The largest database of trusted experimental protocols

GDC 0941

GDC 0941 is a potent and selective inhibitor of the phosphoinositide 3-kinase (PI3K) signaling pathway.
It has demonstrated efficacy in preclinical models of various cancers by blocking tumor growth and survival.
GDC 0941 inhibits multiple PI3K isoforms, including PI3Kα, PI3Kβ, PI3Kδ, and PI3Kγ, making it a promising therapeutic agent for targeting the PI3K/Akt/mTOR axis, which is frequently dysregulated in human malignancies.
Reseachers can use PubCompare.ai's AI-driven protocol comparison to locate the best available protocols for studying the anticancer effects of GDC 0941 and enhancing the reproducibility of their research.

Most cited protocols related to «GDC 0941»

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2017
1,3-dihydro-1-(1-((4-(6-phenyl-1H-imidazo(4,5-g)quinoxalin-7-yl)phenyl)methyl)-4-piperidinyl)-2H-benzimidazol-2-one AKT1 protein, human AZD6482 AZD8055 Chir 99021 EIF4EBP1 protein, human FRAP1 protein, human GDC 0941 Genes Glycogen Synthase Kinase 3 Hypersensitivity inhibitors Malignant Neoplasm of Breast Malignant Neoplasms Mechanistic Target of Rapamycin Complex 1 MK 2206 MTOR Inhibitors Mus Neoplasms NVP BEZ235 Pharmaceutical Preparations Phosphoproteins PIK3CG protein, human PTEN Phosphohydrolase PTEN protein, human Ribosomal Protein S6 Kinases, 70-kDa Sirolimus temsirolimus Tissues Transcription, Genetic Tuberous Sclerosis 2
Mouse His6-p110β(1-1064)/p85β-icSH2(423-722) complex was diluted to 4 mg/ml, mixed with 20 mM (final concentration) sodium phenyl phosphate (Sigma P-7751) and 150 μM of the PI3K inhibitor GDC0941 (Folkes et al., 2008 (link)). The initial crystallization conditions were obtained from a broad screen of 1056 conditions (Stock et al., 2005 (link)) in 96-well MRC crystallization plates (SWISSCI AG, Zug, Switzerland). Additives (GDC0941 and phenyl phosphate) were identified by differential scanning fluorimetry (see Supplemental Experimental Procedures). Optimal crystals were obtained at 22°C in hanging drops over reservoirs of 24-well plates (Hampton Research, Aliso Viejo, CA) containing 12% polyethylene glycol 3350, 0.1 M potassium citrate at pH 6, and 0.4 M lithium sulfate. The drops contained 1 μl each of protein and reservoir solutions. The crystals were cryoprotected by stepwise addition of cryoprotectants consisting of the reservoir solution with 20 mM sodium phenyl phosphate, 150 μM of GDC0941, and an increasing concentration of glycerol up to 20% (in 5% increments). Crystals were flash frozen in liquid nitrogen.
Full text: Click here
Publication 2011
Cryoprotective Agents Crystallization Fluorometry Freezing GDC 0941 Glycerin lithium sulfate Nitrogen p110beta, mouse Phosphates PIK3CB protein, human polyethylene glycol 3350 Potassium Citrate Proteins sodium phosphate
Fresh Her2+ and TN human tumor samples were acquired from patients undergoing resection of breast to brain metastases, in accordance with a City of Hope Institutional Review Board (IRB)-approved protocol (IRB #05091). A portion of each specimen was cultured in DMEM-F12 (Life Technologies) supplemented with 10% fetal bovine serum (FBS), 1% glutamax, and 1% Anti-Anti (Life Technologies) in collagen-coated (Life Technologies) T75 flasks to derive low-passage primary cell lines (COH-BBM1 (BBM1), and COH-BBM2 (BBM2) and COH-BBM3 (BBM3)) [19 (link)]. Established breast cancer cell lines MDA-MB-361 (361), BT474 and SkBr3 cells were also cultured in the aforementioned DMEM-F12 in T75 flasks. All cells were maintained at 37 °C and 5% CO2.
To obtain conditioned medium from astrocytes and fibroblasts, cells were grown in serum-free DMEM for 24 h before collecting and purifying the medium by centrifugation (4000 × g, 15 minutes). For growth in conditioned medium, BBM cells were first grown for 24 h in serum-free DMEM. The growth medium was removed and the cells were washed once with fresh DMEM before adding the conditioned medium. Cells were grown for differing amounts of time in the conditioned medium, as indicated for specific experiments. For treatment with BDNF, lapatinib, cyclotraxin B, XL 147 or GDC0941, cells were grown overnight in serum-free mediuma before treatment with BDNF, lapatinib and cyclotraxin B for various time periods. For details on materials and methods please see Additional file 1.
Full text: Click here
Publication 2017
Astrocytes Brain Metastases Breast Cell Lines Cells Centrifugation Collagen Culture Media Culture Media, Conditioned cyclotraxin-B ERBB2 protein, human Ethics Committees, Research Fetal Bovine Serum Fibroblasts GDC 0941 Homo sapiens Lapatinib MCF-7 Cells Neoplasms Patients Serum XL147
All animal experiments were done in accordance with local and national United Kingdom Co-ordinating Committee on Cancer Research guidelines (35 ). Female BALB/c mice (6-8 wk old; Charles River) were dosed i.v. and p.o. with 10 mg/kg PI-540 or PI-620 (free base) in 10% DMSO-0.5% Tween 20 in saline (10 mL/kg), which did not cause hemolysis. Blood was collected after serial bleeding and centrifuged, and the plasma was frozen at -80°C. Tissues were snap frozen in dry ice and kept at -80°C until analysis. Quantitative analysis was done by liquid chromatography tandem mass spectrometry using multiple reaction monitoring, as described previously (29 (link)). Pharmacokinetic linearity was examined following i.p. administration of 25, 50, and 100 mg/kg PI-540 (dimesylate salt) and 12.5, 25, and 50 mg/kg PI-620 (HCl salt) in water. GDC-0941 (dimesylate salt) was administered p.o. at 50 mg/kg to female CrTac:Ncr-Fox1 (nu) athymic mice bearing established U87MG human glioblastoma xenografts (see below). Sampling and analysis were done as detailed above.
Publication 2009
BLOOD Dry Ice Females Freezing GDC 0941 Glioblastoma Hemolysis Heterografts Homo sapiens Liquid Chromatography Malignant Neoplasms Mice, Inbred BALB C Mice, Nude PI 540 PI 620 Plasma Rivers Saline Solution Sodium Chloride Sulfoxide, Dimethyl Tandem Mass Spectrometry Tissues Tween 20
Human bronchial epithelial cell line HBE cells were cultured in RPMI 1640 supplemented with penicillin (100 U/ml), streptomycin (100 mg/ml), and 10% heat inactivated fetal bovine serum (FBS). Lipopolysaccharide(LPS, Escherichia coli, 055:B5)was purchased from Sigma (Missouri, USA). Interferon-γ was purchased from R&D Systems (Minnesota, USA). PI3K/Akt/mTOR inhibitors (GDC0941, GSK690693, BEZ235, LY294002 and CAL101) were purchased from Biovision (California, USA). SHBM1009 (a new PI3K/mTOR inhibitor) was synthesized by Fudan University. CEACAM1 and GAPDH antibodies for western blot were purchased from Abcam (Hong Kong, China). SYBR Premix Ex Taq was from TaKaRa (Shiga, Japan). Lipofectamine™ 2000 Transfection Reagent was from Invitrogen (Grand Island, NY, USA).
Full text: Click here
Publication 2019
Antibodies BEZ235 biliary glycoprotein I Bronchi CAL 101 Cell Lines Epithelial Cells Escherichia coli Fetal Bovine Serum GAPDH protein, human GDC 0941 GSK690693 Homo sapiens Interferon Type II lipofectamine 2000 LY 294002 MTOR Inhibitors Penicillins Phosphatidylinositol 3-Kinases Streptomycin Transfection Western Blot

