Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Geneticin

Geneticin

Geneticin, also known as G418, is an aminoglycoside antibiotic used as a selective agent in cell culture and genetic engineering.
It inhibits protein synthesis by binding to the 80S ribosomal subunit, making it a powerful tool for identifying and isolating cells that have been successfully transfected with a gene of interest.
Geneticin is commonly employed in the development of stable cell lines and the generation of transgenic organisms.
Researchers leveraging Geneticin in their work can benefit from the advanced capabilities of PubCompare.ai, an AI-driven platform that helps locate the most effective protocols from literature, preprints, and patents.
By facilitating seamless comparisons, PubCompare.ai enables researchers to easily identify the optimal protocols and products to enhance reproducibility and drive their Geneticin studies forward.

Most cited protocols related to «Geneticin»

1
Efficient Electroporation and Cryopreservation of Mouse ES Cells
Cited 173 times
The final targeting constructs were prepared for ES cell electroporation from 2 ml of culture (2X LB plus antibiotics) in 96-well format using the Qiagen Turboprep kit. Before electroporation, vectors were linearized with AsiSI and examined by gel electrophoresis. For most clones, the digested DNA migrated as a single high-molecular-mass band of the expected size (Supplementary Fig. 5). Occasionally, contaminating smaller molecular mass bands were also observed on the gel (DNA quality failures).
JM8 mouse ES cell lines derived from the C57BL/6N strain were grown either on a feeder layer of SNL6/7 fibroblasts (neomycin and/or puromycin resistant) or on gelatinized tissue culture plates16 (link). Both feeder-independent and feeder-dependent lines were maintained in Knockout DMEM (500 ml, Gibco) supplemented with 2 mM glutamine, 5 ml 100× β-mercaptoethanol (360 μl in 500 ml PBS, filter sterilized), 10–15% fetal calf serum respectively (Invitrogen) and 500 U ml−1 leukaemia-inhibitory factor (ESGRO, Millipore). Trypsin solution was prepared by adding 20 ml of 2.5% trypsin solution (Gibco) and 5 ml chicken serum (Gibco) to 500 ml filter-sterilized PBS containing 0.1 g EDTA (Sigma) and 0.5 g d-glucose (Sigma).
Electroporations of ES cells were carried out in a 25-well cuvette using the ECM 630 96-well electroporator /HT-200 automatic plate handler (BTX Harvard Apparatus; set at 700 V, 400 Ω, 25 μF). Immediately before electroporation, cell suspensions of ~1 × 107 cells and ~2 μg of linearized targeting vector DNA were mixed in a final volume of 120 μl PBS. Cells were seeded onto a 10-cm dish (with feeders or gelatin) and colonies were picked after 10 d of selection in 100 μg (active) per ml Geneticin (Invitrogen). To expand cells into duplicate wells for archiving and preparation of genomic DNA, confluent cultures of JM8 ES cells grown on feeder cells were washed twice with pre-warmed PBS and trypsinized for 15 min at 37 °C. Five volumes of pre-warmed media were added and the cells were gently dispersed by tituration and passed at a dilution of 1:4 into new plates containing feeder cells. Passage of cells grown on gelatinized plates was carried out in a similar manner except that the cells were trypsinized for 10 min and passed at a dilution of 1:6 into freshly gelatin-coated plates (0.1% gelatin, Sigma G1393). Culture medium was replaced daily and cells reached confluence 2 days after passage. To archive ES cell clones, trypsinized cells from confluent 96-well plates were transferred in 200 μl freezing medium (Knockout DMEM, 15% serum/ 10% DMSO) to 96-well cryovials (Matrix) and overlayed with sterile mineral oil. The cells were placed at −80 °C overnight and then transferred to liquid nitrogen.
Skarnes W.C., Rosen B., West A.P., Koutsourakis M., Bushell W., Iyer V., Mujica A.O., Thomas M., Harrow J., Cox T., Jackson D., Severin J., Biggs P., Fu J., Nefedov M., de Jong P.J., Stewart A.F, & Bradley A. (2011). A conditional knockout resource for the genome–wide study of mouse gene function. Nature, 474(7351), 337-342.
Publication 2011
2-Mercaptoethanol Antibiotics Cells Chickens Clone Cells Cloning Vectors Edetic Acid Electrophoresis Electroporation Embryonic Stem Cells Feeder Cell Layers Feeder Cells Fetal Bovine Serum Fibroblasts Gelatins Geneticin Genome Glucose Glutamine Hyperostosis, Diffuse Idiopathic Skeletal LIF protein, human Mus Neomycin Nitrogen Oil, Mineral PRSS2 protein, human Puromycin Serum Sterility, Reproductive Strains Sulfoxide, Dimethyl Technique, Dilution Tissues Trypsin
2
Yeast Cultivation and Transformation Protocols
Cited 55 times
