Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Glufosinate

Glufosinate

Glufosinate is a non-selective herbicide used to control a wide range of annual and perennial weeds.
It inhibits the enzyme glutamine synthetase, leading to the accumulation of ammonia and disruption of photosynthesis.
Glufosinate is commonly used in agriculture, including in genetically modified crops resistant to its effects.
Researchers can optimize their Glufosinate studies using PubCompare.ai's AI-driven platform, which helps locate the best protocols from literature, preprints, and patents, enhancing reproducibility and finding the ideal Glufosinate products with ease.
Experince the power of AI-driven research optimization today!

Most cited protocols related to «Glufosinate»

1
Modular Cloning for Cas9 Constructs
Cited 8 times
The vectors were assembled using the Golden Gate modular cloning method [23 (link)]. To generate the Cas9 expression cassettes, the RPS5a, YAO, ICU2, CsVMV, EC1.2, EC_enh., UBI10, AG, MGE1 and 35S promoters, the Cas9_1, Cas9_2, Cas9_3 and Cas9_4 coding sequences, the Ocs, Nos, Ags and E9 terminators were amplified using primers flanked with BpiI restriction sites associated with Golden Gate compatible overhangs (S3 Table). 0.02 pmoles of the purified PCR products were mixed with the same molar amount of the corresponding Level 0 vector (S3 Table), 0.5 μl of BpiI enzyme (10U/μl, ThermoFisher), 0.5 μl of T4 ligase (400U/μl, NEB), 1.5 μl of CutSmart Buffer (NEB), 1.5μl of Bovine Serum Albumin (10X) and water in a total reaction volume of 15 μl. The reaction was placed in a thermocycler and the following ‘Golden Gate’ program was applied: 20 seconds 37°C, 25 cycles of [3 minutes 37°C / 4 minutes 16°C], 5 minutes 50°C and 5 minutes 80°C.
Combinations of three Level 0 vectors containing respectively a promoter, a Cas9 coding sequence and a terminator were assembled in Level 1 vector pICH7742 (Position 2) or pICH47811 (Position 2, reverse) by the same ‘Golden Gate’ protocol but using 0.5 μl of BpiI enzyme (10U/μl, ThermoFisher) instead of 0.5 μl of BsaI-HF.
To generate the sgRNA expression cassettes, DNA fragments containing the classic or the ‘EF’ backbone with 7, 67 or 192 bp of the U6-26 terminator were amplified using primers flanked with BsaI restriction sites associated with Golden Gate compatible overhangs (S3 Table). The amplicons were assembled with the U6-26 promoter (pICSL90002) in Level 1 vector pICH7751 (Position 3) by the ‘Golden Gate’ protocol using the BsaI-HF enzyme. Combinations of three Level 1 vectors containing a glufosinate resistance selectable maker (pICSL11017), a Cas9 expression cassette and a sgRNA expression cassette were assembled in Level 2 pAGM4723 (- overdrive) or pICSL4723 (+ overdrive) by the ‘Golden Gate’ protocol using the BpiI enzyme. All the plasmids were prepared using a QIAPREP SPIN MINIPREP KIT on Escherichia coli DH10B electrocompetent cells selected with appropriate antibiotics and X-gal.
All the plasmid identification numbers refer to the ‘addgene database’ (www.addgene.org/).
Castel B., Tomlinson L., Locci F., Yang Y, & Jones J.D. (2019). Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. PLoS ONE, 14(1), e0204778.
Full text: Click here
Publication 2019
5-bromo-4-chloro-3-indolyl beta-galactoside Antibiotics Buffers Cells Cloning Vectors Enzymes Escherichia coli Exons glufosinate Ligase Molar Neoplasm Metastasis Oligonucleotide Primers Open Reading Frames Plasmids Serum Albumin, Bovine Vertebral Column
2
Generation and Characterization of Myosin XI-K Marker Lines
