Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Eosine I Bluish

Eosine I Bluish

Eosine I Bluish is a synthetic dye commonly used as a biological stain and indicator.
It exhibits a bluish-red color and is widely utilized in microscopy, histology, and cytology for staining various cellular structures.
Eosine I Bluish is particularly useful for visualizing erythrocytes, nucleic acids, and certain proteins.
Researchers can leverage PubCompare.ai's intelligent search and analysis tools to locate the best protocols for working with Eosine I Bluish from literature, preprints, and patents, improving research reproducibility and accurancy with the power of artificial intelliegence.

Most cited protocols related to «Eosine I Bluish»

1
Validating Neutrophil Abundance in BLCA
Cited 13 times
For the TCGA data sets, the original samples are unavailable for further studies; however, hematoxylin and eosin (H&E) digital slides have been publicly released. While it is not possible to distinguish T cells and B cells by H&E, neutrophils are morphologically distinctive and their abundance can be estimated. Occasional dendritic cells and macrophages can be identified by H&E but their true abundance is difficult to estimate in the absence of immunohistochemical stains. Slides were reviewed via digital images viewed with the Cancer Digital Slide Archive (http://cancer.digitalslidearchive.net). We chose BLCA because it has a large sample size (n = 404), does not have excessive necrosis, and has sufficient neutrophil counts and sample variety to allow for validation by histological evaluation. The pathologist reviewing the slides was blinded to the in silico neutrophil predictions. Samples were stratified into three groups (high, medium, low) with levels of neutrophils relative to the entire collection of samples.
Li B., Severson E., Pignon J.C., Zhao H., Li T., Novak J., Jiang P., Shen H., Aster J.C., Rodig S., Signoretti S., Liu J.S, & Liu X.S. (2016). Comprehensive analyses of tumor immunity: implications for cancer immunotherapy. Genome Biology, 17, 174.
Full text: Click here
Publication 2016
B-Lymphocytes Cells Dendritic Cells Eosin Eosine I Bluish Hematoxylin Macrophage Malignant Neoplasms Necrosis Neutrophil Pathologists Specimen Collection Staining T-Lymphocyte
2
C. albicans Growth Conditions
Cited 10 times
The strains of C. albicans used in this study are listed in supplemental Table S2. For routine growth, modified Lee's medium without methionine was used [31] (link), unless stated otherwise. For repression of MET3 promoter-controlled gene expression, 2.5 mM methionine and 2.5 mM cysteine were added to the medium. For GlcNAc induction, the carbon source glucose was replaced with GlcNAc (1.25% w/v) in nutrient medium. Here, agar containing Lee's medium, in which glucose was the carbon source, was referred to as glucose agar and Lee's medium containing GlcNAc as a carbon source was referred to as GlcNAc agar. Agar cultures were grown at a density of 80–120 colonies per 85 mm plate. Phloxine B was added to nutrient agar for opaque colony staining [46] (link).
Huang G., Yi S., Sahni N., Daniels K.J., Srikantha T, & Soll D.R. (2010). N-Acetylglucosamine Induces White to Opaque Switching, a Mating Prerequisite in Candida albicans. PLoS Pathogens, 6(3), e1000806.
Full text: Click here
Publication 2010
Agar Carbon Cysteine Eosine I Bluish Gene Expression Glucose Methionine Nutrients Repression, Psychology Strains
3
Generating Temperature-Sensitive Yeast Mutants
Cited 7 times