All experiments were carried out in the DF5 strain background (Finley et al., 1987 (link)). All strains used are listed in Table S2 (see Supporting information). Standard procedures were followed for yeast cultivation and transformation (Sherman, 1991 (link)). For use of the CUP1 promoter, 100 µM CuSO4 was added to the growth medium. Geneticin was used at 200 µg/ml (for kanMX4 selection); hygromycin B at 300 µg/ml (for hphNT1); and nourseothricin at 100 µg/ml (for natNT2). Auxin was used at 1 mm unless otherwise indicated. TIR1 strains were created by integration of pNHK53 (encoding OsTIR1 under control of the ADH1 promoter) into the URA3 locus (Nishimura et al., 2009 (link)). All strains carrying a deletion or epitope-tagged allele of RAD53 were constructed in an sml1Δ background. Gene deletions and tags were introduced by means of PCR-generated cassettes (Longtine et al., 1998 (link)), using the primers listed in Table S1 (see Supporting information).
Morawska M, & Ulrich H.D. (2013). An expanded tool kit for the auxin-inducible degron system in budding yeast. Yeast (Chichester, England), 30(9), 341-351.
Publication 2013
Alleles Auxins Culture Media Deletion Mutation Epitopes Gene Deletion Geneticin Hygromycin B Nourseothricin Oligonucleotide Primers Saccharomyces cerevisiae Strains
3
VASA Promoter-driven eGFP Tracking
Cited 30 times
2.5 kb of human VASA upstream of the first codon was cloned into pENTR 5′-TOPO. eGFP was fused 1kb downstream of the last codon of human VASA, and cloned into pENTR/D-TOPO. Cloned plasmids were recombined27 (link) to create pLVGV. Lentiviral supernatant was produced, hESCs were transduced overnight on matrigel in conditioned medium and subsequently selected with geneticin (200ng/ml) for 7 days. Selected hESCs were differentiated for times indicated and harvested by brief treatment with Collagenase IV and then TrypLEExpress (Invitrogen). The cell suspension was prepared in differentiation medium for FACS with a MoFlow or BD cell sorter.
Kee K., Angeles V.T., Flores M., Nguyen H.N, & Pera R.A. (2009). Human DAZL, DAZ and BOULE genes modulate primordial germ cell and haploid gamete formation. Nature, 462(7270), 222-225.
Publication 2009
Brief Treatment Cells Codon Collagenase Culture Media, Conditioned Geneticin Homo sapiens Human Embryonic Stem Cells matrigel Plasmids Topotecan
4
VASA Promoter-driven eGFP Tracking
Cited 30 times
2.5 kb of human VASA upstream of the first codon was cloned into pENTR 5′-TOPO. eGFP was fused 1kb downstream of the last codon of human VASA, and cloned into pENTR/D-TOPO. Cloned plasmids were recombined27 (link) to create pLVGV. Lentiviral supernatant was produced, hESCs were transduced overnight on matrigel in conditioned medium and subsequently selected with geneticin (200ng/ml) for 7 days. Selected hESCs were differentiated for times indicated and harvested by brief treatment with Collagenase IV and then TrypLEExpress (Invitrogen). The cell suspension was prepared in differentiation medium for FACS with a MoFlow or BD cell sorter.
Kee K., Angeles V.T., Flores M., Nguyen H.N, & Pera R.A. (2009). Human DAZL, DAZ and BOULE genes modulate primordial germ cell and haploid gamete formation. Nature, 462(7270), 222-225.
Publication 2009
Brief Treatment Cells Codon Collagenase Culture Media, Conditioned Geneticin Homo sapiens Human Embryonic Stem Cells matrigel Plasmids Topotecan
5
Yeast Protein Tagging Protocol with PCR and Transformation
Cited 29 times
Polymerase chain reactions (PCRs) and yeast transformations were performed as described (Petracek and Longtine, 2002 (link)) but with some modifications. Takara EX taq™ (Takara) was used for amplification of DNA fragments from the template plasmids described in Figure 1. The generalized pair of primers used for each PCR is shown in Figure 1, and the specific primers used in the validation studies are given in Table 3. PCR conditions were as follows: a 94 °C, 5 min denaturation step was followed by five cycles of 94 °C, 30 s; 10 °C, 1 min; and 68 °C, 4 min, and then by 30 cycles of 94 °C, 30 s; 65 °C, 30 s; and 72 °C, 4 min. The amplified DNA was used for transformation of diploid yeast strain YPH501 with selection for growth on 0.3 mg/ml Geneticin/G418 (Invitrogen) (for kanMX6-marked fragments), 0.3 mg/ml hygromycin B (Roche) (for hphMX4-marked fragments), or minimal medium lacking histidine (for HIS3MX6-marked fragments). After the recombination was confirmed by colony PCR, the transformants were sporulated and asci were dissected. Single-site insertion of the tagging construct was confirmed by 2 : 2 segregation of the marker gene based on growth on selection plates. Expression of the tagged proteins was verified by immunoblotting.