Cited 7 times
A genomic copy of the myosin XI-K gene (AT5G20490) tagged by insertion of the YFP ORF (XI-K:YFP) was generated as described for the FLAG-tagged XI-K (Peremyslov et al., 2010 (link)). The YFP ORF was PCR amplified and inserted in a pMDC32 binary vector carrying a genomic copy of the XI-K using overlapping PCR. The resulting plasmid was mobilized into Agrobacterium tumefaciens GV3101 and used to transform the 3KO xi-k xi-1 xi-2 plants (Peremyslov et al., 2010 (link)) by floral dipping. The identifiers for the T-DNA insertion lines used to generate 3KO plants were Salk_067972, Salk_019031, and Salk_055785, respectively. Transgenic plants designated 3KOR were selected using Hygromycin-containing medium and YFP imaging. Immunoblotting using a rabbit polyclonal XI-K antibody, rabbit polyclonal antibody to ER binding protein (BiP; a gift from Dr. J. Denecke), or mouse monoclonal GFP antibody (Roche) was done as described (Peremyslov et al., 2008 (link)). All four originally selected, independent lines of transformed plants showed very similar levels of XI-K:YFP expression and virtually indistinguishable phenotypes. One of these lines was selected for all following analyses. To compare the expression levels of myosin XI-K in Columbia-0 to that of XI-K:YFP in 3KOR line plants, the immunoblots were quantified by measuring mean band intensity normalized to that of a loading control (BiP; n = 4 for each variant). The phenotypes of plant lines presented in Figures 1D–F were characterized as described (Peremyslov et al., 2010 (link)); statistical analyses of the data, including standard deviations shown as error bars and t-tests, were done using Microsoft Excel package. The p values, corresponding to pairwise comparisons of data sets, are presented in the text under Results.
To generate transgenic lines expressing compartment-specific markers, a binary vector pCB301 was modified to accommodate an UBQ10 promoter (Geldner et al., 2009 (link)) and a polyadenylation signal, and used to generate N-terminal fusions of the mTurquoise fluorescent protein (Goedhart et al., 2010 (link)) with the actin-binding domain LifeAct (Goedhart et al., 2010 (link)), the transmembrane domain of N-acetylglucosaminyl transferase I (NAG; Grebe et al., 2003 (link)), or SCAMP2 (Toyooka et al., 2009 (link)). An ER-targeted CFP was described before (Peremyslov et al., 2010 (link)). The marker-expressing 3KOR plants were selected using glufosinate. The transgenic plant lines generated in Columbia or 3KOR genetic background had normal developmental phenotypes under optimal growth conditions. This was also the case for the LifeAct-mTurquoise plants in accord with recent independent work (van der Honing et al., 2011 (link)).
Peremyslov V.V., Klocko A.L., Fowler J.E, & Dolja V.V. (2012). Arabidopsis Myosin XI-K Localizes to the Motile Endomembrane Vesicles Associated with F-actin. Frontiers in Plant Science, 3, 184.
Full text: Click here
Publication 2012
Actins Agrobacterium tumefaciens Animals, Transgenic Cloning Vectors Developmental Disabilities Genes Genes, vif Genetic Background Genome glufosinate hygromycin A Immunoblotting immunoglobulin-binding factors Immunoglobulins Mice, Laboratory Monoclonal Antibodies Myosin ATPase Nonmuscle Myosin Type IIA nucleoprotein, Measles virus Phenotype Plants Plants, Transgenic Plasmids Polyadenylation Rabbits Transferase
3
Engineered Glufosinate Resistance Gene
Cited 6 times
