Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Ethylmaleimide

Ethylmaleimide

Ethylmaleimide is a chemical compound widely used in biomedical research and clinical applications.
It is a member of the maleimide family and is known for its ability to selectively modify sulfhydryl groups in proteins, making it a valuable tool for studying protein structure and function.
Ethylmaleimide has been employed in a variety of protocols, including protein labeling, crosslinking, and activity assays.
Researchers can leverage the power of PubCompare.ai to optimize their Ethylmaleimide-based protocols by accessing a comprehensive database of published procedures, pre-prints, and patents.
The AI-driven platform helps identify the most reliable and effective Ethylmaleimide protocols, ensuring efficient and reproducible research.
Explore PubCompare.ai today to discover the latest advancements in Ethylmaleimide research and streamline your scientific endeavors.

Most cited protocols related to «Ethylmaleimide»

1
Proteomic Identification of Fission Yeast Proteins
Two datasets corresponding to the spectral type (CID, Low, Standard, αLP) and (ETD, Low, Standard, αLP) contain 49,167 spectra each. These datasets were generated in the Komives laboratory (University of California, San Diego). The detailed experimental procedures to generate these datasets are as follows. Wild-type S. pombe cells were lysed in: 50mM Tris-HCl pH: 8.0; 150mM NaCl; 5mM EDTA; 10% Glycerol; 50mM NaF; 0.1mM Na3VO4; 0.2% NP40 and stored at −80°C. The debris was pelleted and then the supernatant was collected. The pellet was extracted according to [56 (link)]. Briefly, the pellet was resuspended in 200 ul of 0.1 M NaOH, 0.05 M ETDA, 2% SDS, and 2% beta-mercaptoethanol and incubated at 90°C for 10 minutes. Acetic acid was added to 0.1M and vortexed followed by an additional incubation at 90°C for 10 minutes before clarification by centrifugation and Methanol/chloroform extraction. The pellet was resuspended in 100 mM Tris containing 0.1% sodium deoxycholate with TCEP at 5 mM. Free thiols were capped with n-ethylmaleimide. Excess reagent was removed by ultrafiltration with amicon-4 10 kDa centrifugal devices. The protein was then quantified and exchanged into 6M guanidine for digestion overnight by αLP. The digests were quenched by the addition of formic acid to 1%, followed by desalting by sep-pak (Waters, Milford, MA). Peptides were then fractionated with Electrostatic Repulsion-Hydrophilic Interaction Chromatography [57 (link)]. Fractions were assayed for protein concentration using a BCA assay and pooled into 18 fractions of equal protein concentration, evaporated to dryness and resuspended in 100 uL of 0.2% FA. Nano liquid chromatography tandem mass spectrometry (nLC-MS/MS) was performed with a LTQ XL mass spectrometer equipped with ETD. 10 ul of each fraction (≈ 1 ug) was injected onto a 12 cm × 75 um I.D.C18 column prepared in house and eluted in 0.2% FA with a gradient of 5% to 40% ACN over 60 min followed by wash and re-equilibration totaling 90 minutes of MS data per run. The flow was split about 1:500 to a flow rate of about 250 nL/min. A survey scan was followed by data dependent fragmentation of the 4 most abundant ions with both CID and ETD with supplemental activation. The maximum MS/MS ion accumulation time was set to 100 ms. Fragmented precursors were dynamically excluded for 45 seconds with one repeat allowed.
Kim S, & Pevzner P.A. (2014). Universal database search tool for proteomics. Nature communications, 5, 5277.
Publication 2014
2-Mercaptoethanol Acetic Acid Biological Assay Cells Centrifugation Chloroform Chromatography Deoxycholic Acid, Monosodium Salt Digestion Disgust Edetic Acid Electrostatics Ethylmaleimide formic acid Glycerin Guanidine Hydrophilic Interactions Liquid Chromatography M-200 Medical Devices Methanol Neoplasm Metastasis Peptides Proteins Radionuclide Imaging Sodium Chloride Sulfhydryl Compounds Tandem Mass Spectrometry tris(2-carboxyethyl)phosphine Tromethamine Ultrafiltration
2
Protocols for DNA Damage Response Research
