blender machine (Next Advance, Averill Park, NY) following the manufacturer's instruction. To enhance solubility, homogenized tissue was rotated at room temperature or 4° C. for 30 minutes. The crude plant extract was clarified by centrifugation at 13,000 g for 10 minutes at 4° C. Necrotic leaf tissue has reduced water weight, which can lead to inaccurate measurements based on leaf mass. Therefore, extracts were normalized based on total protein content by Bradford protein assay kit (Bio-Rad) with bovine serum albumin as standard.

iv. SDS-PAGE and Western Blot

Clarified plant protein extract was mixed with sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.02% bromophenol blue) and separated on 4-15% polyacrylamide gels (Bio-Rad). For reducing conditions, 0.5M DTT was added, and the samples were boiled for 10 minutes prior to loading. Polyacrylamide gels were either transferred to a PVDF membrane or stained with Coomassie stain (Bio-Rad) following the manufacturer's instructions. For L2 detection, the protein transferred membranes were blocked with 5% dry milk in PBST (PBS with 0.05% tween-20) overnight at 4° C. and probed with polyclonal rabbit anti-L2 diluted 1:5000 in 1% PBSTM, followed by goat anti-rabbit horseradish peroxidase conjugate (Sigma). Bound antibody was detected with ECL reagent (Amersham).

v. Immunization of Mice and Sample Collection

All animals were handled in accordance to the Animal Welfare Act and Arizona State University IACUC. Female BALB/C mice, 6-8 weeks old, were immunized subcutaneously with purified plant-expressed L2 (14-122), HBche-L2 VLP, L2 RIC, or PBS mixed 1:1 with Imject® Alum (Thermo Scientific, Rockford, IL). In all treatment groups, the total weight of antigen was set to deliver an equivalent 5 μg of L2. Doses were given on days 0, 21, and 42. Serum collection was done as described (Santi et al. 2008) by submandibular bleed on days 0, 21, 42, and 63.

vi. Antibody Measurements

Mouse antibody titers were measured by ELISA. Bacterially-expressed L2 (amino acids 11-128) was bound to 96-well high-binding polystyrene plates (Corning), and the plates were blocked with 5% nonfat dry milk in PBST. After washing the wells with PBST (PBS with 0.05% Tween 20), the diluted mouse sera were added and incubated. Mouse antibodies were detected by incubation with polyclonal goat anti-mouse IgG-horseradish peroxidase conjugate (Sigma). The plate was developed with TMB substrate (Pierce) and the absorbance was read at 450 nm. Endpoint titers were taken as the reciprocal of the lowest dilution which produced an OD450 reading twice the background. IgG1 and IgG2a antibodies were measured with goat-anti mouse IgG1 or IgG2a horseradish peroxidase conjugate.

vii. Electron Microscopy

Purified samples of HBche or HBche-L2 were initially incubated on 75/300 mesh grids coated with formvar. Following incubation, samples were briefly washed twice with deionized water then negatively stained with 2% aqueous uranyl acetate. Transmission electron microscopy was performed with a Phillips CM-12 microscope, and images were acquired with a Gatan model 791 CCD camera.

viii. Statistical Analysis

The significance of vaccine treatments and virus neutralization was measured by non-parametric Mann-Whitney test using GraphPad prism software. Two stars (**) indicates p values <0.05. Three stars (***) indicates p values <0.001.

b. Design and Expression of HBc VLPs and RIC Displaying HPV16 L2

BeYDV plant expression vectors (FIG. 3) expressing either the target VLP HBche-L2, or L2 and HBche alone as controls, were agroinfiltrated into the leaves of N. benthamiana and analyzed for VLP production. After 4-5 days post infiltration (DPI), leaves displayed only minor signs of tissue necrosis, indicating that the VLP was well-tolerated by the plants (FIG. 4A). Leaf extracts analyzed by reducing SDS-PAGE showed an abundant band near the predicted size of 51 kDa for HBche-L2, just above the large subunit of rubisco (RbcL). HBche was detected around the predicted size of 38 kDa (FIG. 4B). Western blot probed with anti-L2 polyclonal serum detected a band for HBche-L2 at ˜51 kDa (FIG. 4B). These results indicate that this plant system is capable of producing high levels of L2-containing HBc VLP.