The Streptomyces hygroscopicus bar gene conferring resistance to glufosinate (Avalos et al. 1989 (link)) was amplified by polymerase chain reaction (PCR) from pBAR-GEM 7.2 (Pall and Brunelli 1993 ) using primers Bar-BstB1-F (5′ TTCGAAGTCGACAGAAGATGATATTG 3′) and Bar-BstB1-R (5′ TTCGAAGAACCGGCAGGCTGAAGTCC 3′). The resulting 912-bp DNA fragment was ligated into pCR blunt (Invitrogen, Carlsbad, CA) generating plasmid pJV1. The 1690-bp DNA fragment containing the tcu-1 promoter was generated by PCR on wild-type (WT) genomic DNA using primers Ptcu-1 F-NotI (5′ TTTGCGGCCGCGATGGGATAGAGAGAATGGC 3′) and Ptcu-1 R ApaI (5′ TTTGGGCCCGGTTGGGGATGTGTGTGC 3′). The PCR product was cut with NotI and ApaI, and ligated into pJV1 digested with the same enzymes, creating pCR blunt bar::Ptcu-1 (plasmid and sequence deposited at the Fungal Genetic Stock Center).
Lamb T.M., Vickery J, & Bell-Pedersen D. (2013). Regulation of Gene Expression in Neurospora crassa with a Copper Responsive Promoter. G3: Genes|Genomes|Genetics, 3(12), 2273-2280.
Full text: Click here
Publication 2013
DNA Fingerprinting Enzymes Genes Genes, Fungal Genome glufosinate methyl 4-azidophenylacetimidate Oligonucleotide Primers Plasmids Streptomyces hygroscopicus
4
Optimized Sorghum Transformation Protocol
Cited 6 times
TX430, a non-tannin sorghum variety, was used in this study. All sorghum embryo donor plants and transgenic plants were grown in a greenhouse located in Johnston, Iowa. Greenhouse temperatures averaged 29°C during the day and 20°C at night with a 12 h d/night photoperiod and supplemental lighting was provided by a 3:1 ratio of metal halide (1,000 W) and high-pressure sodium (1,000 W) lamps. The components of the media used in this study are listed in Table 1. The Escherichia coli phosphomannose isomerase (PMI) gene (Miles and Guest 1984 (link)), which catalyzes the reversible isomerization of mannose-6-phosphate to fructose-6-phosphate (serving as a precursor for the glycolytic pathway and enabling growth on mannose-containing media) and a codon-modified phosphinothricin acetyltransferase (moPAT) gene, which confers resistance to the herbicide glufosinate-ammonium (US patent no. 6,096,947), were used as the selectable markers. The baseline transformation protocol is described in detail as “treatment C” in Zhao et al. (2000 (link)). Briefly, freshly harvested sorghum immature grains were sterilized with 50% bleach and 0.1% Tween-20 for 30 min under vacuum and then rinsed with sterile water three times. The embryos were subjected to the following five sequential steps: (1) Agrobacterium infection: embryos were incubated in an Agrobacterium suspension (OD = 0.7 at 550 nm) with PHI-I medium for 5 min; (2) co-cultivation: embryos were cultured on PHI-T medium following infection for 3 d at 25°C in the dark; (3) resting: embryos were cultured on PHI-T medium plus 100 mg/l carbenicillin for 4 d at 28°C in the dark; (4) selection: embryos were cultured on PHI-U medium for 2 wk, followed by culture on PHI-V medium for the remainder of the selection process at 28°C in the dark, using subculture intervals of 2–3 wk; (5) regeneration: callus was cultured on PHI-X medium for 2–3 wk in the dark to stimulate shoot development, followed by culture for 1 wk under conditions of 16 h light (40–120 μE m−2 s−1) and 8 h dark at 25°C, and a final subculture on PHI-Z medium for 2–3 wk under lights (16 h, 40–120 μE m−2 s−1) to stimulate root growth. Regenerated plantlets were transplanted into soil and grown in the greenhouse (Zhao et al. 2000 (link)). T0 plants were self-pollinated to produce T1 progeny for further analysis. A new optimized protocol is described in the Results section of this manuscript.