U2OS-based lines were maintained under standard conditions. cDNA cloning was by standard procedures. siRNA transfections were with Lipofectamine RNAiMAX (Invitrogen). IR was administered with a Faxitron X-ray machine (Faxitron X-ray Corporation). ATM inhibition was by KU-55933 (KuDOS Pharmaceuticals). Laser micro-irradiation was with a FluoView 1000 confocal microscope (Olympus) with 37°C heating stage (Ibidi) and 405 nm diode (6 mW). FRAP was performed when laser-track accumulation of GFP-tagged protein reached maximal steady-state level. For immunofluorescence, cells were pre-extracted or not, fixed with 2% paraformaldehyde, permeabilized and stained. For whole cell extracts, cells were lysed on plates with 2% SDS, 50 mM Tris-HCl pH 7.5, 20 mM N-ethylmaleimide (Sigma-Aldrich) and protease inhibitor cocktail (Roche). To immunoprecipitate 53BP1, BRCA1 and sumoylated proteins, different lysis and binding buffers were used (Supplementary Information). HR and NHEJ assays were as previously described17 (link),28 (link). For IR survival, cells were transfected with siRNA and exposed to IR. After 10-14 days, colonies were stained with 0.5% crystal violet/20% ethanol, counted and normalized to plating efficiencies. For Florescence-Activated Cell Sorting (FACS) of propidium iodide-stained cells, data were analyzed by FlowJo software. All error-bars represent STDEV. Detailed descriptions of methods are provided in Supplementary Information.
Galanty Y., Belotserkovskaya R., Coates J., Polo S., Miller K.M, & Jackson S.P. (2009). Mammalian SUMO E3-ligases PIAS1 and PIAS4 promote responses to DNA double-strand breaks. Nature, 462(7275), 935-939.
Publication 2009
Biological Assay BRCA1 protein, human Buffers Cell Extracts Cells DNA, Complementary Ethanol Ethylmaleimide Immunofluorescence KU 55933 Lipofectamine Microscopy, Confocal Non-Homologous DNA End-Joining paraform Pharmaceutical Preparations Propidium Iodide Protease Inhibitors Proteins Psychological Inhibition Radiography Radiotherapy RNA, Small Interfering TP53BP1 protein, human Transfection Tromethamine Violet, Gentian
3
Histological and Immunological Analysis of Placental Samples
Samples were fixed, paraffin embedded, sectioned, and stained with hematoxylin/eosin for histological evaluation as described [57 (link)]. Tissue sections were subject to immunological staining with avidin:biotinylated enzyme complex as described [18 (link),58 (link)]. Proteins were extracted from TS cells using M-PER reagent (PIERCE) with the addition of protease inhibitor cocktail (Sigma-Aldrich), 1 mM sodium molybdate, 1 mM sodium vanadate, and 10 mM N-ethylmaleimide, or SDS lysis buffer (2% SDS, 10% glycerol, and 50 mM Tris, pH 6.8). Protein extracts were subject to immunoblotting as described [54 (link)]. Bound primary antibodies were detected with horseradish peroxidase-conjugated secondary antibodies (Vector Lab), followed by ECL-mediated visualization (GE HealthCare) and autoradiography. Mouse monoclonal antibodies anti-actin (Thermo Fisher; 1:1,000), anti-BrdU (Thermo Fisher; 1:300), anti-Cdx2 (BioGenex; 1:1), anti-MDM2 (Santa Cruz; 1:100), and anti-SUMO-1 (Zymed; 1:2,000); rabbit polyclonal antibodies anti-calnexin (Stressgene; 1:2,000), anti-cyclin D1 (Neomarker; 1:100), anti-Ki67 (Neomarker; 1:400), anti-laminin (Sigma-Aldrich; 1:25), anti-Myc tag (CalBioChem; 1:400), anti-Oct4 (Santa Cruz; 1:200), anti-p53 (Santa Cruz; 1:50), and anti-p450scc (Chemicon; 1:200); and goat polyclonal antibody anti-lamin B (Santa Cruz; 1:100) were used as primary antibodies. BrdU incorporation analysis was performed by intraperitoneal injection of BrdU (250 μg/g of body weight) into pregnant females for 1 h. Placentas were recovered, fixed, embedded, sectioned, and subject to immunostaining as described [18 (link),57 (link)].
Chiu S.Y., Asai N., Costantini F, & Hsu W. (2008). SUMO-Specific Protease 2 Is Essential for Modulating p53-Mdm2 in Development of Trophoblast Stem Cell Niches and Lineages. PLoS Biology, 6(12), e310.
Full text: Click here
Publication 2008
Actins Antibodies Autoradiography Avidin Body Weight Bromodeoxyuridine Buffers Calnexin Cloning Vectors Cyclin D1 Eosin Ethylmaleimide Glycerin Goat Horseradish Peroxidase immunoglobulin B Immunoglobulins Injections, Intraperitoneal Laminin Lamins Lamin Type B MDM2 protein, human Monoclonal Antibodies Multienzyme Complexes Mus Paraffin Placenta POU5F1 protein, human Pregnant Women Protease Inhibitors Proteins Rabbits sodium molybdate(VI) Sodium Vanadate SUMO1 protein, human Tissues Tromethamine
4
Investigating NF-κB Signaling Mechanisms