To express L2-containing MC, amino acids 14-122 of HPV16 L2 were fused with linker to the C-terminus of the 6D8 antibody heavy chain and tagged with the 6D8 epitope (Kim et al. 2015). A BeYDV vector (FIG. 3) expressing both the L2-fused 6D8 heavy chain and the light chain was agroinfiltrated into leaves of N. benthamiana and analyzed for RIC production. To create more homogenous human-type glycosylation, which has been shown to improve antibody Fc receptor binding in vivo, transgenic plants silenced for xylosyltransferase and fucosyltransferase were employed (Castilho and Steinkellner 2012). By western blot, high molecular weight bands >150 kDa suggestive of RIC formation were observed (FIG. 4C). Expression of soluble L2 RIC was lower than HBche-L2 due to relatively poor solubility of the RIC (FIG. 4C).

After rigorous genetic optimization, the N. benthamiana system is capable of producing very high levels of recombinant protein, up to 30-50% of the total soluble plant protein, in 4-5 days (Diamos et al. 2016). Using this system, we produced and purified milligram quantities of fully assembled and potently immunogenic HBc VLPs displaying HPV L2 through a simple one-step purification process (FIGS. 4A-4C and 6).

c. Purification and Characterization of HBche-L2 and L2 RIC

To assess the assembly of HBc-L2 VLP, clarified plant extracts containing either HBche-L2 or HBche were analyzed by sucrose gradient sedimentation. HBche-L2 sedimented largely with HBche, which is known to form VLP, though a small increase in density was observed with HBche-L2, perhaps due to the incorporation of L2 into the virus particle (FIG. 5A). To demonstrate particle formation, sucrose fractions were examined by electron microscopy. Both HBche and HBche-L2 formed ˜30 nm particles, although the appearance of HBche-L2 VLP suggested slightly larger, fuller particles (FIGS. 5C and 5D). As most plant proteins do not sediment with VLP, pooling peak sucrose fractions resulted in >95% pure HBche-L2 (FIG. 5B), yielding sufficient antigen (>3 mg) for vaccination from a single plant leaf.

L2 RIC was purified from plant tissue by protein G affinity chromatography. By SDS-PAGE, an appropriately sized band was visible >150 kDa that was highly pure (FIG. 5B). Western blot confirmed the presence of L2 in this band, indicating proper RIC formation (FIG. 5B). L2 RIC bound to human complement C1q receptor with substantially higher affinity compared to free human IgG standard, suggesting proper immune complex formation (FIG. 5E).

d. Mouse Immunization with HBche-L2 and L2 RIC

Groups of Balb/c mice (n=8) were immunized, using alum as adjuvant, with three doses each of 5 μg L2 delivered as either L2 alone, HBche-L2 VLP, L2 RIC, or a combination of half VLP and half RIC. VLP and RIC, alone or combined, greatly enhanced antibody titers compared to L2 alone by more than an order of magnitude at all time points tested (FIG. 6). After one or two doses, the combined VLP/RIC treatment group outperformed both the VLP or RIC groups, reaching mean endpoint titers of >200,000, which represent a 700-fold increase over immunization with L2 alone (FIG. 6). After the third dose, both the VLP and combined VLP/RIC groups reached endpoint titers >1,300,000, a 2-fold increase over the RIC alone group. To determine the antibody subtypes produced by each treatment group, sera were assayed for L2-binding IgG1 and IgG2a. All four groups produced predominately IgG1 (FIG. 7, note dilutions). However, RIC and especially VLP-containing groups had an elevated ratio of IgG2a:IgG1 (>3-fold) compared to L2 alone (FIG. 7).

In vitro neutralization of HPV16 pseudovirions showed that the VLP and RIC groups greatly enhanced neutralization compared to L2 alone (FIG. 5, p<0.001). Additionally, VLP and RIC combined further enhanced neutralization activity ($5-fold, p<0.05) compared to either antigen alone, supporting the strong synergistic effect of delivering L2 by both platforms simultaneously.

