Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Gefitinib

Gefitinib

Gefitinib is a tyrosine kinase inhibitor used in the treatment of non-small cell lung cancer.
It works by blocking the activity of the epidermal growth factor receptor (EGFR), which is often overexpressed in certain types of cancer cells.
Gefitinib has been shown to be effective in patients with EGFR-mutant non-small cell lung cancer, and is approved for use in this patient population.
PubCompare.ai can help researchers find the optimal Gefitinib protocols from scientific literature, preprints, and patents, enhancing protocol reproducibility and research accruacy to ensure reliable and effective results.

Most cited protocols related to «Gefitinib»

1
Structural Protein Docking with Vina
Cited 15 times
The crystal structures of MAPK2K (PDB:3FXW), FGF (PDB: 1IJT), the mTORdeltaN-mLST8 complex (PDB: 4JSN), tumor growth factor beta1 (PDB:1KLC), EGFR kinase (T790M/L858R) apo (PDB: 5EDP), and iNOS (PDB:2BHJ) were obtained from the Protein Data Bank (https://www.rcsb.org/ ) in protein data bank (PDB) file format and subsequently converted into the Auto Dock Pdbqt format using AutoDock Vina (vers. 0.8, the Scripps Research Institute, La Jolla, CA, USA) (35 (link)). The three-dimensional (3D) structure of NSC765598 was built out with the Avogadro molecular builder and visualization tool vers. 1.XX (http://avogadro.cc/) (36 (link)). The structure was retrieved in mol2 file format and was subsequently transformed into PDB format using the PyMOL Molecular Graphics System, vers. 1.2r3pre (Schrödinger; https://pymol.org/edu/?q=educational/) followed by conversion to pdbqt. The three-dimensional (3D) structures of standard drugs; Dactolisib (CID: 11977753), Mirdametinib (CID: 9826528), Gefitinib (CID: 123631), N-Iminoethyl-l-lysine dihydrochloride (CID: 2733505), Erdafitinib (CID: 67462786), and Galunisertib (CID: 10090485) were retrieved in SDF file format from the PubChem database and subsequently converted to PDB format using the PyMOL tool and then to pdbqt format using the AutoDock Vina. Receptors were prepared by pre-docking removal of water (H20) molecules, the addition of hydrogen atoms (polar only), and the addition of Kolmman charges (8 (link)). Molecular docking was performed using AutoDock Vina with all parameters set to default values, and all bonds in the ligand rotated freely while considering the receptor to be rigid. A grid box of 40 × 40 × 40 Å at X, Y, and Z dimensions and a spacing of 1.0 angstrom were used. All docking was performed at an exhaustiveness of 8. The docking outcome was analyzed in terms of the ligand’s affinity for the receptor and was expressed as binding energy values in Kcal/mol. The interactions in 2D conformation were visualized using the Discovery studio visualizer vers. 19.1.0.18287 (BIOVIA, San Diego, CA, USA) (37 ), while the hydrophobic contacts between the receptor-ligand complex were mapped out using the protein-ligand interaction profiler web tool (https://plip-tool.biotec.tu-dresden.de/plip-web/plip/index) (38 (link)).
Lawal B., Lee C.Y., Mokgautsi N., Sumitra M.R., Khedkar H., Wu A.T, & Huang H.S. (2021). mTOR/EGFR/iNOS/MAP2K1/FGFR/TGFB1 Are Druggable Candidates for N-(2,4-Difluorophenyl)-2′,4′-Difluoro-4-Hydroxybiphenyl-3-Carboxamide (NSC765598), With Consequent Anticancer Implications. Frontiers in Oncology, 11, 656738.
Full text: Click here
Publication 2021