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2009
alpha, NF-KappaB Inhibitor Biological Assay Buffers Cardiac Arrest Cells Edetic Acid Ethylmaleimide G-substrate Glycerin Glycerophosphates GTP-Binding Proteins HEPES Immunoglobulins Immunoprecipitation Interferon Type II Interleukin-1 beta leupeptin Magnesium Chloride Proteins Sepharose Serum Sodium Chloride Staphylococcal Protein A Staphylococcal protein A-sepharose Tetracycline Triton X-100 Tromethamine Tumor Necrosis Factor-alpha Urea
5
Ubiquitin-tagged Protein Analysis in Cells
Parental GFP-Ub, stable GFP-Ub, and GFP-UbK0,G76V Mel JuSo cells were washed with phosphate-buffered saline and trypsinized. Cells were lysed in SDS-PAGE sample buffer. Proteins were separated by SDS-PAGE, transferred onto nitrocellulose or PVDF membranes, and probed with two different rabbit polyclonal antibodies against GFP (Invitrogen; van Ham et al., 1997 (link)) or a rabbit polyclonal antibody against ubiquitin (DakoCytomation and Sigma-Aldrich, respectively). The filters were reprobed with a mouse monoclonal antibody against glyceraldehyde-3-phosphate dehydrogenase (Fitzgerald Industries, Intl.) as a control for equal protein loading. After incubation with peroxidase-conjugated secondary antibodies, the blots were developed by enhanced chemiluminescence (GE Healthcare).
For separation of nuclei and cytosol, cells were scraped in a buffer containing 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 50 mM Hepes, pH 7.0, 1 mM EGTA, and 0.2% Triton X-100 supplemented with protease inhibitors and 50 mM N-ethylmaleimide. Cells were lysed for 10 min, and nuclei were pelleted by centrifugation for 5 min at 1,000 g. The supernatant is the cytosolic fraction; nuclei were resuspended in a buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, and 0.1% SDS supplemented with 50 mM N-ethylmaleimide and sonicated on ice to disrupt DNA.
Dantuma N.P., Groothuis T.A., Salomons F.A, & Neefjes J. (2006). A dynamic ubiquitin equilibrium couples proteasomal activity to chromatin remodeling. The Journal of Cell Biology, 173(1), 19-26.
Publication 2006
Antibodies Buffers Cell Nucleus Cells Centrifugation Chemiluminescence Cytosol Egtazic Acid Ethylmaleimide Glyceraldehyde-3-Phosphate Dehydrogenases HEPES Immunoglobulins Magnesium Chloride Monoclonal Antibodies Mus Nitrocellulose Parent Peroxidase Phosphates polyvinylidene fluoride Protease Inhibitors Proteins Rabbits Saline Solution SDS-PAGE Sodium Chloride Staphylococcal Protein A Sucrose Tissue, Membrane Triton X-100 Tromethamine Ubiquitin