In this study, by displaying amino acids 11-128 on the surface of plant-produced HBc VLPs, L2 antibody titers as high as those seen with L1 vaccines were generated (FIG. 6). Mice immunized with L2 alone had highly variable antibody titers, with titers spanning two orders of magnitude. By contrast, the other groups had much more homogenous antibody responses, especially the VLP-containing groups, which had no animals below an endpoint titer of 1:1,000,000 (FIG. 6). These results underscore the potential of HBc VLP and RIC to provide consistently potent immune responses against L2. Moreover, significant synergy of VLP and RIC systems was observed when the systems were delivered together, after one or two doses (FIG. 6). Since equivalent amounts of L2 were delivered with each dose, the enhanced antibody titer did not result from higher L2 doses. Rather, these data suggest that higher L2-specific antibody production may be due to augmented stimulation of L2-specific B cells by T-helper cells that were primed by RIC-induced antigen presenting cells. Although treatment with VLP and RIC alone reached similar endpoint titers as the combined VLP/RIC group after 3 doses, virus neutralization was substantially higher (>5-fold) in the combined group (FIG. 8). Together, these data indicate unique synergy exists when VLP and RIC are delivered together. Inventors have observed similarly significant synergistic enhancement of immunogenicity for a variety of other antigens.

Mice immunized with L2 alone had highly variable antibody titers, with titers spanning two orders of magnitude. By contrast, the VLP and VLP/RIC groups had much more homogenous antibody responses, with no animals below an endpoint titer of 1:1,000,000 (FIG. 6). These results underscore the potential of HBc VLP and RIC to provide consistently potent immune responses against L2.

Fc gamma receptors are present on immune cells and strongly impact antibody effector functions such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity (Jefferis 2009). In mice, these interactions are controlled in part by IgG subtypes. IgG1 is associated with a Th2 response and has limited effector functions. By contrast, IgG2a is associated with a Th1 response and more strongly binds complement components (Neuberger and Raj ewsky 1981) and Fc receptors (Radaev 2002), enhancing effector functions and opsonophagocytosis by macrophages (Takai et al. 1994). Immunization with L2 alone was found to produce low levels of IgG2a, however immunization with RIC and VLP produced significant increases in IgG2a titers. VLP-containing groups in particular showed a 3-fold increase in the ratio of IgG2a to IgG1 antibodies (FIG. 7). Importantly, production of IgG2a is associated with successful clearance of a plethora of viral pathogens (Coutelier et al. 1988; Gerhard et al. 1997; Wilson et al. 2000; Markine-Goriaynoff and Coutelier 2002).

The glycosylation state of the Fc receptor also plays an important role in antibody function. Advances in glycoengineering have led to the development of transgenic plants with silenced fucosyl- and xylosyl-transferase genes capable of producing recombinant proteins with authentic human N-glycosylation (Strasser et al. 2008). Antibodies produced in this manner have more homogenous glycoforms, resulting in improved interaction with Fc gamma and complement receptors compared to the otherwise identical antibodies produced in mammalian cell culture systems (Zeitlin et al. 2011; Hiatt et al. 2014; Strasser et al. 2014; Marusic et al. 2017). As the known mechanisms by which RIC vaccines increase immunogenicity of an antigen depend in part on Fc and complement receptor binding, HPV L2 RIC were produced in transgenic plants with silenced fucosyl- and xylosyl-transferase. Consistent with these data, we found that L2 RIC strongly enhanced the immunogenicity of L2 (FIG. 6). However, yield suffered from insolubility of the RIC (FIG. 4C). We found that the 11-128 segment of L2 expresses very poorly on its own in plants and may be a contributing factor to poor L2 RIC yield. Importantly, we have produced very high yields of RIC with different antigen fusions. Thus, in some aspects, antibody fusion with a shorter segment of L2 could substantially improve the yield of L2 RIC.

e. Neutralization of HPV Pseudovirions

Neutralization of papilloma pseudoviruses (HPV 16, 18, and 58) with sera from mice immunized IP with HBc-L2 VLP and L2(11-128) showed neutralization of HPV 16 at titers of 400-1600 and 200-800, respectively (Table 1). More mice IP-immunized with HBc-L2 VLP had antisera that cross-neutralized HPV 18 and HPV 58 pseudoviruses, compared with mice immunized with L2(11-128). Anti-HBc-L2 VLP sera neutralized HPV 18 at titers of 400 and HPV 58 at titers ranging from 400-800 (Table 1), while anti-L2(11-128) sera neutralized HPV 18 at a titer of 200 and HPV 58 at a titer of 400 (Table 1). None of the sera from intranasal-immunized mice demonstrated neutralizing activity, consistent with lower anti-L2 titers for intranasal than for intraperitoneal immunized mice.