Most recents protocols related to «GDC 0941»

LDH Cytotoxicity assay was performed using Pierce LDH cytotoxicity assay kit (Thermo scientific 88,954) according to manufacturer’s instructions. Briefly, the optimal number of cells (1 × 105 cells/ml) were seeded in 100 μl of RPMI medium in triplicate wells in a 96-well tissue culture plate. A complete medium control without cells was used to determine LDH background activity present in sera used for media supplementation. A serum-free media control was included to determine the amount of LDH activity in sera. Additional cells were plated in triplicate wells for spontaneous LDH activity controls (water) and maximum LDH activity controls (10X Lysis Buffer). The plate was incubated in an incubator at 37°C, 5% CO2 for 30 min. To the set of triplicate wells serving as the maximum LDH activity controls, 10 μl of lysis buffer (10X) was added, and mixed by gentle tapping. Different concentrations of glucose (5 mM and 15 mM), and inhibitors AZD6244 (10 μM), GDC0941 (2 μM), GDC0068 (2 μM), were added to cells. The plate was again incubated in an incubator at 37°C, 5% CO2 for 45 min. Each sample medium (50 μl) (e.g., complete medium, serum-free medium, Spontaneous LDH Activity Controls, glucose-treated, inhibitors-treated and Maximum LDH Activity Controls) was added to a 96-well flat-bottom plate in triplicate wells. Reaction mixture (50 μl) was transferred to each sample well and mixed using a multichannel pipette. The plate was incubated at room temperature for 30 min protected from light. Stop solution (50 μl) was added to each sample well and mixed by gentle tapping. The absorbance was measured at 490 nm and 680 nm. To determine LDH activity, the 680 nm absorbance value (background) was subtracted from the 490 nm absorbance before calculation of % cytotoxicity [(LDH at 490 nm) − (LDH at 680 nm)]. The % cytotoxicity was calculated as follows:
% Cytotoxicity = Glucose/inhibitors-treated LDH activity − Spontaneous LDH activity/Maximum LDH activity − Spontaneous LDH activity × 100.
Full text: Click here
Publication 2023
AZD 6244 Biological Assay Buffers Cells Culture Media, Serum-Free Cytotoxin GDC-0068 GDC 0941 Glucose inhibitors Light Serum Tissues