dactolisib EGFR protein, human erdafitinib galunisertib Gefitinib Growth Factor Hydrogen Ligands Lysine mirdametinib MLST8 protein, human Muscle Rigidity Neoplasms NOS2A protein, human Pharmaceutical Preparations Phosphotransferases Proteins Versed
2
Gefitinib Sensitivity Prediction Protocol
Cited 14 times
A published expression signature that predicted gefitinib sensitivity based on baseline gene expression in non-small cell lung cancer cell lines [33] (link) was used to assign predicted gefitinib sensitivity scores to tumors. The published gefitinib overexpressed genes and underexpressed genes were combined to define a gefitinib sensitivity score for each tumor: , where o and u represent expression of the overexpressed and underexpressed genes, respectively, and n represents the gene total. Increasing scores indicate increasing sensitivity.
Computational procedures were executed using R (http://www.r-project.org) and Bioconductor libraries (http://www.bioconductor.org ) unless otherwise specified.
Wilkerson M.D., Yin X., Walter V., Zhao N., Cabanski C.R., Hayward M.C., Miller C.R., Socinski M.A., Parsons A.M., Thorne L.B., Haithcock B.E., Veeramachaneni N.K., Funkhouser W.K., Randell S.H., Bernard P.S., Perou C.M, & Hayes D.N. (2012). Differential Pathogenesis of Lung Adenocarcinoma Subtypes Involving Sequence Mutations, Copy Number, Chromosomal Instability, and Methylation. PLoS ONE, 7(5), e36530.
Full text: Click here
Publication 2012
Gefitinib Gene Expression Genes Hypersensitivity Neoplasms Non-Small Cell Lung Carcinoma
3
Generating Drug-Tolerant Tumor Cell Populations
Cited 12 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2010
Cells Cisplatin Clone Cells Culture Media Erlotinib Gefitinib Hyperostosis, Diffuse Idiopathic Skeletal paraform Pharmaceutical Preparations
4
Establishment and Characterization of EGFR-Resistant NSCLC Cell Lines
Cited 9 times
The EGFR-mutant NSCLC cell lines, HCC827, PC-9 and gefitinib-resistant PC-9/GR (T790M), were provided by Dr. P. A. Jänne (Dana Faber Cancer Institute, Boston, MA) in 2009. The EGFR-wild type NSCLC cell lines, H226 and H596, were originally obtained from Dr. R. Lotan (M. D. Anderson Cancer Center, Houston, TX) in 2003. Erlotinib-resistant HCC827/ER and AZD9291-resistant HCC827/AR cell lines were established in our laboratory and described previously (14 (link),17 (link)). The AZD9291-resistant cell lines, PC-9/AR and PC-9/GR/AR, were newly established in our laboratory by exposing PC-9 or PC-9/GR cells to gradually increasing concentrations of AZD9291 (starting at 10 nM and ending with 500 nM) for approximately 6 months (Fig. S1). These cell lines were routinely cultured in the presence of 500 nM AZD9291 and maintained resistance to AZD9291 even after withdrawal of AZD9291 from the culture medium for over 6 months, indicating an irreversible phenotype. MET gene amplification and protein hyperactivation were detected in HCC827/ER and HCC827/AR cells (14 (link)). Using ICE COLD-PCR developed by Transgenomic, Inc (Omaha, NE), EGFR exon 20 T790M mutation was detected in PC-9/GR/AR cells. However, C797S mutation in EGFR exon 20 and other mutations around codon C797S region and in EGFR exon 21 were not detected in HCC827/AR, PC-9/AR and PC-9/GR/AR cells (Fig. S1). Moreover, no K-RAS exon 2 mutations were detected in these cell lines. HCC827/Mcl-1 and PC-9/Mcl-1 stable cell lines (pooled populations) were generated by infecting cells with lentiviruses carrying ectopic Mcl-1 or vector for 48 h followed with selection with