TABLE 1
L2-specific serum IgG and pseudovirus neutralization
titers from IP immunized mice
Neutralization of Pseudoviruses
ImmunogenSerum IgGHPV 16HPV 18HPV 58
HBc-L2>50,000 400
~70,0001600400400
>80,0001600400800
L2 (11-128)~8000 200
~12,000 400
~50,000 800200400

Patent 2024
3' Untranslated Regions 5' Untranslated Regions AA 149 Agrobacterium tumefaciens aluminum potassium sulfate aluminum sulfate Amino Acids Animals Animals, Transgenic Antibodies Antibody Formation Antigen-Presenting Cells Antigens B-Lymphocytes Bacteria Bromphenol Blue Buffers Cell Culture Techniques Cells Centrifugation Chromatography, Affinity Cloning Vectors Cold Temperature Combined Modality Therapy complement 1q receptor Complement Receptor Complex, Immune Complex Extracts Cytotoxicities, Antibody-Dependent Cell Cytotoxin Digestion DNA, A-Form DNA Sequence Edetic Acid Electron Microscopy Electroporation Enzyme-Linked Immunosorbent Assay Epitopes ethane sulfonate Fc Receptor Females Formvar Fucosyltransferase G-substrate Gamma Rays Genes Genes, vif Glycerin Goat Helix (Snails) Helper-Inducer T-Lymphocyte Homo sapiens Homozygote Horseradish Peroxidase Human papillomavirus 16 Human papillomavirus 18 Human Papilloma Virus Vaccine IGG-horseradish peroxidase IgG1 IgG2A Immune Sera Immunoglobulin Heavy Chains Immunoglobulins Immunologic Factors Institutional Animal Care and Use Committees Introns Inventors L2 protein, Human papillomavirus type 16 Light Macrophage Mammals Matrix Attachment Regions Mice, Inbred BALB C Microscopy Milk, Cow's Morpholinos Mus Necrosis Needles Nicotiana Oligonucleotide Primers Oligonucleotides Open Reading Frames Opsonophagocytosis Papilloma Pathogenicity Plant Development Plant Extracts Plant Leaves Plant Proteins Plants Plants, Transgenic polyacrylamide gels Polystyrenes polyvinylidene fluoride prisma Protein Glycosylation Proteins Punctures Rabbits Receptors, IgG Recombinant Proteins Replicon Reproduction Response, Immune Ribulose-Bisphosphate Carboxylase Large Subunit Satellite Viruses SDS-PAGE Serum Serum Albumin, Bovine Sodium Ascorbate Sodium Chloride sodium phosphate Specimen Collection Stars, Celestial Strains Sucrose Sulfate, Magnesium Syringes System, Immune Technique, Dilution Tissue, Membrane Tissues Transferase Transmission Electron Microscopy Triton X-100 Tromethamine Tween 20 Ultraviolet Rays uranyl acetate Vaccination Vaccines Vaccines, Recombinant Virion Viroids Virus Vision Western Blotting xylosyltransferase

Example 5

TABLE 5
IngredientsQty/vial
Melphalan50mg
Povidone5mg
EDTA5mg
PEG5ml
Water0.2ml
Ethanol4.8ml
0.1N HClQS

EDTA was dissolved in water and added to a manufacturing vessel containing a mixture of PEG and ethanol. Melphalan and povidone were added to the above solution mixture. pH was adjusted to 3.5-5.5 using 0.1N HCl. Volume was made up using mixture of PEG and ethanol. The obtained solution was filtered and filled in vials followed by capping and sealing. The formulation was tested for stability at 25° C./60% RH for a period of 22 days. Stability data is summarized in Table 5A.

TABLE 5A
Stability at Day 22Day 22
Purity92.04
Maximum Individual Impurity1.76
Total Impurities7.96

Patent 2024
Blood Vessel Edetic Acid Ethanol Melphalan Povidone

Example 4

TABLE 4
IngredientsQty/vial
Melphalan50mg
EDTA5mg
PEG2ml
Water0.4ml
Ethanol7.6ml
0.1N HClQS

EDTA was dissolved in water and added to a manufacturing vessel containing a mixture of PEG and ethanol to obtain a clear solution. Melphalan was added to the above solution mixture. pH was adjusted to 3.5-5.5 using 0.1N HCl. Volume was made up using mixture of PEG and ethanol. The obtained solution was filtered and filled in vials followed by capping and sealing. The formulation was tested for stability at 2-8° C. for a period of 5 months. Stability data is summarized in Table 4A.