Table lists the yeast strains and Table the plasmids used. Sherman 1991 and Ausubel et al. 1996 describe the methods used for growth, maintenance, and genetic manipulation of yeast, and Gietz and Schiestl 1995 describe the method used to transform yeast.
Temperature-sensitive myo2 strains were generated by replacing the 3′ region of the endogenous genomic MYO2 gene with mutagenized plasmid DNA. To construct a plasmid capable of integrating 3′ to MYO2, pJP10-2B (YCp50 containing MYO2) ( Johnston et al. 1991) was cut with SpeI and the resulting fragments circularized using T4 DNA ligase. The ligated DNA served as template for five cycles of amplification by PCR using Taq DNA polymerase and the oligonucleotide primers GATAATGAAATCGATATTATGGAAGA and CGGGATCCATTATCATACTATACTATTGACAAATACTTC. The ClaI-BamHI segment of the 1.7-kb product was inserted into pRS303 ( Sikorski and Hieter 1989). Destruction of the pRS303 SpeI site by cutting with SpeI (partial digest) and XbaI and religation produced the plasmid pRS303MYO2, containing the 201-bp ClaI-SpeI fragment of the MYO2 3′ untranslated region, followed by the 1,587-bp segment of MYO2 from the SpeI site at +3271 on, fused to the sequence GCACTAGA and the NotI site of pRS303.
pRS303MYO2 served as a template for PCR-based mutagenesis ( Cadwell and Joyce 1992), modified to reduce the mutation frequency. The reaction mix (1 mM dCTP, 1 mM dTTP, 0.2 mM dATP, 0.2 mM dGTP, 40 ng pRS303MYO2 cut with PvuII, 7 mM MgCl2, 0.5 mM primers, 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 10 mg BSA, and 0.05% Tween 20; and after the mix had warmed up to 80°C, 0.3 mM MnCl2 and 5u Taq DNA polymerase) was subjected to six cycles of amplification and the EcoRI-NotI fragment of the PCR product was subcloned into the corresponding region of pRS303MYO2 to make libraries of mutagenized MYO2. When cut with SpeI and transformed into yeast, the library plasmids insert pRS303 (containing HIS3) into the ClaI site of the MYO2 3′ untranslated region, and replace the EcoRI-ClaI region of MYO2 with mutagenized sequence encoding amino acid residues 1119 to the COOH terminus.
Roughly 500 transformants at 30°C were replica-plated to 14 and 37°C to detect conditional-lethal mutants. Phloxine B included in plates at 10 mg/liter allowed easier identification of growth-arrested yeast ( Horn and Wilkie 1966). Because dead cells absorb this red dye, red marks correspond to the positions of temperature-sensitive colonies. Genomic DNA from each of the temperature sensitives was cut with SpeI and circularized to reconstitute versions of pRS303MYO2 containing mutations. Transformation of these plasmids relinearized with SpeI into the yeast strain PSY316 yielded the temperature-sensitive strains ABY532, 533, 534, 536, 537, 538, and 530. The temperature sensitivity could be complemented by transformation with pJP10-2B (MYO2 on a low copy number plasmid) or by mating with a MYO2 strain, but could not be complemented by mating with JP7B, a myo2-66 strain. ABY531, an isogenic MYO2 strain, was made by transformation of PSY316 with pRS303MYO2. An analogous series of plasmids made from pRS306 (containing URA3) allowed the construction of yeast strains containing myo2 alleles tagged with URA3. To make an isogenic myo2-66 strain, genomic DNA from JP7B transformed with pRS303MYO2 was cut with NcoI and religated, resulting in an integrating plasmid analogous to pRS303MYO2, but containing the full-length myo2-66 gene instead of the MYO2 fragment. This plasmid was cut with NcoI and transformed into PSY316 to construct ABY535. Diploid versions of these strains were made by transiently transforming with YCp50HO, a plasmid bearing HO ( Herskowitz and Jensen 1991).
Schott D., Ho J., Pruyne D, & Bretscher A. (1999). The Cooh-Terminal Domain of Myo2p, a Yeast Myosin V, Has a Direct Role in Secretory Vesicle Targeting. The Journal of Cell Biology, 147(4), 791-808.