PCR primers used in this study

NameSequencePurpose
MF 259GCTGAAGTTAAGAAATTGGAAGGCACTATAGAATACCA-RPT4 C-terminal tagging, forward
AA AATTAGGGGGAGGCGGGGGTGGA
MF 232GTTACTGATATACACATACCTATACATACACATGTCTTT-RPT4 C-terminal tagging, reverse
TTA ACAGAATTCGAGCTCGTTTAAAC
MF 256AGTGAAGTTCAAGCAAGAAAATCGAAATCGGTATCCTTTT ATGCAGGGGGAGGCGGGGGTGGARPT5 C-terminal tagging, forward
MF 257GTAGATATGTGAATGGCGGCTTGATAAATCAAAATATTA-RPT5 C-terminal tagging, reverse
TTA TTTGAATTCGAGCTCGTTTAAAC
MF 233ACATAAAAGC TTTGCAAAGT ATTGGACAATRPT4 colony PCR, forward
MF 258GGTCATGGA TATGAATGAG ATTGAAGRPT5 colony PCR, forward
MF 234AGATCTATATTACCCTGTTATCCCTAGCGGColony PCR, reverse
Funakoshi M, & Hochstrasser M. (2009). Small epitope-linker modules for PCR-based C-terminal tagging in Saccharomyces cerevisiae. Yeast (Chichester, England), 26(3), 185-192.
Publication 2009
antibiotic G 418 Diploidy Geneticin Genetic Markers Histidine Hygromycin B Oligonucleotide Primers Plasmids Proteins PSMC3 protein, human Recombination, Genetic Saccharomyces cerevisiae Strains

Most recents protocols related to «Geneticin»

1
Engineered Stable CRE-Luciferase Cell Lines
Not available on PMC !

Example 11

CREB responsive luciferase stable HEK 293 cell line overexpressing human glucagon receptor (GCGR), glucagon-like peptide 1 receptor (GLP-1R), Glucose-dependent insulinotropic polypeptide receptor (GIPR), or Glucagon-like peptide 2 receptor (GLP-2R) was generated as follows.