TABLE 4A
Stability at 5 Months5 Months
Purity99.05
Maximum Individual impurity0.25
Total Impurities0.95

Patent 2024
Blood Vessel Edetic Acid Ethanol Melphalan polyethylene glycol 300
Not available on PMC !

Example 6

This Example illustrates the involvement of alkalinity of culture medium in mediating Pb′ precipitation.

The pH of culture broth after the recovery of bioprecipitated Pb′ by B. licheniformis strain ECOBIO_2 was found to be 12. However, the pH of the control broth remained at 7. With this background, experiments were conducted to assess the involvement of alkalinity of the culture medium in mediating lead precipitation. Both the chelated and non-chelated forms of Pb(C2H3O2)2) and Pb(NO3)2 were added in culture broth and the initial pH was recorded as 7.4. Further, after the three days of incubation, individual flasks were tested for change in the pH. Results are shown in FIG. 6. To rule out the involvement of pH alone in precipitation, ammonium chloride was added to the broth amended with Pb(NO3)2+EDTA till the pH of the medium reached 12 and the broth was observed for signs of precipitation. No precipitation was observed even after increasing the pH of medium to 12 and 14. Thus the investigation confirmed that pH alone without the bacteria cannot bring forth the precipitation of lead, and that the lead precipitation is due to the bacteria and not due to the pH change.

Patent 2024
Alkalies Bacteria Bioremediation Chloride, Ammonium Edetic Acid Strains

Top products related to «Edetic Acid»

Sourced in United States, United Kingdom, Germany, Canada, Switzerland, France, China, Australia, Japan, Italy, Spain, New Zealand, Sweden, Singapore, Portugal, Thailand, Belgium, Denmark, Taiwan, Province of China, Ireland, Brazil, Netherlands, Austria, Czechia, India, Morocco, Israel, Poland, Macao
Trypsin-EDTA is a solution used in cell culture applications to dissociate adherent cells from their growth surface. It contains the proteolytic enzyme trypsin and the chelating agent EDTA, which work together to break down the cellular adhesions and allow the cells to be harvested and passaged.
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel
Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.
Sourced in United States, Germany, China, United Kingdom, Italy, Japan, Sao Tome and Principe, France, Canada, Macao, Switzerland, Spain, Australia, Israel, Hungary, Ireland, Denmark, Brazil, Poland, India, Mexico, Senegal, Netherlands, Singapore
The Protease Inhibitor Cocktail is a laboratory product designed to inhibit the activity of proteases, which are enzymes that can degrade proteins. It is a combination of various chemical compounds that work to prevent the breakdown of proteins in biological samples, allowing for more accurate analysis and preservation of protein integrity.
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
Sourced in United States, Germany, United Kingdom, France, Italy, Canada, Switzerland, India, Sao Tome and Principe, Macao, Poland, Australia, China, Spain, Ireland, Japan, Israel, Brazil, Belgium, Sweden, Denmark, Singapore, Netherlands, Austria
EDTA is a chemical compound commonly used as a laboratory reagent. Its primary function is as a chelating agent, capable of binding to metal ions and forming stable complexes. EDTA is widely used in various analytical and experimental procedures to control the availability of metal ions in solutions.
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
Sourced in United States, United Kingdom, Germany, Switzerland, France, China, Japan, Canada, Belgium, Italy, Spain, India, Sweden, Netherlands, Australia
EDTA is a chemical compound used as an anticoagulant in laboratory settings. Its primary function is to prevent the coagulation or clotting of blood samples, which is essential for various analytical and diagnostic procedures.
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.

More about "Edetic Acid"

EDTA, ethylenediaminetetraacetic acid, chelating agent, heavy metal removal, water softening, analytical chemistry, medical treatment, pharmaceutical applications, laboratory procedures, DNA extraction, protein purification, PubCompare.ai, AI-driven protocol optimization, Trypsin-EDTA, FBS, protease inhibitor cocktail, penicillin, streptomycin, DMEM