Publication 1999
2'-deoxycytidine 5'-triphosphate Alleles Amino Acids Cells deoxyguanosine triphosphate Deoxyribonuclease EcoRI Diploidy DNA Library Eosine I Bluish Genes Genome Horns Hypersensitivity Magnesium Chloride manganese chloride Mutagenesis Mutation Oligonucleotide Primers Plasmids Reproduction Saccharomyces cerevisiae Strains T4 DNA Ligase Taq Polymerase thymidine 5'-triphosphate Tromethamine Tween 20 Untranslated Regions
4
Phenotypic Switching and Mating Assays
Cited 6 times
White-opaque switching and mating assays were performed as previously described [36] (link). The cells were incubated in air or in 5% CO2 for 4 to 10 days as indicated in the main text. We examined 350 to 500 colonies for each strain. More were tested for nonswitchable strains or on nonconducive media. To verify the colony phenotype, several randomly selected colonies were examined for the cellular morphology. The dye phloxine B, which exclusively stains opaque colonies red, was added to the media. Scanning electron microscopy (SEM) assay was described as we described previously [22] (link). To observe the mating response, 106 cells of each of the two mating strains indicated in the text were mixed and spotted onto Lee's GlcNAc agar and incubated at 25°C for 4 days. At least 1×107 cells of each mating patch were examined with a light microscopy. Quantitative mating assay was performed as previously described with slight modifications [10] (link). Briefly, the mating experiments were performed on Lee's GlcNAc medium at 25°C. The experimental opaque cell samples were collected from Lee's GlcNAc medium plates. To test the mating ability of the MTLa/α strain (SZ306u), 1×106 of MTLa/a (or MTLα/α) cells and 1×106 of MTLa/α cells were mixed and cultured on Lee's GlcNAc medium plates for 48 hours. The mating mixtures were resuspended, diluted, and plated onto three types of selectable plates (without uridine, or arginine, or both) for prototrophic growth. Mating efficiencies were calculated as previously described [14] (link).
The library of transcription factor mutants contains the TF mutants generated by the Johnson lab [37] (link) and strains collected from Candida community [36] (link). Cells of each mutant were plated onto Lee's GlcNAc plates and incubated at 25°C for 7 to 10 days. Opaque colonies were replated and tested for the MTL genotype with PCR.
Xie J., Tao L., Nobile C.J., Tong Y., Guan G., Sun Y., Cao C., Hernday A.D., Johnson A.D., Zhang L., Bai F.Y, & Huang G. (2013). White-Opaque Switching in Natural MTLa/α Isolates of Candida albicans: Evolutionary Implications for Roles in Host Adaptation, Pathogenesis, and Sex. PLoS Biology, 11(3), e1001525.
Full text: Click here
Publication 2013
Agar Arginine Biological Assay Candida cDNA Library Cells Cultured Cells Culture Media Eosine I Bluish Genotype Light Microscopy Phenotype Scanning Electron Microscopy SLC47A1 protein, human Staining Strains Transcription Factor Uridine
5
Postinfection Eye Tissue Fixation
Cited 6 times
Whole eyes were harvested at 0, 4, 8, or 12 h postinfection and incubated in an 85/15 paraformaldehyde/alcohol fixative for 24 h at room temperature. Whole eyes were then exchanged into 70% ethanol for 24 h and then embedded in paraffin. Sections were deparaffinized and stained in Harris hematoxylin solution for 8 min, counterstained in eosin-phloxine B solution for 30 sec, dehydrated through two changes of 95% alcohol and cleared in two changes of xylene. Images are representative of 4 eyes per group at each time point.
Novosad B.D., Astley R.A, & Callegan M.C. (2011). Role of Toll-Like Receptor (TLR) 2 in Experimental Bacillus cereus Endophthalmitis. PLoS ONE, 6(12), e28619.
Full text: Click here
Publication 2011
Eosin Eosine I Bluish Ethanol Eye Fixatives Paraffin Embedding paraform phloxine Xylene