HEK293 cells were infected with lent virus encoding firefly luciferase gene under the control of CRE promoter, as described in the manual (Qiagen, Netherlands) and then were selected using 1p g/mL puromycin (Life technologies, Carlsbad) for 1 week. The survived cells were named as CRE-HEK293, expanded and then transfected with a G418 selective mammalian expression plasmid encoding human GCGR, GLP-1R, GIPR or GLP-2R. In brief, GCGR, GLP-1R, GIPR, or GLP-2R plasmid was transfected into CRE-HEK293 cells using Lipofectamine 2000 and selected with 400 μg/mL geneticin (Life technologies, Carlsbad, CA). Single colony stable cell lines overexpressing both CRE-luciferase and GCGR, GLP-1R, GIPR, or GLP-2R were then established for in vitro activity assays. These four stable cell lines were named as HEK293-GCGR-CRE, HEK293-GLP-1R-CRE, HEK293-GIPR-CRE, and HEK293-GLP-2R-CRE.

US11865160B2. Modified therapeutic agents, stapled peptide lipid conjugates, and compositions thereof (2024-01-09). THE SCRIPPS RESEARCH INSTITUTE [US]. Inventors: Weijun Shen [US], Pengyu Yang [US], Huafei Zou [US], Peter G. Schultz [US].
Patent 2024
antibiotic G 418 Biological Assay Cell Lines Cells gastric inhibitory polypeptide receptor Genes, Viral Geneticin Glucagon Glucagon-Like Peptide-1 Receptor Glucagon-Like Peptide-2 Receptor Glucagon-Like Peptide 1 Glucagon Receptor HEK293 Cells Homo sapiens lipofectamine 2000 Luciferases Luciferases, Firefly Mammals Plasmids Puromycin
2
Calcium Mobilization Assay for Opioid Receptors
Stock solutions (10 mM) of the peptides were prepared in 5% DMSO in bidistilled water and kept at −20°C Serial dilutions were carried out in HBSS/HEPES buffer (20 mM, containing 0.02% bovine serum albumin fraction V). Calcium mobilization assay was performed using the same method as previously described (Camarda and Calo, 2013 (link)). CHO cells with stable co-expression of human mu or kappa receptors and the C-terminally modified Gαqi5 and CHO cells with co-expression of the delta-opioid receptor and the GαqG66Di5 protein were used. Dulbecco’s MEM/HAMS F12 (1:1) medium supplemented with 10% fetal bovine serum, penicillin (100 IU/mL), streptomycin (100 μg/mL), L-glutammine (2 mM), fungizone (1 μg/mL), geneticin (G418; 200 μg/mL) and hygromycin B (100 μg/mL) was used for cell culture. Cells were seeded at a density of 50,000 cells/well into 96-well black, clear-bottom plates and kept in the incubator at 37°C in 5% CO2/humidified air. After 24 h the cell growth medium was aspired and loading medium, supplemented with probenecid (2.5 mM), calcium sensitive fluorescent dye Fluo-4 AM (3 µM), pluronic acid (0.01%) and HEPES (20 mM), was added. Then the plates were placed in the incubator again. After 30 min the loading solution was aspirated and 100 µL/well of assay buffer (HBSS supplemented with 20 mM HEPES, 2.5 mM probenecid, and 500 µM Brilliant Black) was added. Next, both plates (cell culture and compound plate) were placed in the FlexStation II reader (Molecular Device, Union City, CA 94587, United States), the on-line additions were carried out in a volume of 50 µL/well and the fluorescence changes were measured. Ligand efficacies, expressed as the intrinsic activity (α), were calculated as the Emax ratio of the tested compound and the standard agonist. At least three independent experiments for each assay were carried out in duplicate.
Curve fittings were performed using Graph Pad PRISM 5.0 (GraphPad Software Inc., San Diego, United States). Data have been statistically analyzed with one way ANOVA followed by the Dunnett’s test for multiple comparisons; p values < 0.05 were considered significant.