Most recents protocols related to «Ethylmaleimide»

1
Targeted siRNA Delivery for Muscle Atrophy
Not available on PMC !

Example 24

For groups 1-12, see study design in FIG. 32, the 21mer Atrogin-1 guide strand was designed. The sequence (5′ to 3′) of the guide/antisense strand was UCGUAGUUAAAUCUUCUGGUU (SEQ ID NO: 14237). The guide and fully complementary RNA passenger strands were assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity. Purified single strands were duplexed to get the double stranded siRNA described in figure A. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linkers. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

For groups 13-18 see study design in FIG. 32, a 21mer negative control siRNA sequence (scramble) (published by Burke et al. (2014) Pharm. Res., 31(12):3445-60) with 19 bases of complementarity and 3′ dinucleotide overhangs was used. The sequence (5′ to 3′) of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 14228). The same base, sugar and phosphate modifications that were used for the active MSTN siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH2 at the 5′ end and a C6-SH at the 3′ end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphodiester linker. Because the free thiol was not being used for conjugation, it was end capped with N-ethylmaleimide.

Antibody siRNA Conjugate Synthesis Using Bis-Maleimide (BisMal) Linker

Step 1: Antibody Reduction with TCEP

Antibody was buffer exchanged with 25 mM borate buffer (pH 8) with 1 mM DTPA and made up to 10 mg/ml concentration. To this solution, 4 equivalents of TCEP in the same borate buffer were added and incubated for 2 hours at 37° C. The resultant reaction mixture was combined with a solution of BisMal-siRNA (1.25 equivalents) in pH 6.0 10 mM acetate buffer at RT and kept at 4° C. overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA. The reaction mixture was treated with 10 EQ of N-ethylmaleimide (in DMSO at 10 mg/mL) to cap any remaining free cysteine residues.

Step 2: Purification

The crude reaction mixture was purified by AKTA Pure FPLC using anion exchange chromatography (SAX) method-1. Fractions containing DAR1 and DAR2 antibody-siRNA conjugates were isolated, concentrated and buffer exchanged with pH 7.4 PBS.

Anion Exchange Chromatography Method (SAX)-1.

Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID×15 cm, 13 um

Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow Rate: 6.0 ml/min

Gradient:

a.% A% BColumn Volume
b.10001
c.81190.5
d.505013
e .40600.5
f.01000.5
g.10002

Anion Exchange Chromatography (SAX) Method-2

Column: Thermo Scientific, ProPac™ SAX-10, Bio LC™, 4×250 mm

Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow Rate: 0.75 ml/min

Gradient:

a.Time% A% B
b.0.09010
c.3.009010
d.11.004060
e.14.004060
f.15.002080
g.16.009010
h.20.009010

Step-3: Analysis of the Purified Conjugate

The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2 (Table 22).

TABLE 22
SAX retention% purity
Conjugatetime (min)(by peak area)
TfR1-Atrogin-1 DAR19.299
TfR1-Scramble DAR18.993

In Vivo Study Design

The conjugates were assessed for their ability to mediate mRNA downregulation of Atrogin-1 in muscle (gastroc) in the presence and absence of muscle atrophy, in an in vivo experiment (C57BL6 mice). Mice were dosed via intravenous (iv) injection with PBS vehicle control and the indicated ASCs and doses, see FIG. 32. Seven days post conjugate delivery, for groups 3, 6, 9, 12, and 15, muscle atrophy was induced by the daily administration via intraperitoneal injection (10 mg/kg) of dexamethasone for 3 days. For the control groups 2, 5, 8, 11, and 14 (no induction of muscle atrophy) PBS was administered by the daily intraperitoneal injection. Groups 1, 4, 7, 10, and 13 were harvested at day 7 to establish the baseline measurements of mRNA expression and muscle weighted, prior to induction of muscle atrophy. At three days post-atrophy induction (or 10 days post conjugate delivery), gastrocnemius (gastroc) muscle tissues were harvested, weighed and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ΔCt) is calculated and then further normalized relative to the PBS control group by taking a second difference (ΔΔCt).