Most recents protocols related to «Eosine I Bluish»

1
Fungal Specimen Collection and Microscopic Analysis
The specimens were collected from the provinces of Jinlin, Heilongjiang, and Gansu in North China. They were deposited in the herbaria of Beijing Forestry University (BJFC) and the Mycology Department of Jinlin Agriculture University (HMJAU). Samples were photographed when fresh in the field, and their habitats were recorded. Microscopic structures were discussed by Chen et al. (2020) (link), Fan et al. (2021) (link), and Zhou et al. (2022) (link). Special color terms were set by Anonymous (1969) and Petersen (1996) . A Nikon Digital Sight DS-L3 or Leica ICC50 HD camera (magnification ×1,000) was used to examine hand-cut sections of basidiomata, which were first treated with 5% KOH for a few minutes and then with 1% phloxine B (C20H4Br4Cl2K2O5). At least 30 basidiospores of each species were examined. The values were expressed as a mean with 5% of the measurements excluded from each end of the range, given in parentheses. Stalks were excluded for basidia measurement, and the hilar appendages were excluded for basidiospore measurement.
The following abbreviations are used in the descriptions: IKI, Melzer’s reagent; IKI−, neither amyloid nor dextrinoid; CB, cotton blue; CB−, acyanophilous in cotton blue; L, the arithmetic average of spore lengths; W, the arithmetic average of spore widths; Q, L/W ratio; and n (a/b), number of spores (a) measured from a given number (b) of specimens.
Zhou H.M., Bau T, & Si J. (2023). Morphological and phylogenetic evidence reveal three new Pseudohydnum (Auriculariales, Basidiomycota) species from North China. Frontiers in Cellular and Infection Microbiology, 13, 1139449.
Full text: Click here
Publication 2023
Amyloid Proteins aniline blue Eosine I Bluish Microscopy Spores Stalking Vision
2
Immunohistochemical Evaluation of SARS-CoV-2
The samples were fixed in 7% formaldehyde for 5 days, after which the samples were oriented and placed in cassettes. Tissue processing was performed using a vacuum infiltration processor, Tissue-Tek VIP 5 Jr (Sakura, Alphen aan den Rijn, Netherlands). Paraffin embedding and sectioning were performed using the Tissue-Tek TEC 6 system (Sakura, Alphen aan den Rijn, Netherlands) and Accu-Cut SRM 200 Rotary Microtome (Sakura, Alphen aan den Rijn, Netherlands). Slide staining was performed using the automated slide stainer Tissue-Tek Prisma Plus (Sakura, Alphen aan den Rijn, Netherlands), according to the internal staining protocol, using Mayer Modified Hematoxylin (Titolchimica, Rovigo, Italy) and Eosine solution (10 g Eosine B in 1000 mL distilled water).
Immunohistochemistry was performed automatically on 3 μm thick sections of formalin-fixed and paraffin-embedded tissues with MD Stainer (Vitro Master Diagnostica®, Granada, Spain) using ethylenediaminetetraacetic acid (EDTA), at pH = 9, for antigen retrieval. We used anti-SARS coronavirus NP mouse anti-virus antibody (clone B46F, Invitrogen, Waltham, MA, USA) at a 1:100 dilution for the immunohistochemical assessment. Positive cells are colored in brown.
Microscopic examination was performed by the same experienced pathologist (D.G.), using a Leica DM1000 clinical microscope (Leica, Wetzlar, Germany) with a dedicated image acquisition camera and software. All sections were examined by the same experienced investigator (D.G.).
Jeican I.I., Inișca P., Gheban D., Anton V., Lazăr M., Vică M.L., Mironescu D., Rebeleanu C., Crivii C.B., Aluaș M., Albu S, & Siserman C.V. (2023). Histopathological Lung Findings in COVID-19 B.1.617.2 SARS-CoV-2 Delta Variant. Journal of Personalized Medicine, 13(2), 279.
Full text: Click here
Publication 2023
Antibodies, Anti-Idiotypic Antigens Cells Clone Cells Coronavirus Edetic Acid Eosin Eosine I Bluish Formaldehyde Formalin Hematoxylin Immunohistochemistry Microscopy Microtomy Mus Paraffin Embedding Pathologists prisma Severe acute respiratory syndrome-related coronavirus Technique, Dilution Tissues Vacuum Virus
3
Electrochemical Properties of Organic Dyes
The electrochemical properties of the 0.1 mM ZnTPyP molecule, rhodamine B, MO, and eosin B dichloromethane solution were measured with cyclic voltammetry (CV) using the conventional three-electrode system, in which a 3.0 mm diameter glass carbon disk (0.071 cm2, Shanghai Chenhua) was used as the working electrode, a platinum wire was used as the counter electrode, and Ag/AgCl (silver/silver chloride) was used as the reference electrode (3.0 M KCl solution. The electrode potential was +0.22 V vs. the NHE potential, and 0.1 M of tetra-n-butylammonium hexafluorophosphate (TBAPF6) was used as the electrolyte. The oxidation-reduction potential was measured through an electrochemical workstation. Based on the optical and electrochemical data, the energy levels of the HOMOs and LUMOs of the organic dyes can be estimated using Equations (2)–(4).