Piekielna-Ciesielska J., Malfacini D., Djeujo F.M., Marconato C., Wtorek K., Calo’ G, & Janecka A. (2023). Functional selectivity of EM-2 analogs at the mu-opioid receptor. Frontiers in Pharmacology, 14, 1133961.
Publication 2023
Acids antibiotic G 418 ATF7IP protein, human Biological Assay brilliant black Buffers Calcium Cell Culture Techniques Cells CHO Cells Fetal Bovine Serum Fluo 4 Fluorescence Fluorescent Dyes Fungizone Geneticin Hemoglobin, Sickle HEPES Homo sapiens Hygromycin B Ligands Medical Devices neuro-oncological ventral antigen 2, human Penicillins Peptides Pluronics prisma Probenecid Proteins Receptors, Cell Surface Receptors, Opioid, delta Receptors, Opioid, kappa Receptors, Opioid, mu Serial C Serum Albumin, Bovine Streptomycin Sulfoxide, Dimethyl Technique, Dilution
3
Engineered Yeast for Resveratrol Biosynthesis
E. coli Trans 5α (TransGen Biotech, Beijing, China) was used for propagation of plasmids. Luria–Bertani (LB) broth medium (5 g/L yeast extract, 10 g/L tryptone, 10 g/L NaCl) containing 50 mg/L of kanamycin was used to culture E. coli carrying transformed plasmids. S. cerevisiae strain BY4742 (MATα, his3Δ1, leu2Δ0, lys2Δ0, ura3Δ0) was used as the parent strain for resveratrol biosynthesis. YPD medium (10 g/L yeast extract, 20 g/L peptone, and 20 g/L glucose, also marked as YPD-20G when needed) was used for routine cultivation of S. cerevisiae strains. YPD medium with 40 g/L glucose was also used for fermentation in shake flasks and marked as YPD-40G. Geneticin (G418, 100 mg/L) was supplemented in the YPD agar plate for the selection of engineered yeast strains edited by CRISPR/Cas9. SC agar plates (synthetic complete drop-out medium, 20 g/L glucose, 6.7 g/L yeast nitrogen base without amino acids, and 0.8 g/L dropout powder minus appropriate amino acids) was used for the selection of engineered yeast strains edited by homologous recombination using HIS3, LEU2, URA3 and LYS2 respectively as selective markers. Minimal medium used in our study was based on studies described previously [36 (link)]. The medium contained 20 g/L or 40 g/L glucose, 15 g/L (NH4)2SO4, 8 g/L KH2PO4, 6.2 g/L MgSO4∙7H2O, 1.2% (v/v) vitamin solution, and 1% (v/v) trace metal solution. L-lysine (0.5 g/L) was added in minimal medium for the cultivation of strain BRT8 and BRT9. The trace metal solution contained 5.75 g/L ZnSO4∙7H2O, 0.32 g/L MnCl2∙4H2O, 0.47 g/L CoCl2∙6H2O, 0.48 g/L Na2MoO4∙2H2O, 2.9 g/L CaCl2∙2H2O, 2.8 g/L FeSO4∙7H2O and 80 mL 0.5 M EDTA, pH 8.0. The vitamin solution contained 0.05 g/L biotin, 1 g/L calcium pantothenate, 1 g/L nicotinic acid, 25 g/L myo-inositol, 1 g/L thiamine HCl, 1 g/L pyridoxal HCl and 0.2 g/L p-aminobenzoic acid.
Meng L., Diao M., Wang Q., Peng L., Li J, & Xie N. (2023). Efficient biosynthesis of resveratrol via combining phenylalanine and tyrosine pathways in Saccharomyces cerevisiae. Microbial Cell Factories, 22, 46.
Publication 2023
4-Aminobenzoic Acid Agar Amino Acids Amino Acids, Basic Anabolism antibiotic G 418 Biotin Clustered Regularly Interspaced Short Palindromic Repeats Edetic Acid Escherichia coli Fermentation Geneticin Glucose Homologous Recombination Inositol Kanamycin Lysine manganese chloride Metals Nicotinic Acids Nitrogen Pantothenate, Calcium Parent Peptones Plasmids Powder Pyridoxal Resveratrol Saccharomyces cerevisiae Sodium Chloride sodium molybdate(VI) Strains Sulfate, Magnesium thiamine hydrochloride Tremor Vitamins
4
Auxin-Induced Degradation of DPY30 and RBBP5