zeocin (500 ng/ml) for another 7 days as described previously (18 (link)). PC-9 cell line with EGFR 19del+T790M+C797S triple mutation used in a previous study (12 (link))(we named it PC-9/3M) was kindly provided by Dr. A. N. Hata (Harvard Medical School, Boston, MA) on January of 2017. This cell line was resistant to AZD9291 as well as CO1686 and erlotinib (Fig. S2), thus confirming its resistance to these EGFR inhibitors. These cell lines were not genetically authenticated. Mycoplasma was detected annually or upon receiving using MycoAlert@ Mycoplasma Detection Kit (Lonza; Rockland, ME) to ensure mycoplasma negative. All cell lines were cultured in RPMI 1640 containing 5% fetal bovine serum at 37 °C in a humidified atmosphere of 5% CO2 and 95% air.
Shi P., Oh Y.T., Deng L., Zhang G., Qian G., Zhang S., Ren H., Wu G., Legendre B J.r., Anderson E., Ramalingam S.S., Owonikoko T.K., Chen M, & Sun S.Y. (2017). Overcoming acquired resistance to AZD9291, a third generation EGFR inhibitor, through modulation of MEK/ERK-dependent Bim and Mcl-1 degradation. Clinical cancer research : an official journal of the American Association for Cancer Research, 23(21), 6567-6579.
Publication 2017
Atmosphere AZD9291 Cell Lines Cells Cloning Vectors Codon Common Cold Culture Media EGFR protein, human Erlotinib Exons Fetal Bovine Serum Gefitinib Gene Amplification inhibitors KRAS protein, human Lentivirus Malignant Neoplasms Mutation Mycoplasma Non-Small Cell Lung Carcinoma Phenotype Population Group Proteins Zeocin
5
EGFR Mutation Analysis and Inhibitor Testing
Cited 9 times
Two numbering systems are used for EGFR. The first denotes the initiating methionine in the signal sequence as amino acid −24. The second, used here, denotes the methionine as amino acid +1. Commercial suppliers of antibodies, such as the Y1068-specific anti-phospho-EGFR, use the first nomenclature. To be consistent, we consider Y1068 as Y1092. Likewise, the T790M mutation reported here has also been called T766M. Mutations were introduced into full-length wild-type and mutant EGFR cDNAs using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, United States) and cloned into expression vectors as described [3 (link)]. The following primers were used to generate the deletion (del) L747–E749;A750P mutant: forward 5′-
TAAAATTCCCGTCGCTATCAAGGAGCCAACATCTCCGAAAGCCAACAAGG-3′ and reverse 5′-
CCTTGTTGGCTTTCGGAGATGTTGGCTCCTTGATAGCGACGGGAATTTTA-3′. The following primers were used to introduce the T790M mutation: forward 5′-
AGCTCATCATGCAGCTCAT-3′ and reverse 5′-
ATGAGCTGCATGATGAGCT-3′. The L858R mutant cDNA was generated previously [3 (link)]. All mutant clones were fully re-sequenced bidirectionally to ensure that no additional mutations were introduced. Various EGFRs were transiently expressed in 293T human embryonic kidney cells as published [3 (link)]. Cells were treated with different concentrations of gefitinib or erlotinib.
Pao W., Miller V.A., Politi K.A., Riely G.J., Somwar R., Zakowski M.F., Kris M.G, & Varmus H. (2005). Acquired Resistance of Lung Adenocarcinomas to Gefitinib or Erlotinib Is Associated with a Second Mutation in the EGFR Kinase Domain. PLoS Medicine, 2(3), e73.
Full text: Click here
Publication 2005
Amino Acids Antibodies Cells Clone Cells Cloning Vectors Deletion Mutation DNA, Complementary EGFR protein, human Embryo Erlotinib Gefitinib HEK293 Cells Homo sapiens Kidney Methionine Mutagenesis, Site-Directed Mutation Oligonucleotide Primers Signal Peptides