Quantitation of tissue siRNA concentrations was determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Results

The data are summarized in FIG. 33-FIG. 35. The Atrogin-1 siRNA guide strands were able to mediate downregulation of the target gene in gastroc muscle when conjugated to an anti-TfR mAb targeting the transferrin receptor, see FIG. 33. Increasing the dose from 3 to 9 mg/kg reduced atrophy-induced Atrogin-1 mRNA levels 2-3 fold. The maximal KD achievable with this siRNA was 80% and a tissue concentration of 40 nM was needed to achieve maximal KD in atrophic muscles. This highlights the conjugate delivery approach is able to change disease induce mRNA expression levels of Atrogin-1 (see FIG. 34), by increasing the increasing the dose. FIG. 35 highlights that mRNA down regulation is mediated by RISC loading of the Atrogin-1 guide strands and is concentration dependent.

Conclusions

In this example, it was demonstrated that a TfR1-Atrogin-1 conjugates, after in vivo delivery, mediated specific down regulation of the target gene in gastroc muscle in a dose dependent manner. After induction of atrophy the conjugate was able to mediate disease induce mRNA expression levels of Atrogin-1 at the higher doses. Higher RISC loading of the Atrogin-1 guide strand correlated with increased mRNA downregulation.

US11872287B2. Compositions and methods of treating muscle atrophy and myotonic dystrophy (2024-01-16). Avidity Biosciences, Inc. [US]. Inventors: Andrew John Geall [US], Venkata Doppalapudi [US], David Sai-Ho Chu [US], Michael Caramian Cochran [US], Michael Hood [US], Beatrice Diana Darimont [US], Rob Burke [US], Yunyu Shi [US], Gulin Erdogan Marelius [US], Barbora Malecova [US].
Full text: Click here
Patent 2024
Acetate Anions Antibody Formation Antigens Atrophy Biological Assay Borates Buffers Carbohydrates Chromatography Complementary RNA Complement System Proteins Cysteine Dexamethasone Dinucleoside Phosphates DNA, Complementary Down-Regulation Ethanol Ethylmaleimide Freezing Genes Genes, Housekeeping High-Performance Liquid Chromatographies Immunoglobulins Injections, Intraperitoneal maleimide MicroRNAs Mus Muscle, Gastrocnemius Muscle Tissue Muscular Atrophy Nitrogen Obstetric Delivery Oligonucleotide Primers Pentetic Acid Phosphates Plasma PPIB protein, human Prospective Payment Assessment Commission Real-Time Polymerase Chain Reaction Retention (Psychology) Reverse Transcription RNA, Messenger RNA, Small Interfering RNA-Induced Silencing Complex RNA Interference Sodium Chloride Solvents Stem, Plant STS protein, human Sulfhydryl Compounds Sulfoxide, Dimethyl TFRC protein, human Tissues Transferrin tris(2-carboxyethyl)phosphine Tromethamine
2
Theoretical and Experimental Mass Analysis of His-tagged Proteins
The theoretical oxidized monoisotopic molecular weight (MtheorOx) of the His‐tag YebF constructs in dalton (Da) was calculated using the ExPaSy Compute pI/Mw ‐tool (Gasteiger et al., 2005 (link)) (Table 2). The molecular weights of purified protein samples were measured by electrospray ionization mass spectrometry combined with liquid chromatography (LC‐ESI‐MS) using a Q Exactive Plus Mass Spectrometer. The protein samples were mixed with trifluoroacetic acid (TFA) to a final concentration of 0.5% before analysis. For N‐ethylmaleimide (NEM)‐trapped samples the protein was incubated with 20 mM NEM in 50 mM phosphate buffer pH 7.3 with 6 M guanidine‐HCl for 10 min and quenched with 0.5% TFA before analysis.