For the generation of the auxin-inducible degradation system for DPY30 sgRNA targeting the stop-codon region were cloned into eSpCas9(1.1)-T2A-eGFP. Left and right homology arms, as well as the mAID-T2A-BFP middle part were ligated into a modified pUC19 vector backbone (a gift from S. Pollard) using the In-Fusion cloning kit (Takara, 638910). mES cells were co-transfected with sgRNA- and donor-vector using Lipofectamine 3000 and sorted 48 h later for GFP/BFP-double-positive cells. Homozygous clones were then transfected with pPB-hygro-OsTIR1-P2A-mCherry and pBase plasmids and selected with 100 µg ml−1 hygromycin B (Thermo Fisher Scientific, 10687010). For the generation of the endogenous dTAG-inducible degradation system for RBBP5, sgRNA targeting the stop codon region were co-transfected into the cells and contained the following elements: left and right homology arms, as well as FKBP12(F36V), 2× HA tags, P2A and a neomycin-resistance gene. The transfected cells were selected with 100 µg ml−1 Geneticin selective antibiotic (G418 Sulfate) (Thermo Fisher Scientific, 10131027), single-cell sorted to obtain clonal cell lines and screened for correct biallelic integration. All homozygous insertions and knock-ins were confirmed by Sanger sequencing and western blotting. A list of the oligos and the sequences of the sgRNAs is provided in Supplementary Table 1.
Wang H., Fan Z., Shliaha P.V., Miele M., Hendrickson R.C., Jiang X, & Helin K. (2023). H3K4me3 regulates RNA polymerase II promoter-proximal pause-release. Nature, 615(7951), 339-348.
Publication 2023
2',5'-oligoadenylate antibiotic G 418 Antibiotics Arm, Upper Auxins Cell Lines Cells Clone Cells Cloning Vectors Codon, Terminator Genes Geneticin Homozygote Hygromycin B Insertion Mutation Lipofectamine Neomycin Plasmids Sulfates, Inorganic Tacrolimus Binding Protein 1A Tissue Donors Vertebral Column
5
Auxin-Induced Degradation of DPY30 and RBBP5
For the generation of the auxin-inducible degradation system for DPY30 sgRNA targeting the stop-codon region were cloned into eSpCas9(1.1)-T2A-eGFP. Left and right homology arms, as well as the mAID-T2A-BFP middle part were ligated into a modified pUC19 vector backbone (a gift from S. Pollard) using the In-Fusion cloning kit (Takara, 638910). mES cells were co-transfected with sgRNA- and donor-vector using Lipofectamine 3000 and sorted 48 h later for GFP/BFP-double-positive cells. Homozygous clones were then transfected with pPB-hygro-OsTIR1-P2A-mCherry and pBase plasmids and selected with 100 µg ml−1 hygromycin B (Thermo Fisher Scientific, 10687010). For the generation of the endogenous dTAG-inducible degradation system for RBBP5, sgRNA targeting the stop codon region were co-transfected into the cells and contained the following elements: left and right homology arms, as well as FKBP12(F36V), 2× HA tags, P2A and a neomycin-resistance gene. The transfected cells were selected with 100 µg ml−1 Geneticin selective antibiotic (G418 Sulfate) (Thermo Fisher Scientific, 10131027), single-cell sorted to obtain clonal cell lines and screened for correct biallelic integration. All homozygous insertions and knock-ins were confirmed by Sanger sequencing and western blotting. A list of the oligos and the sequences of the sgRNAs is provided in Supplementary Table 1.
Wang H., Fan Z., Shliaha P.V., Miele M., Hendrickson R.C., Jiang X, & Helin K. (2023). H3K4me3 regulates RNA polymerase II promoter-proximal pause-release. Nature, 615(7951), 339-348.
Publication 2023
2',5'-oligoadenylate antibiotic G 418 Antibiotics Arm, Upper Auxins Cell Lines Cells Clone Cells Cloning Vectors Codon, Terminator Genes Geneticin Homozygote Hygromycin B Insertion Mutation Lipofectamine Neomycin Plasmids Sulfates, Inorganic Tacrolimus Binding Protein 1A Tissue Donors Vertebral Column