Most recents protocols related to «Gefitinib»

1
Synergistic Cytotoxicity of Gefitinib and DZ1-Simvastatin Amide
Not available on PMC !

Example 4

A Crystal Violet Staining of a human lung carcinoma cell line (H-1975, a cell line with EGFR mutations), is performed, exposing the cells to various concentrations of Gefitinib alone, in comparison to combined exposure with DZ1-Simvastatin amide. As shown in FIG. 4, Gefitinib is used in concentrations of 64, 32, 16, 8, 4, 2, 1, 0.5 and 0 uM (columns 1-6, row A), the same concentrations of Gefitinib are combined with DZ-Simvastatin Amide in a concentration of 5 uM (row B) and 6 uM (row C). The results show a dramatic increase and synergism of the cytotoxic effects of the TKI Gefitinib by combination with DZ1-Simvastatin amide in a concentration-dependent manner, see e.g. effect of 0.5 uM Gefitinib combined with 6 uM DZ1-SIM Amide.

US11878000B2. Compounds and methods to sensitize cancer cells to tyrosine kinase inhibitors (2024-01-23). Cedars-Sinai Medical Center [US], Da Zen Theranostics, Inc. [US]. Inventors: Liyuan Yin [US], Yi Zhang [US], Stefan Mrdenovic [HR], Gina Chia Yi Chu [US], Ruoxiang Wang [US], Qinghua Zhou [CN], Jian Zhang [US], Leland W. K. Chung [US].
Full text: Click here
Patent 2024
Amides Cell Lines EGFR protein, human Gefitinib Homo sapiens Lung Cancer Malignant Neoplasms Mutation Simvastatin Violet, Gentian
2
Investigating CD274 and BCL2L11 in EGFR-driven cancer
The HCC827 cell line was grown in RPMI-1640 medium (Thermo Fisher Scientific, Waltham, MA, USA) with supplement of 10% (v/v) fetal bovine serum (FBS) (Gibco; Life Technologies, Carlsbad, CA, USA) at 37 °C in an incubator with 5% carbon dioxide. The cells were maintained by monolayer culture and passaged twice or thrice per week. For siRNA transfection, HCC827 cells were cultured in a 6-cm dish. Thereafter, the cultured cells were washed once with sterile phosphate-buffered saline and the culture medium was supplemented with Lipofectamine (Dharmacon, Horizon Discovery, Lafayette, CO, USA) plus 100 nM of the ON-TARGETplus siRNA targeting CD274 or BCL2L11 (Dharmacon, Horizon Discovery, Lafayette, CO, USA). For drug treatment, gefitinib (Selleck Chemicals LLC, Houston, TX, USA) was dissolved in DMSO and diluted to the desired final concentrations with a growth medium immediately before administration. After 24-h transfection, the culture medium was replaced with a medium containing 1 μM or 5 μM gefitinib for the following 24 h.
Chu C.Y., Lin C.Y., Lin C.C., Li C.F., Wu S.Y., Tsai J.S., Yang S.C., Chen C.W., Lin C.Y., Chang C.C., Yen Y.T., Tseng Y.L., Su P.L, & Su W.C. (2023). Effect of BIM expression on the prognostic value of PD-L1 in advanced non-small cell lung cancer patients treated with EGFR-TKIs. Scientific Reports, 13, 3943.
Full text: Click here
Publication 2023
Carbon dioxide CD274 protein, human Cell Lines Cells Cultured Cells Fetal Bovine Serum Gefitinib Hyperostosis, Diffuse Idiopathic Skeletal Lipofectamine Pharmaceutical Preparations Phosphates RNA, Small Interfering Saline Solution Sterility, Reproductive Sulfoxide, Dimethyl Transfection
3
Cytotoxicity Evaluation of Cancer Drugs
For lung cancer cell lines, cells were seeded in 96‐well plates and incubated at 37 °C for 24 h. Then cells were incubated with 200 µL of medium containing increasing doses of the drugs gefitinib (Selleckchem Houston, TX), erlotinib (Selleckchem Houston, TX), afatinib (Selleckchem Houston, TX), crizotinib (Selleckchem Houston, TX), or cisplatin (Sigma‐Aldrich, St Louis, MO) for 72 h. To detect and calculate the half maximal inhibitory concentration (IC50), 5 mg mL−1 of (MTT) (Sigma‐Aldrich, St Louis, MO) was added and the mixture was incubated at 37 °C for 4 h. The absorbance was determined at 570 nm. For organoids assays, organoids were dissociated by mechanical shearing, strained through a 70 µm filter, resuspended using LOM medium containing 5% GFR‐BME, and finally 30 µL of suspension were seeded into 384‐well plate. Organoids were treated with increasing concentrations of drugs for 5 days. Cell viability was detected by Cell titer–Glo 2.0 assay kit (Promega) and luminescence were measured by a multifunctional reader. The drug response curve was plotted and IC50 was calculated using nonlinear regression model by GraphPad Prism 7.0.
Wang S., Chen J., Jiang Y., Lei Z., Ruan Y.C., Pan Y., Yam J.W., Wong M.P, & Xiao Z. (2023). Targeting GSTP1 as Therapeutic Strategy against Lung Adenocarcinoma Stemness and Resistance to Tyrosine Kinase Inhibitors. Advanced Science, 10(7), 2205262.
Full text: Click here
Publication 2023