Arauzo‐Aguilera K., Saaranen M.J., Robinson C, & Ruddock L.W. (2023). Highly efficient export of a disulfide‐bonded protein to the periplasm and medium by the Tat pathway using CyDisCo in Escherichia coli. MicrobiologyOpen, 12(2), e1350.
Full text: Click here
Publication 2023
Buffers Ethylmaleimide Guanidine Phosphate Liquid Chromatography Proteins Spectrometry, Mass, Electrospray Ionization Trifluoroacetic Acid
3
Aerobic vs. Anaerobic E. coli Proteomics
Proteomics analysis of aerobic versus nonaerobic E. coli cultures was carried out on MG1655 (K12) in LB media at 37 C. Four replicate cultures were started with a 5 μL inoculation from an overnight culture and grown under an atmosphere of nitrogen or ambient air until harvest at mid-log phase (0.4 OD for the aerobic samples and 0.3 OD for anaerobic samples). Cells were pelleted using centrifugation and proteins extracted immediately. The cell pellets were resuspended in 0.1 M Tris–HCL pH 7.5 buffer with 8 M urea and subjected to three freeze/thaw cycles in liquid Nitrogen, followed by ultrasonication for 5 min (Biologix -Model 13,000). Samples were centrifuged and the resulting supernatant was removed and proteins precipitated from it using ice cold acetone and stored at – 20 C for 1 h. The precipitated proteins were centrifuged, the supernatant was removed and the protein pellet was resuspended in 0.1 M Tris–HCL pH 6.8, 5 um EDTA, 50 mM N-ethylmaleimide in 6 M urea. This sample was transferred to a 3 K MWCO Nanosep centrifuge device and a modified FASP digestion was carried out. The sample was reduced with an excess of DTT and alkylated using 50 mM Iodoacetamide. The samples were washed four times with 50 mM ammonium bicarbonate pH 7.8 and then digested using sequencing grade Trypsin at a 20:1 protein: protease ration for 18 h. Samples were run on a Dionex Ultimate 3000 Nano UHPLC equipped with an Acclaim PepMap 100 C18 trap column (100 μm × 2 cm) and an Acclaim PepMap RSLC C18 (75 μm × 50 cm, C18 2 μM 100A) for separation. Mobile phase A was 0.1% formic acid in HPLC grade water and B was 80/20 acetonitrile: water. Peptides were separated at 0.6 nL/min. using a linear solvent gradient from 3–30% B over 120 min. The LC system was coupled with a Bruker maXis Impact with captive spray ESI mass spectrometer was used for data collection of spectra from 150 to 1750 m/Z at a maximum rate of 2 Hz for precursor and fragment spectra with adaptive acquisition for highly abundant ions. Data dependent MS/MS was used to collect sequence information on the 5 most abundant ion per full scan. Data analysis was done using MaxQuant (v1.6.4.0) and Perseus (v1.6.4.10).
Steward K.F., Refai M., Dyer W.E., Copié V., Lachowiec J, & Bothner B. (2023). Acute stress reduces population-level metabolic and proteomic variation. BMC Bioinformatics, 24, 87.
Full text: Click here
Publication 2023