Top products related to «Geneticin»

1
Geneticin by Thermo Fisher Scientific
Sourced in United States, France, Germany, United Kingdom, Canada, Belgium, Australia, Japan, Switzerland, Spain, Italy, Sweden, Thailand
Geneticin is a broad-spectrum antibiotic used for the selection of mammalian, plant, and bacterial cells that have been successfully transfected with a gene of interest. It acts by inhibiting protein synthesis and is commonly used in cell culture applications to identify and maintain cells that have been genetically modified.
2
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
3
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
4
Geneticin g418 by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Australia
Geneticin (G418) is a broad-spectrum antibiotic used as a selectable marker in eukaryotic cell culture. It inhibits protein synthesis, allowing for the selection of cells that have been successfully transfected with a resistance gene.
5
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
6
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
7
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.
8
Streptomycin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
9
Geneticin by Merck Group
Sourced in United States, Germany, France, United Kingdom, Canada, China, Italy, Sao Tome and Principe, Switzerland
Geneticin is a broad-spectrum antibiotic used as a selection agent in cell culture. It inhibits protein synthesis in eukaryotic cells by interfering with ribosomal function.
10
L glutamine by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, France, Canada, Switzerland, Italy, Australia, Belgium, China, Japan, Austria, Spain, Brazil, Israel, Sweden, Ireland, Netherlands, Gabon, Macao, New Zealand, Holy See (Vatican City State), Portugal, Poland, Argentina, Colombia, India, Denmark, Singapore, Panama, Finland, Cameroon
L-glutamine is an amino acid that is commonly used as a dietary supplement and in cell culture media. It serves as a source of nitrogen and supports cellular growth and metabolism.

More about "Geneticin"

Geneticin, also known as G418, is a powerful aminoglycoside antibiotic widely used in cell culture and genetic engineering.
This selective agent plays a crucial role in identifying and isolating cells that have been successfully transfected with a gene of interest.
By inhibiting protein synthesis through binding to the 80S ribosomal subunit, Geneticin is a valuable tool for the development of stable cell lines and the generation of transgenic organisms.
Researchers leveraging Geneticin in their work can greatly benefit from the advanced capabilities of PubCompare.ai, an AI-driven platform that helps locate the most effective protocols from literature, preprints, and patents.
By facilitating seamless comparisons, PubCompare.ai enables researchers to easily identify the optimal protocols and products to enhance reproducibility and drive their Geneticin studies forward.
In addition to Geneticin, other key components often used in cell culture and genetic engineering include Lipofectamine 2000 (a transfection reagent), FBS (fetal bovine serum), DMEM (Dulbecco's Modified Eagle Medium), and antibiotics like Penicillin and Streptomycin.
These reagents and media work in tandem to create a conducive environment for cell growth, transfection, and selection.
By leveraging the insights and capabilities of PubCompare.ai, researchers can streamline their Geneticin-related studies, optimize protocols, and ultimately drive their research forward with greater efficiency and reproducibility.
Experience the power of seamless research with PubCompare.ai - the ultimate tool for Geneticin and beyond.