Composition of mediaa

Medium
PHI-I: 4.3 g/l MS salts (Phytotechnology Laboratories, Shawnee Mission, KS, catalog number M524), 0.5 mg/l nicotinic acid, 0.5 mg/l pyridoxine HCl, 1 mg/l thiamine HCl, 0.1 g/l myo-inositol, 1 g/l casamino acids (Becton Dickinson and Company, BD Diagnostic Systems, Sparks, MD, catalog number 223050), 1.5 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D), 68.5 g/l sucrose, 36 g/l glucose, pH 5.2; with 100 μM acetosyringone added before using.
PHI-T: PHI-I with 20 g/l sucrose, 10 g/l glucose, 2 mg/l 2,4-D, no casamino acids, 0.5 g/l MES buffer, 0.7 g/l L-proline, 10 mg/l ascorbic acid, 100 μM acetosyringone, 8 g/l agar, pH 5.8.
PHI-U: PHI-T with 1.5 mg/l 2,4-D 100 mg/l carbenicillin, 30 g/l sucrose, no glucose and acetosyringone; 5 mg/l PPT, pH 5.8.
PHI-UM: PHI-U with12.5 g/l mannose and 5 g/l maltose, no sucrose, no PPT, pH 5.8
PHI-V: PHI-U with 10 mg/l PPT
DBC3: 4.3 g/l MS salts, 0.25 g/l myo-inositol, 1.0 g/l casein hydrolysate, 1.0 mg/l thiamine HCL, 1.0 mg/l 2,4-D, 30 g/l maltose, 0.69 g/l L-proline, 1.22 mg/l cupric sulfate, 0.5 mg/l BAP, 3.5 g/l phytagel, pH 5.8
PHI-X: 4.3 g/l MS salts, 0.1 g/l myo-inositol, 5.0 ml MS vitamins stockb, 0.5 mg/l zeatin, 700 mg/l L-proline, 60 g/l sucrose, 1 mg/l indole-3-acetic acid, 0.1 μM abscisic acid, 0.1 mg/l thidiazuron, 100 mg/l carbenicillin, 5 mg/l PPT, 8 g/l agar, pH 5.6.
PHI-XM: PHI-X with no PPT; added 1.25 mg/l cupric sulfate, pH 5.6.
PHI-Z: 2.15 g/l MS salts, 0.05 g/l myo-inositol, 2.5 ml MS vitamins stockb, 20 g/l sucrose, 3 g/l phytagel, pH 5.6

aPHI-I, PHI-T, PHI-U, PHI-V, PHI-X, and PHI-Z media from Zhao et al. 2000 (link)

bMS vitamins stock: 0.1 g/l nicotinic acid, 0.1 g/l pyridoxine HCl, 0.02 g/l thiamine HCl, 0.4 g/l glycine.

Wu E., Lenderts B., Glassman K., Berezowska-Kaniewska M., Christensen H., Asmus T., Zhen S., Chu U., Cho M.J, & Zhao Z.Y. (2013). Optimized Agrobacterium-mediated sorghum transformation protocol and molecular data of transgenic sorghum plants. In Vitro Cellular & Developmental Biology, 50(1), 9-18.
Publication 2013
5
Floral Dip Transformation of A. thaliana
Cited 5 times

A. thaliana plants were transformed by a modified version of the floral dip protocol [33] (link), where only the tips of the inflorescences were dipped into the agrobacteria solution.
For selection on soil, Basta™ (glufosinate-ammonium; Bayer CropScience Deutschland GmbH, Langenfeld, Germany) was used at a concentration of 20 mg/L, both for spraying and watering. The concentrations of sulfadiazine, D-alanine, Basta™, kanamycin and hygromycin for selection on ½ MS plates were 0.75–7.5 µg/mL, 12 mM, 10 µg/mL, 50 µg/ml and 25 µg/mL, respectively.
Lampropoulos A., Sutikovic Z., Wenzl C., Maegele I., Lohmann J.U, & Forner J. (2013). GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis. PLoS ONE, 8(12), e83043.
Full text: Click here
Publication 2013
Agrobacterium Alanine Basta hygromycin A Inflorescence Kanamycin phosphinothricin, monoammonium salt Plants Sulfadiazine

Most recents protocols related to «Glufosinate»