Eg=hcλabs=1240λabs
EHOMO=−Eox vs. Ag/AgCl−ENHE vs. Ag/AgCl−4.5
ELUMO=EHOMO−Eg
where Eg is the energy gap and λabs is the maximum UV–Vis absorption wavelengths value in the dichloromethane solution. EHOMO and ELUMO are the energy levels of the HOMOs and LUMOs, respectively. The standard hydrogen electrode (NHE) potential was −4.5 eV relative to the vacuum level. The CV curve test ranged from −1.6 V to 1.6 V, and the scan rate was 200 mV/s. All electrochemical tests were performed at 25 °C under N2 saturation.
Liu S., Huang G., Wang J., Bao J., Wang M., Wei Y., Zhong Y, & Bai F. (2023). Noble Metal Nanoparticle-Loaded Porphyrin Hexagonal Submicrowires Composites (M-HW): Photocatalytic Synthesis and Enhanced Photocatalytic Activity. Nanomaterials, 13(4), 660.
Full text: Click here
Publication 2023
Carbon Dyes Electrolytes Eosine I Bluish Homo Hydrogen Methylene Chloride Oxidation-Reduction Platinum Radionuclide Imaging rhodamine B silver chloride tetra-n-butylammonium hexafluorophosphate Vacuum zinc 5, 10, 15, 20-tetra(4-pyridyl)-21H-23H-porphine
4
Photocatalytic Degradation of Organic Dyes
The photocatalytic activity of M-HW was evaluated through the photocatalytic degradation of the organic pollutants. Precisely, 1 mg of M-HW composites (photocatalyst) was added to 40 mL of MO (20 mg/L, target dye). The mixture was stirred continuously in the dark for 30 min to obtain a homogenized mixture and achieve adsorption–desorption equilibrium. Then, the mixture was transferred to the photocatalytic reaction system and irradiated under light at a specific time, and aliquots of 4 mL of the solution were collected in 7 mL Eppendorf (Ep) tubes every 20 min, and the supernatant was removed twice using high-speed centrifugation at 9500 rpm for 10 min. The absorbance value of MO at the maximum absorption wavelength (464 nm) was measured using a visible spectrophotometer (Shanghai Prism Technology 722SP). Different target dyes, such as rhodamine B (1 × 10−5 M, λmax = 554 nm) and eosin B (5 × 10−5 M, λmax = 518 nm), were changed in the same condition to record the maximum absorption value. The photocatalytic activities of M-HW on different dyes were studied using the photocatalytic degradation curve.
The photocatalytic degradation curve of organic dyes can be fitted using the first-order kinetic Equation (1) as follows: InC0C=kt
where C0 (mg/mL) and C (mg/mL) represent the initial organic dye concentration and the dye concentration after irradiation, respectively; k represents the apparent rate constants, and t represents the reaction time (min) [44 (link)]. Thus, k was used to evaluate the photocatalytic activity in this work.
Liu S., Huang G., Wang J., Bao J., Wang M., Wei Y., Zhong Y, & Bai F. (2023). Noble Metal Nanoparticle-Loaded Porphyrin Hexagonal Submicrowires Composites (M-HW): Photocatalytic Synthesis and Enhanced Photocatalytic Activity. Nanomaterials, 13(4), 660.
Full text: Click here
Publication 2023
Adsorption Centrifugation Environmental Pollutants Eosine I Bluish Kinetics Light prisma Radiotherapy rhodamine B
5
Synthesis and Characterization of CTAB-ZnTPyP Complex
Cetyltrimethylammonium bromide (CTAB) was obtained from Sigma-Aldrich, and 5, 10, 15, 20-tetrakis (4-pyridyl) zinc porphyrin (ZnTPyP) was purchased from Frontier Scientific. Sodium hydroxide standard solution (NaOH, 1 N) was obtained from Acros, and hydrochloric acid (HCl) was obtained from Kaifeng Dongda Chemical Co., Ltd. Methyl orange (MO) and ascorbic acid (AA) were purchased from Aladdin. Rhodamine B (RhB) and eosin B were obtained from J&K. N,N-dimethylformamide (DMF) was obtained from Tianjin Deen Chemical Reagent Co., Ltd. Tetra-n-butyl hexafluorophosphate (TBAPF6) was obtained from Alfa Aesar. All the solutions were prepared with ultrapure water from a Barnstead Nanopure water system (resistivity of 18.2 MΩ·cm).
Liu S., Huang G., Wang J., Bao J., Wang M., Wei Y., Zhong Y, & Bai F. (2023). Noble Metal Nanoparticle-Loaded Porphyrin Hexagonal Submicrowires Composites (M-HW): Photocatalytic Synthesis and Enhanced Photocatalytic Activity. Nanomaterials, 13(4), 660.
Full text: Click here
Publication 2023
Ascorbic Acid Cetrimonium Bromide Dimethylformamide Eosine I Bluish Hydrochloric acid methyl orange rhodamine B Sodium Hydroxide Tetragonopterus zinc 5, 10, 15, 20-tetra(4-pyridyl)-21H-23H-porphine zinc hematoporphyrin