Afatinib Biological Assay Cell Lines Cells Cell Survival Cisplatin Crizotinib Erlotinib Gefitinib Luminescence Lung Cancer Organoids Pharmaceutical Preparations prisma Promega Psychological Inhibition
4
Murine Model of Oropharyngeal Candidiasis
The virulence of the various C. albicans strains and the effects of gefitinib and SGX523 were determined using our standard mouse model of oropharyngeal candidiasis(Solis and Filler, 2012 (link); Swidergall et al., 2021 (link); Zhu et al., 2012 (link)). All studies were performed using male Balb/c mice that were randomly assigned to the different experimental groups. For studies with immunocompetent or phagocyte-depleted mice, the animals were inoculated with calcium alginate swabs that had been soaked in HBSS containing 2×107 organisms/ml and for experiments with mice that had been immunosuppressed with cortisone acetate, the animals were inoculated with calcium alginate swabs that had been soaked in HBSS containing 1×106 organisms/ml. These mice were administered gefitinib and/or SGX523 by adding it to powdered mouse chow at final concentrations of 200 ppm and 120 ppm, respectively, starting at day −1 relative to infection. To deplete the mice of phagocytes, they were administered 80 μg of an anti-GR-1 antibody (#BE0075; clone RB6–8C5, Bio X Cell) intraperitoneally on day −1 relative to infection. Control mice were injected with a similar dose of an isotype control antibody (#BE0090, Clone LTF-2, Bio X Cell). The mice were sacrificed after 1, 2 or 5 days of infection, depending on the experiment, after which the tongues were excised, weighed, and quantitatively cultured.
Phan Q.T., Solis N.V., Cravener M.V., Swidergall M., Lin J., Huang M.Y., Liu H., Singh S., Ibrahim A.S., Mazzone M., Mitchell A.P, & Filler S.G. (2023). Candida albicans stimulates the formation of a multi-receptor complex that mediates epithelial cell invasion during oropharyngeal infection. bioRxiv.
Full text: Click here
Publication Preprint 2023
Animals Antibodies, Anti-Idiotypic Calcium Alginate Candidiasis Cells Clone Cells Cortisone Acetate Gefitinib Hemoglobin, Sickle Immunocompetence Immunoglobulin Isotypes Infection Males Mice, Inbred BALB C Mus Oropharynxs Phagocytes SGX-523 Strains Tongue Virulence
5
C. albicans Modulation of Receptor Tyrosine Kinase Signaling
The capacity of the various C. albicans strains to induce phosphorylation of EGFR and c-Met in the presence and absence of inhibitors was determined as described previously (Swidergall et al., 2018 (link)). Briefly OKF6/TERT cells were seeded onto 24 well plates and incubated overnight in KSF medium without supplements. The next morning, the medium was aspirated and replaced with either fresh medium alone or containing gefitinib and/or SGX-523. When inhibitors were used, control cells were incubated with KSF medium containing a similar volume of the DMSO diluent. After 1 h, the cells were infected with 1×106C. albicans germ tubes in the presence of the inhibitors and incubated for 20 min. Next, the medium was aspirated and the epithelial cells were lysed with 2X SDS loading buffer (#BP-111R, Boston Bioproducts, Inc.) containing phosphatase/protease inhibitors (# A32959, Thermo Fisher Scientific), and PMSF (#P7626, Sigma-Aldrich). After denaturing the samples at 90°C for 2 minutes, the lysates were clarified by centrifugation. The proteins were separated by SDS-PAGE and transferred to PVDF membranes. The phosphorylated proteins were detected by probing the membranes with an anti-phospho-c-Met antibody (Tyr1234/1235, #3077, Cell Signaling Technology) or an anti-phospho-EGFR antibody (Tyr1068, #2234, Cell Signaling Technology). Next the blots were stripped and total c-Met was detected with an anti-met antibody (# 8198, Cell Signaling Technology) and total EGFR was detected with an anti-EGFR antibody (#4267, Cell Signaling Technology). The blots were developed using enhanced chemiluminescence, imaged with a digital imager, and quantified using Image Studio Lite software. Each experiment was repeated at least four times.
Phan Q.T., Solis N.V., Cravener M.V., Swidergall M., Lin J., Huang M.Y., Liu H., Singh S., Ibrahim A.S., Mazzone M., Mitchell A.P, & Filler S.G. (2023). Candida albicans stimulates the formation of a multi-receptor complex that mediates epithelial cell invasion during oropharyngeal infection. bioRxiv.
Full text: Click here
Publication Preprint 2023
anti-c antibody Antibodies, Anti-Idiotypic Buffers Cells Centrifugation Chemiluminescence Dietary Supplements EGFR protein, human Epithelial Cells Fingers Gefitinib inhibitors MET protein, human Phosphoric Monoester Hydrolases Phosphorylation polyvinylidene fluoride Protease Inhibitors Proteins SDS-PAGE SGX-523 Strains Sulfoxide, Dimethyl TERT protein, human Tissue, Membrane