1
Correlating Glufosinate Resistance in Echinochloa indica
Not available on PMC !
A glyphosate-resistant sub-population derived from the multiple-resistant E. indica population (Jalaludin et al., 2015) and possessing the target site 106 mutation in 5-enolpyruvylshikimate3phosphate synthase (EPSPS) (Han et al., 2017) was found segregating for glufosinate resistance. This sub-population was used to examine the correlation between EiGS genotypes and glufosinate resistance/susceptibility phenotypes. Leaf material of five-to six-leaf stage R E. indica seedlings (together with the S population as control) were pre-harvested individually, snap-frozen in liquid nitrogen and stored at -80 ℃. Three days later, when leaf regrowth had occurred, the seedlings were foliar treated with 990 g ha -1 glufosinate. Glufosinate-R (survivors) and -S (killed) phenotypes were determined three weeks after treatment. RNA was prepared from pre-harvested samples and the relevant EiGS1-1 gene amplified and sequenced using the primer pair of EiGS1-1-F/EiGS1-1-R (Table 2).
Chun Z., Yu Q., Han H., Yu C., Nyporko A.Y., Tian X., Beckie H.J., & Powles S.B. (2024). A naturally evolved mutation (Ser-59-Gly) in glutamine synthetase confers glufosinate resistance in plants.
Publication 2024
2
Characterization of Transgenic Rice Expressing Mutant EiGS1
Not available on PMC !
Wild type and mutant EiGS1 (EiGS1-1-WT and EiGS1-1-R59, respectively) coding sequences were amplified using the primer pair pOX-GS1-F and pOX-GS1-R (Table 2). The PCR conditions were 35 cycles at 98°C for 10 s, 55°C for 15 s and 72°C for 30 s, followed by 72°C for 7 min. The amplicons were sub-cloned into the pOX vector using the In-fusion HD Cloning kit (Takara). The recombinant vectors were introduced into Agrobacterium tumefaciens strain EHA105, which was then used to transform Nipponbare rice.
Hygromycin-resistant (50 mg L -1 ) and proliferating calli were transferred onto fresh N6D plates containing glufosinate at 0, 50, 100, 200 or 400 μM. For each glufosinate concentration, 10 transformed calli were used, and growth response to glufosinate compared between WT and R59 transformants 18 days after treatment. Hygromycin-resistant and glufosinate-untreated calli were transferred to differentiation and rooting medium to obtain transgenic rice seedlings. The introduction of the transgene into rice calli and seedlings was confirmed by PCR using the primer pair HygF/HygR (Table 2) amplifying the hygromycin phosphotransferase (hpt) gene.
Seedlings of five T1 WT and five mutant R59 transgenic lines were tested for response to glufosinate (990 g ha -1 ). Surviving plants from each line were grown to maturity to obtain T2 seeds.
The EiGS1-1 gene copy number in T2 rice plants was estimated by qPCR (Ding et al., 2004) with the sucrose phosphate synthase (SPS) gene used as the endogenous reference gene. Primers for EiGS1-1 and SPS gene copy number detection are listed in Table2. Three WT and three R59 T2 lines with a single copy of EiGS1-1 were used for the glufosinate sensitivity test. These T2 lines were foliar sprayed with glufosinate (0, 248, 495, 990, 1480 and 1980 g ha -1 for WT and 0, 495, 990, 1480 WT and 0, 495, 990, , 1980 WT and 0, 495, 990, and 2970 g ha -1 for R59), and plant survival was determined three weeks after treatment. The experiment was conducted in a glasshouse during the normal warm rice growing season at Guangdong Academy of Agricultural Sciences, China. There were three replicate pots per treatment each containing eight seedlings.