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
Cells GDC 0941 HL-60 Cells Mitogen-Activated Protein Kinase p38 Neutrophil PD-L1 Inhibitors Phosphatidylinositol 3-Kinases SB 203580 SP600125 Zymosan
The synergy of drug combinations was evaluated in the mouse 5746 and TM31 glioma cell lines. The 17 glioma cell line was used for the PTC596/Trametinib combination as this combination showed limited sensitivity than the 5746 line (S2 Table). Cell lines were plated in 96-well plates and processed as described in the spheroid or 2D drug screening assays. We created a dilution series of our drug combinations (7 dilutions of the drug of interest, 5 dilutions of Trametinib or GDC-0941). On Day 0, Trametinib, GDC-0941, Bortezomib, Dinaciclib, JQ1, LY2606368, PTC596, or Vorinostat were added in a serial dilution per row in duplicate. We used the percent viability compared to untreated cells to calculate a synergy score for each of the analyzed combinations (https://synergyfinder.fimm.fi/; parameters: LL4 curve fit, ZIP method for synergy score calculation).
Full text: Click here
Publication 2023
Biological Assay Bortezomib Cell Lines Cells dinaciclib Drug Combinations GDC 0941 Glioma Hypersensitivity LY2606368 Mus Pharmaceutical Preparations PTC596 Technique, Dilution trametinib Vorinostat
To characterize our mouse glioma cell lines, a genotyping PCR for Nf1 (primers: Nf1-wt-F: GGTATTGAATTGAAGCAC, Nf1-R: TTCAATACCTGCCCAAGG, Nf1-mut-F: ATTCGCCAATGACAAGAC) and Tp53 (primers: Tp53-wt-F: AGGCTTAGAGGTGCAAGCTG, Tp53-R: TGGATGGTGGTATACTCAGAGC, Tp53-mut-F: CAGCCTCTGTTCCACATACACT) was performed [11 (link)]. The reported ATRX mutation (E2281*, PCR primers: GAACATGATTCTCTTTTGGACCAC and ACCTGTTTCAAATGTGACCCTTT and sequencing primer GGATACCATACTTGCAGAGC) and NF1 mutation (p.LF1247fs18*, primers: AATAAAAATGGGATTGTTTG and GGAAGAGAGTCTGCATGGAG) in the TM-31 cell line was confirmed by sequencing. Western blot was performed to evaluate the expression of OPC lineage markers and for the expression of TP53 and CDKN2A in TM-31. Target inhibition of the drugs that caused potent cell death in our glioma lines inhibited was evaluated by western blot as well. Glioma cell line 17 was treated for 24h with 20nM Trametinib, 1μM GDC-0941, 5nM bortezomib, 25nM Dinaciclib, 500nM JQ1, 100nM LY2606368, 500nM PTC596, or 1μM Vorinostat and target inhibition was evaluated by comparing the expression levels of pERK, pAKT, Ubiquitin, pS2 RNApol II and CDK9, MYC, pCHEK1, BMI1 and H3K27Ac respectively.
Full text: Click here
Publication 2023
Alpha Thalassemia X-Linked Intellectual Disability Syndrome BMI1 protein, human Bortezomib CDK9 protein, human CDKN2A Gene Cell Death Cell Lines dinaciclib Drug Delivery Systems GDC 0941 Glioma LY2606368 Mus Mutation Oligonucleotide Primers Psychological Inhibition PTC596 TP53 protein, human trametinib Ubiquitin Vorinostat Western Blot
Two thousand cells/well of 17, 5653, or 5746 glioma cell lines are plated in 96-well round-bottomed ultra-low attachment plates (MS9096UZ, S-bio, Hudson, NH) and used for spheroid drug screening. Cells are plated in 100uL of complete culture media, centrifuged (90g, 5min) and incubated overnight to stimulate a single colony from forming at the bottom of the round well. Twenty-one drugs were screened, using three concentrations (see S2 Table, in triplicate) and prepared in NeuroCult media. All drugs were combined with DMSO, a single concentration of Trametinib (10nM), or a single concentration GDC0941 (1000nM for 17 and 5746, 500nM for 5653). For each cell line, these concentrations of Trametinib and GDC-0941 were chosen to be below the Half Maximal Inhibitory Concentration (IC50) value, in order to discern the maximum cooperativity between drug combinations. The final volume of media for each well is 150ul. Each concentration of a drug combination was evaluated in triplicate, including the DMSO controls. The total integrated intensity of RFP was monitored over the course of 72 hours, taking measurements every 2 hours with the Incucyte® S3 Live-Cell Analysis System (Sartorius, Gottingen, Germany) and serve as a proxy for the number of cells present. Analysis parameters are listed in S3 Table.
Full text: Click here
Publication 2023
Cell Lines Cells Culture Media Drug Combinations GDC 0941 Glioma Pharmaceutical Preparations Psychological Inhibition Sulfoxide, Dimethyl trametinib