Top products related to «Gefitinib»

1
Gefitinib by Selleck Chemicals
Sourced in United States, Germany, China, France
Gefitinib is a tyrosine kinase inhibitor used in laboratory research. It functions by inhibiting the epidermal growth factor receptor (EGFR) tyrosine kinase.
2
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
3
Gefitinib by Merck Group
Sourced in United States, Germany, United Kingdom, Ireland
Gefitinib is a laboratory product manufactured by Merck Group. It is a small-molecule tyrosine kinase inhibitor used for research purposes in scientific investigations.
4
Gefitinib by AstraZeneca
Sourced in United Kingdom, United States, China, Germany, Japan, Canada, Switzerland
Gefitinib is a pharmaceutical product developed by AstraZeneca. It is a tyrosine kinase inhibitor designed for laboratory research purposes. The core function of Gefitinib is to inhibit the activity of the epidermal growth factor receptor (EGFR) enzyme.
5
Dimethyl sulfoxide (dmso) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, India, Canada, Switzerland, Japan, Australia, Spain, Poland, Belgium, Brazil, Czechia, Portugal, Austria, Denmark, Israel, Sweden, Ireland, Hungary, Mexico, Netherlands, Singapore, Indonesia, Slovakia, Cameroon, Norway, Thailand, Chile, Finland, Malaysia, Latvia, New Zealand, Hong Kong, Pakistan, Uruguay, Bangladesh
DMSO is a versatile organic solvent commonly used in laboratory settings. It has a high boiling point, low viscosity, and the ability to dissolve a wide range of polar and non-polar compounds. DMSO's core function is as a solvent, allowing for the effective dissolution and handling of various chemical substances during research and experimentation.
6
Erlotinib by Selleck Chemicals
Sourced in United States, China, Germany, Australia
Erlotinib is a laboratory reagent used in research applications. It is a tyrosine kinase inhibitor that targets the epidermal growth factor receptor (EGFR). Erlotinib is commonly used in cell-based assays and in vitro studies to investigate EGFR signaling pathways.
7
Afatinib by Selleck Chemicals
Sourced in United States, China, Germany
Afatinib is a chemical compound used in laboratory research. It functions as a tyrosine kinase inhibitor, targeting specific receptors involved in cellular signaling pathways.
8
Gefitinib by LC Laboratories
Sourced in United States
Gefitinib is a small-molecule tyrosine kinase inhibitor that targets the epidermal growth factor receptor (EGFR). It is commonly used in laboratory research and development.
9
Gefitinib by Cayman Chemical
Sourced in United States
Gefitinib is a small-molecule tyrosine kinase inhibitor used as a laboratory tool for research purposes. It functions by blocking the activity of the epidermal growth factor receptor (EGFR), which is involved in cellular signaling pathways.
10
Rpmi 1640 medium by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Japan, France, Canada, Australia, Italy, Switzerland, Belgium, New Zealand, Spain, Israel, Sweden, Denmark, Macao, Brazil, Ireland, India, Austria, Netherlands, Holy See (Vatican City State), Poland, Norway, Cameroon, Hong Kong, Morocco, Singapore, Thailand, Argentina, Taiwan, Province of China, Palestine, State of, Finland, Colombia, United Arab Emirates
RPMI 1640 medium is a commonly used cell culture medium developed at Roswell Park Memorial Institute. It is a balanced salt solution that provides essential nutrients, vitamins, and amino acids to support the growth and maintenance of a variety of cell types in vitro.

More about "Gefitinib"

Gefitinib, a tyrosine kinase inhibitor (TKI), has emerged as a crucial treatment option for non-small cell lung cancer (NSCLC).
This targeted therapy works by blocking the activity of the epidermal growth factor receptor (EGFR), a protein that is often overexpressed in certain types of cancer cells.
The effectiveness of Gefitinib has been particularly notable in patients with EGFR-mutant NSCLC, and it is approved for use in this patient population.
Researchers can leverage the power of PubCompare.ai to find the optimal Gefitinib protocols from a vast array of scientific literature, preprints, and patents.
This AI-driven platform enables enhanced protocol reproducibility and research accuracy, ensuring reliable and effective results.
By comparing and synthesizing the latest findings, PubCompare.ai helps researchers navigate the complex landscape of Gefitinib studies.
Beyond Gefitinib, PubCompare.ai can also assist with other key components of NSCLC research, such as the use of FBS (Fetal Bovine Serum) and DMSO (Dimethyl Sulfoxide) in cell culture experiments, as well as the exploration of alternative TKIs like Erlotinib and Afatinib.
Furthermore, the platform can provide insights into the optimal use of RPMI 1640 medium, a commonly used cell culture medium in NSCLC research.
By leveraging the comprehensive data and powerful analysis capabilities of PubCompare.ai, researchers can enhance their understanding of Gefitinib and related topics, leading to more accurate and reproducible findings.
This, in turn, can accelerate the development of effective treatments and improve outcomes for patients with non-small cell lung cancer.