Top products related to «Eosine I Bluish»

1
Phloxine b by Merck Group
Sourced in United Kingdom, United States, Germany
Phloxine B is a fluorescent dye used in analytical and research laboratory applications. It is a water-soluble, reddish-pink crystalline powder that fluoresces under ultraviolet light. Phloxine B can be used as a staining agent for various biological samples.
2
Eosin b by Merck Group
Sourced in United States, Germany
Eosin B is a synthetic dye commonly used as a biological stain in laboratory settings. It is a red, crystalline powder that is soluble in water and alcohol. Eosin B is commonly used to stain cellular structures for microscopic analysis, particularly in the fields of histology and cytology.
3
Eosin b solution by Merck Group
Eosin B solution is a laboratory reagent used in various staining and visualization techniques. It is a yellowish-red dye that is commonly used as a counterstain in histological and cytological preparations. The solution provides a contrasting color to highlight specific cellular structures or components when used in conjunction with other stains.
4
Eosin y by Merck Group
Sourced in United States, Germany, United Kingdom, Japan, Italy, Macao, China, Switzerland, Malaysia
Eosin Y is a fluorescent dye commonly used in microscopy and histology. It is a bright, reddish-orange dye that binds to basic structures in cells, staining them a distinct color. Eosin Y is often used in combination with other dyes, such as hematoxylin, to provide contrast in tissue samples.
5
Lsm 510 meta by Zeiss
Sourced in Germany, United States, United Kingdom, Japan, Italy, France, Belgium, Canada, Switzerland, Austria, China, Sweden
The LSM 510 META is a laser scanning confocal microscope designed for high-resolution imaging. It features a multi-track detection system that enables simultaneous acquisition of multiple fluorescent signals.
6
Scanscope cs by Leica
Sourced in United States, Germany
The Leica ScanScope CS is a high-performance digital slide scanner designed for scanning and digitizing microscope slides. It captures high-resolution images of tissue samples and other specimens for various applications in life sciences and medical research.
7
Deuterated chloroform by Merck Group
Sourced in Germany, United States, United Kingdom, Italy, China, France, Switzerland
Deuterated chloroform is a chemical compound that consists of a single carbon atom, a single chlorine atom, and three deuterium atoms. It is a colorless, dense liquid with a characteristic chloroform-like odor. Deuterated chloroform is commonly used as a solvent in nuclear magnetic resonance (NMR) spectroscopy due to its specific chemical and physical properties.
8
Eclipse e200 optical by Nikon
The Eclipse E200 is a compact, versatile optical microscope designed for a wide range of applications. It features a high-quality optical system and a range of accessories to support various observation techniques.
9
Bx41 microscope by Olympus
Sourced in Japan, United States, Germany, Canada, United Kingdom, Spain, Australia, Belgium, Hungary, Switzerland, Denmark, France, China
The BX41 is an upright microscope designed for routine laboratory applications. It features a high-intensity LED illumination system and a sturdy, ergonomic design.
10
Harris hematoxylin by StatLab
Sourced in United States
Harris hematoxylin is a staining reagent used in histology and cytology. It is a complex dye that selectively binds to nucleic acids, allowing the visualization of cell nuclei in tissue sections or cytological preparations.

More about "Eosine I Bluish"

Eosine I Bluish, also known as Eosin I Bluish or Bluish Eosin, is a synthetic dye widely used as a biological stain and indicator.
It exhibits a distinctive bluish-red color and is a versatile tool in microscopy, histology, and cytology, where it is employed to stain various cellular structures for enhanced visualization.
Eosine I Bluish is particularly useful for staining erythrocytes (red blood cells), nucleic acids, and certain proteins.
Researchers can leverage the powerful search and analysis capabilities of PubCompare.ai to locate the best protocols for working with Eosine I Bluish from a vast array of literature, preprints, and patents.
This AI-driven platform helps improve research reproducibility and accuracy by providing access to the most relevant and optimized protocols.
Phloxine B, Eosin B, and Eosin Y are related dyes that share similar properties and applications with Eosine I Bluish.
These dyes are commonly used in combination with other stains, such as hematoxylin, to achieve comprehensive cellular staining and visualization.
Specialized microscopy equipment, such as the LSM 510 META, ScanScope CS, Eclipse E200 optical, and BX41 microscope, can be utilized to observe and analyze samples stained with Eosine I Bluish.
Additionally, deuterated chloroform is sometimes used as a mounting medium for Eosine I Bluish-stained specimens.
By harnessing the power of artificial intelligence and the wealth of information available through PubCompare.ai, researchers can optimize their workflows, enhance research reproducibility, and achieve superior outcomes in their studies involving Eosine I Bluish and related dyes.