Top products related to «GDC 0941»

Sourced in United States
GDC-0941 is a selective phosphoinositide 3-kinase (PI3K) inhibitor. It inhibits the PI3K pathway, which is involved in cellular growth, proliferation, and survival. The product is intended for research use only.
Sourced in United States, China, United Kingdom, Germany
MK-2206 is a selective allosteric Akt inhibitor that binds to the pleckstrin homology (PH) domain of Akt and inhibits its phosphorylation and activation. It has been used in research applications to study the role of Akt signaling in various cellular processes.
Sourced in United States
GDC-0941 is a potent and selective inhibitor of phosphoinositide-3-kinase (PI3K). It inhibits the catalytic activity of the p110α, p110β, p110δ, and p110γ isoforms of PI3K. GDC-0941 is a small molecule compound used for research purposes.
Sourced in United States
GDC-0941 is a laboratory reagent used for research purposes. It is a potent and selective inhibitor of the PI3 kinase pathway. The core function of GDC-0941 is to enable the study of the PI3 kinase signaling cascade and its role in cellular processes.
Sourced in United States, Germany
BYL719 is a laboratory equipment product. It is a device designed for use in scientific research and analysis. The core function of BYL719 is to facilitate the measurement and processing of chemical or biological samples. No further details about its intended use or application can be provided while maintaining an unbiased and factual approach.
Sourced in United States, Germany, United Kingdom, France, China, Italy
Trametinib is a selective inhibitor of mitogen-activated protein kinase kinase (MEK) enzymes 1 and 2. It is a white to almost white crystalline powder that is used in various biomedical research applications.
Sourced in United States, Germany
BKM120 is a lab equipment product that functions as a Class I phosphoinositide 3-kinase (PI3K) inhibitor. It exhibits selectivity for the p110α isoform of PI3K.
Sourced in United States
GDC-0941 is a potent and selective inhibitor of the PI3 kinase (PI3K) enzyme. It targets the p110α, p110β, p110δ, and p110γ isoforms of PI3K. GDC-0941 is a small molecule compound used for research purposes.
Sourced in United States
Pictilisib is a laboratory equipment product manufactured by Selleck Chemicals. It is a selective inhibitor of the phosphoinositide 3-kinase (PI3K) enzyme. Pictilisib is used in various research applications, but its core function is to serve as a tool for studying the role of the PI3K signaling pathway in cellular processes.
Sourced in United States, Germany, China
AZD8055 is a small molecule inhibitor that targets the serine/threonine protein kinase mTOR (mammalian target of rapamycin). It functions as an ATP-competitive inhibitor of mTOR, affecting both mTORC1 and mTORC2 complexes.

More about "GDC 0941"

GDC-0941 is a potent and selective inhibitor of the phosphoinositide 3-kinase (PI3K) signaling pathway, which plays a crucial role in tumor growth and survival.
This small-molecule inhibitor has demonstrated efficacy in preclinical models of various cancers, such as breast, prostate, and lung, by effectively blocking the PI3K/Akt/mTOR axis - a key pathway that is frequently dysregulated in human malignancies.
GDC-0941 inhibits multiple PI3K isoforms, including PI3Kα, PI3Kβ, PI3Kδ, and PI3Kγ, making it a promising therapeutic agent for targeting the PI3K signaling cascade.
This broad-spectrum inhibition of the PI3K pathway sets GDC-0941 apart from more selective PI3K inhibitors like MK-2206 (Akt inhibitor), BYL719 (PI3Kα inhibitor), and Trametinib (MEK inhibitor), as well as pan-PI3K inhibitors like BKM120 (Buparlisib), Pictilisib (GDC-0941), and AZD8055 (mTOR inhibitor).
Researchers can leverage PubCompare.ai's AI-driven protocol comparison tool to identify the most effective and reproducible experimental protocols for studying the anticancer effects of GDC-0941.
This innovative platform makes it easy to locate the best available protocols from the literature, preprints, and patents, enhancing the overall quality and consistency of your research.