Acclimatization Acetone acetonitrile ammonium bicarbonate Atmosphere Bacteria, Aerobic Cells Centrifugation Cold Temperature Digestion DNA Replication Edetic Acid Escherichia coli Ethylmaleimide formic acid Freezing High-Performance Liquid Chromatographies Iodoacetamide Medical Devices Nitrogen Pellets, Drug Peptide Hydrolases Peptides Proteins Radionuclide Imaging Solvents Tandem Mass Spectrometry Tromethamine Trypsin Urea Vaccination
4
Characterization of DUSP14, ACOX1, and β-Catenin
Proteasome inhibitor MG132 (HY-13259), Nutlin-3 (HY-50696), Cytarabine (HY-13605), BMS-536924 (HY-10262), AZ628 (HY-11004), and palmitic acid (HY-N0830) were purchased from MedChemExpress. Cycloheximide (R750107), Hydroxylamine (HAM, 467804), 2-BP (238422), and DAPI (D9542) were purchased from Sigma-Aldrich. iCRT14 (sc-362746) was purchased from Santa Cruz. A dual-luciferase reporter assay kit (DL-101-01) was purchased from Vazyme. N-Ethylmaleimide (NEM, A600450-0005) and BMCC-biotin ((1-Biotinamido)-4-[4′-(maleimidomethyl)cyclohexanecarboxamido]hexane, C100222-0050) were purchased from Sangon Biotech. Human palmitic acid ELISA kits (MM-51627H2) were purchased from MeiMian (Jiangsu, China). Anti-Flag agarose beads (23101) and Nu-7441 (503468-95-9) were purchased from Selleck (Houston, USA). RNase A (CW2105) was purchased from CWBIO. All antibodies used in this study are indicated in Supplementary Table S4. The human DUSP14, ACOX1, CTNNB1, and c-Myc coding sequences were amplified from HEK293T cDNA and cloned into pCMV-HA and pHAGE-CMV-MCS-PGK vectors. The human GSK3β and CK1 coding sequences were amplified from HEK293T cDNA and cloned into the pHAGE-CMV-MCS-PGK vector. The human ACOX1-TBE and DUSP14-RE were amplified from HCT15 gDNA and cloned into the pGL3-basic luciferase vector. The mouse ACOX1 coding sequence was amplified from mouse colon cDNA and cloned into pCDH-CMV-MCS-EF1-GFP+Puro vector. Mutations in the DUSP14, ACOX1, β-catenin, and Ubiquitin cDNAs were generated by overlap extension PCR. Deletion mutants from DUSP14 and ACOX1 were cloned into the pHAGE-CMV-MCS-PGK vector. Human DUSP14, CTNNB1, ACOX1, and mouse Acox1 shRNAs were designed and synthesized by RuiBiotech (Guangzhou, China), subsequently annealed, and inserted into the pLKO.1-puro vector. All primers for construction are presented in Supplementary Table S5.
Zhang Q., Yang X., Wu J., Ye S., Gong J., Cheng W.M., Luo Z., Yu J., Liu Y., Zeng W., Liu C., Xiong Z., Chen Y., He Z, & Lan P. (2023). Reprogramming of palmitic acid induced by dephosphorylation of ACOX1 promotes β-catenin palmitoylation to drive colorectal cancer progression. Cell Discovery, 9, 26.
Full text: Click here
Publication 2023
Antibodies Bacteriophages Biological Assay Biotin BMS 536924 Cloning Vectors Colon CTNNB1 protein, human Cycloheximide Cytarabine DAPI Deletion Mutation DNA, Complementary Endoribonucleases Enzyme-Linked Immunosorbent Assay Ethylmaleimide Exons GSK3B protein, human Homo sapiens Hydroxylamines iCRT14 Luciferases MG 132 Mice, House Mutation n-hexane NU 7441 nutlin 3 Oligonucleotide Primers Oncogenes, myc Open Reading Frames Palmitic Acid Paragangliomas 3 Plasmids Proteasome Inhibitor Sepharose Short Hairpin RNA Ubiquitin
5
Palmitoylation Detection in HEK-293T Cells