Chun Z., Yu Q., Han H., Yu C., Nyporko A.Y., Tian X., Beckie H.J., & Powles S.B. (2024). A naturally evolved mutation (Ser-59-Gly) in glutamine synthetase confers glufosinate resistance in plants.
Publication 2024
3
Glutamine Synthetase Enzyme Assay
Not available on PMC !
GS activity in E. indica tissue extracts and in yeast recombinant EiGS1-1 proteins was measured by the γ-transferase assay (GS-dependent formation of γ-glutamyl hydroxamate) (Pateman 1969 ) using a commercial detection kit (Solabio, Beijing, China). Assays were conducted in the presence of glufosinate at final concentrations of 0, 0.001, 0.01, 0.025, 0.05, 0.1, 0.5, and 1 mM. The reaction product was measured spectrophotometrically for absorbance at 540 nm. Protein concentration was determined for sample calibration. Assays using E. indica tissue extracts contained three biological replicates and those using yeast recombinant EiGS1-1 proteins contained three technical replicates.
Kinetic characterization (Km and Vmax) of recombinant EiGS1-1 proteins was performed for the two substrates, glutamate and ATP, by the biosynthetic assay (Jalaludin et al., 2017) . The reaction mixture consisted of 100 mM Tris-HCl (pH 7.5), 10 mM ATP, 20 mM MgCl2, 30 mM hydroxylamine and 20 mM glutamate.
Chun Z., Yu Q., Han H., Yu C., Nyporko A.Y., Tian X., Beckie H.J., & Powles S.B. (2024). A naturally evolved mutation (Ser-59-Gly) in glutamine synthetase confers glufosinate resistance in plants.
Publication 2024
4
Persistence of Radiolabeled Herbicides on Dormant Zoysiagrass
Not available on PMC !
A growth chamber study was conducted at the Virginia Tech Glade Road Research Facility (GRRF) (37.23, -80.44 ) in 2020 to determine the persistence of 14 C-glufosinate and 14 Cglyphosate on dormant zoysiagrass leaves. The experiment was implemented as a completely randomized design, twofactor factorial with four replications and two temporal runs. The two factors were herbicide (glufosinate and glyphosate) and harvest time (0.2, 1, 3, 7, 14, and 21 days after treatment). Dormant Zenith zoysiagrass leaves were collected from a site mowed to a height of 7 cm. The leaves were clipped to 2.5-cm long pieces and treated with three 1-μL droplets containing 4.0 kBq 14 C-glufosinate or 14 C-glyphosate. The glyphosate (phosphonomethyl-14 C, specific activity = 50 μCi mmol -1 , purity 99%) spotting solution was converted to the isopropylamine salt by combining 200 μL 14 C-glyphosate acid with 1.6 μL isopropyl amine, then adding 0.8% v v -1 MON56164 surfactant (Monsanto Company). Radio-labeled glufosinate (glufosinate hydrochloride, specific activity = 51.8 μCi mg -1 , purity = 99%) with 0.1% v v -1 nonionic surfactant (Induce; Helena) was used for spotting solution. The treated leaves were placed in dry Petri dishes and incubated for up to 21 days in a growth chamber maintained at 30˚C day and 25˚C night temperatures, respectively, with 330 μmol m -2 s -1 photosynthetically active radiation (PAR) for 12-h photoperiod each day.
At each harvest time, leaves were vortexed for 30 s in 10 mL of deionized water to remove water-extractable radio-labeled herbicide. Then, leaf tissues were immersed in liquid nitrogen, followed by grinding of plant material with a mortar and pestle. A 2 mL extraction solution, 1:1 methanol:deionized water was added to the grounded plant tissue and further homogenized using the motor and pestle. The ground plant material and extraction solution were suction filtered using a Buchner funnel fitted with Whatman No. 1 filter paper (Whatman International Ltd.). The mortar, pestle, funnel, and