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
1-biotinamido-4-(4'-(maleimidomethyl)cyclohexanecarboxamido)butane Buffers Cell Extracts Ethylmaleimide HEK293 Cells Hydroxylamine Palmitoylation Resins, Plant Streptavidin

Top products related to «Ethylmaleimide»

1
N ethylmaleimide by Merck Group
Sourced in United States, Germany, Switzerland, Italy, United Kingdom, China, Sao Tome and Principe, France
N-ethylmaleimide is a chemical compound used in various laboratory applications. It functions as a reagent for the selective modification of sulfhydryl groups in proteins and peptides.
2
N ethylmaleimide nem by Merck Group
Sourced in United States, China, Italy
N-ethylmaleimide (NEM) is a chemical compound commonly used as a laboratory reagent. It is a colorless crystalline solid that is soluble in organic solvents. NEM is primarily used as a blocking agent for sulfhydryl groups in proteins, which can aid in the study of protein structure and function.
3
Protease inhibitor cocktail by Roche
Sourced in United States, Switzerland, Germany, China, United Kingdom, France, Canada, Japan, Italy, Australia, Austria, Sweden, Spain, Cameroon, India, Macao, Belgium, Israel
Protease inhibitor cocktail is a laboratory reagent used to inhibit the activity of proteases, which are enzymes that break down proteins. It is commonly used in protein extraction and purification procedures to prevent protein degradation.
4
Complete protease inhibitor cocktail by Roche
Sourced in United States, Germany, Switzerland, United Kingdom, China, France, Japan, Canada, Spain, Belgium, Australia, Sweden, Italy, Ireland, Macao
The Complete Protease Inhibitor Cocktail is a laboratory product designed to inhibit a broad spectrum of proteases. It is a concentrated solution containing a mixture of protease inhibitors effective against a variety of protease classes. This product is intended to be used in research applications to preserve the integrity of target proteins by preventing their degradation by proteolytic enzymes.
5
Protease inhibitor cocktail by Merck Group
Sourced in United States, Germany, China, United Kingdom, Italy, Japan, Sao Tome and Principe, France, Canada, Macao, Switzerland, Spain, Australia, Israel, Hungary, Ireland, Denmark, Brazil, Poland, India, Mexico, Senegal, Netherlands, Singapore
The Protease Inhibitor Cocktail is a laboratory product designed to inhibit the activity of proteases, which are enzymes that can degrade proteins. It is a combination of various chemical compounds that work to prevent the breakdown of proteins in biological samples, allowing for more accurate analysis and preservation of protein integrity.
6
Mg132 by Merck Group
Sourced in United States, Germany, China, United Kingdom, Macao, Sao Tome and Principe, France, Canada, Italy, Switzerland, Morocco, Belgium, Japan, Sweden, Australia, Austria, Israel, Spain
MG132 is a proteasome inhibitor, a type of laboratory reagent used in research applications. It functions by blocking the activity of the proteasome, a complex of enzymes responsible for the degradation of proteins within cells. MG132 is commonly used in cell biology and biochemistry studies to investigate the role of the proteasome in various cellular processes.
7
Dithiothreitol (dtt) by Merck Group
Sourced in United States, Germany, United Kingdom, Italy, Sao Tome and Principe, France, China, Switzerland, Macao, Spain, Australia, Canada, Belgium, Sweden, Brazil, Austria, Israel, Japan, New Zealand, Poland, Bulgaria
Dithiothreitol (DTT) is a reducing agent commonly used in biochemical and molecular biology applications. It is a small, water-soluble compound that helps maintain reducing conditions and prevent oxidation of sulfhydryl groups in proteins and other biomolecules.
8
N ethylmaleimide by Thermo Fisher Scientific
Sourced in United States
N-ethylmaleimide is a versatile chemical reagent used in various laboratory applications. It is a colorless to pale yellow crystalline solid with a maleimide functional group. N-ethylmaleimide is commonly used as a modifying agent for thiol (-SH) groups in proteins and peptides, allowing for the study of protein structure and function.
9
Bovine serum albumin (bsa) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico
Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.
10
Iodoacetamide by Merck Group
Sourced in United States, Germany, United Kingdom, Sao Tome and Principe, Italy, France, Macao, China, Canada, Australia, Switzerland, Spain
Iodoacetamide is a chemical compound commonly used in biochemistry and molecular biology laboratories. It is a reactive compound that selectively modifies cysteine residues in proteins, thereby allowing for the study of protein structure and function. Iodoacetamide is often used in sample preparation procedures for mass spectrometry and other analytical techniques.

More about "Ethylmaleimide"