filter paper were further rinsed with an additional 8 mL of extraction solution. A 0.5 mL aliquot from the resulting extract was added to 15 mL of scintillation fluid (Sciniti Verse LC Cocktail Scitanalyzed; Fisher Scientific), and total radioactivity was measured via liquid scintillation spectrometry (LSS 6500 Multipurpose Scintillation Counter; Beckman Coulter Inc.). Homogenates from previously described extraction and filtration procedures were dried in a nitrogen evaporator (N-EVAP 112; Organomation Associates Inc.) and residues were resuspended with 500 μL cold methanol. Of this resuspended solution, 100 μL was then delivered to a 20-cm by 20-cm silica gel thin layer chromatography (TLC) plate (TLC Silica gel 60G F 254 ; Millipore Sigma) and developed in a 55 mL ethanol, 35 mL H 2 O, 2.5 mL of 15 N NH 4 OH, 3.5 g trichloroacetic acid, and 2 mL of 17 N acetic acid (Sprankle et al., 1978) (link) within an airtight glass chamber. The plates were then air-dried, and radioactive positions, proportions, and corresponding R f values were determined with a radiochromatogram scanner (Bioscan, System 200 Imaging Scanner and Auto Changer 1000; Bioscan Inc.). Parent herbicide was identified by comparing it with radio-labeled standards spotted on adjacent lanes of each plate. Radioactive trace peaks were integrated with Win-Scan software (WIN-SCAN Imaging Scanner Software Version 1.6c; Bioscan Inc.) with smoothing set to 13-point cubic and background excluded
Godara N., Craft J.M., Gonçalves C.G., & Askew S.D. (2024). Persistence and relocation of dislodgable herbicide residue from simulated rainfall following glyphosate treatment to dormant zoysiagrass turf. Crop Science.
Publication 2024
5
Evaluating Glufosinate Resistance in E. indica
Not available on PMC !
The glufosinate-resistant (R) E. indica sub-population derived from a multiple herbicide resistance population and a glufosinate-susceptible (S) population (Jalaludin et al., 2015) were used in this study.
The R population was further purified by treating four-leaf stage plants with glufosinate (Basta, 200 g L -1 , SC; Bayer CropScience) at 990 g ha -1 (2x recommended field rate). Glufosinate was applied using an in-house cabinet sprayer delivering 118 L ha -1 at 200 kPa with a speed of 1 m s -1 . Plants were grown in a glasshouse during the summer season at the University of Western Australia (Perth, Australia).
Surviving individuals (eight plants), together with eight untreated plants from the S population, were separately bulked up for seeds and progeny plants were used for subsequent experiments.
In addition, E. indica seeds were collected from 18 field populations (complaint and random samples) from Guangdong province, South China (Table 1), as well as a known glufosinatesusceptible population (referred to as S1) with no glufosinate exposure history. Seedlings were grown outdoors in pots contining autoclaved field soil during the summer growing season at the Academy of Guangdong Agricultural Sciences (Guangzhou, China). At the four-to five-leaf stage, seedlings (40 seedlings per population) were treated with glufosinate (990 g ha -1 ) in a laboratory sprayer delivering 270 mL min -1 at 0.3 MPa with a speed of 0.4 m s -1 (model ASS-4. Beijing, China). Plant survival was determined three weeks after treatment and the experiment was repeated.
Chun Z., Yu Q., Han H., Yu C., Nyporko A.Y., Tian X., Beckie H.J., & Powles S.B. (2024). A naturally evolved mutation (Ser-59-Gly) in glutamine synthetase confers glufosinate resistance in plants.
Publication 2024

Top products related to «Glufosinate»

1
Glufosinate ammonium by Merck Group
Sourced in United States, Germany
Glufosinate ammonium is a broad-spectrum herbicide used in agriculture. It is a synthetic organic compound that inhibits the enzyme glutamine synthetase, which is essential for plant growth and development. This disruption of the plant's metabolism leads to the accumulation of toxic levels of ammonia, resulting in the plant's death. Glufosinate ammonium is commonly used in various crops, including genetically modified crops, to control a wide range of weeds.
2
Glufosinate by Merck Group
Sourced in United States, Germany
Glufosinate is a broad-spectrum herbicide used in agriculture. It is a synthetic amino acid that inhibits the enzyme glutamine synthetase, which is essential for plant growth and development. Glufosinate is used to control a wide range of annual and perennial weeds.
3
Lr clonase by Thermo Fisher Scientific
Sourced in United States, Japan, Belgium, France
LR clonase is a laboratory reagent used in molecular biology for the recombination of DNA sequences. It catalyzes the integration of DNA fragments into an expression vector during the process of gene cloning. The core function of LR clonase is to facilitate the site-specific recombination of DNA sequences.
4
Chlorimuron ethyl by Merck Group
Sourced in United States, China
Chlorimuron ethyl is a chemical compound used as an active ingredient in certain herbicide products. It functions as an inhibitor of the enzyme acetolactate synthase, which is essential for the production of branched-chain amino acids in plants. This disrupts the growth and development of susceptible plant species.
5
Lr clonase 2 by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The LR Clonase II is a lab equipment product manufactured by Thermo Fisher Scientific. It is an enzyme mix used for performing site-specific recombination reactions, enabling the transfer of DNA fragments between compatible vector systems.
6
Pentr d topo by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom
The PENTR/D-TOPO is a vector system designed for the efficient cloning of Polymerase Chain Reaction (PCR) products. It facilitates the direct insertion of PCR amplicons into a plasmid vector without the need for restriction enzyme digestion or ligase. The vector is pre-linearized and contains complementary 3' single-stranded overhangs, allowing for the seamless ligation of PCR products.
7
Hygromycin by Merck Group
Sourced in United States, Germany, France, China, United Kingdom, Italy
Hygromycin is a broad-spectrum antibiotic that is commonly used as a selection marker in genetic engineering and cell culture applications. It functions by inhibiting protein synthesis in eukaryotic cells.
8
Pentr d topo vector by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Australia, Japan
The PENTR/D-TOPO vector is a plasmid designed for direct cloning of PCR products. It features a pUC origin of replication and a kanamycin resistance gene for selection in E. coli. The vector includes TOPO cloning sites that facilitate the direct insertion of PCR products without the need for restriction enzyme digestion or ligation.
9
Glufosinate by Bayer
Sourced in Australia
Glufosinate is a broad-spectrum herbicide used in laboratory settings. It functions as an inhibitor of the enzyme glutamine synthetase, which is essential for plant growth and development. Glufosinate is commonly used in research applications to study plant physiology and weed management.
10
Formic acid by Merck Group
Sourced in Germany, United States, Italy, United Kingdom, France, Spain, China, Poland, India, Switzerland, Sao Tome and Principe, Belgium, Australia, Canada, Ireland, Macao, Hungary, Czechia, Netherlands, Portugal, Brazil, Singapore, Austria, Mexico, Chile, Sweden, Bulgaria, Denmark, Malaysia, Norway, New Zealand, Japan, Romania, Finland, Indonesia
Formic acid is a colorless, pungent-smelling liquid chemical compound. It is the simplest carboxylic acid, with the chemical formula HCOOH. Formic acid is widely used in various industrial and laboratory applications.

More about "Glufosinate"

Glufosinate is a non-selective herbicide used to control a wide range of annual and perennial weeds.
It functions by inhibiting the enzyme glutamine synthetase, leading to the accumulation of ammonia and disruption of photosynthesis.
This chemical is commonly utilized in agriculture, including in genetically modified crops resistant to its effects.
Researchers can optimize their Glufosinate studies using PubCompare.ai's AI-driven platform, which helps locate the best protocols from literature, preprints, and patents, enhancing reproducibility and finding the ideal Glufosinate products with ease.
Glufosinate ammonium is the active ingredient in this herbicide, while LR clonase is a recombinant enzyme used for gene cloning.
Chlorimuron ethyl is another herbicide that can be used in conjunction with Glufosinate.
The LR Clonase II enzyme and PENTR/D-TOPO vector are also useful tools for gene manipulation and expression.
Hygromycin is an antibiotic that can be used for selection in genetic engineering experiments.
Formic acid is a related chemical that can be used in various applications.
Experince the power of AI-driven research optimization today and discover how PubCompare.ai's platform can streamline your Glufosinate studies.
Locate the best protocols, enhance reproducibility, and find the ideal products with ease.
Unlock the full potential of this versatile herbicide and take your research to new heights.