Hydroxytamoxifen

The expression vector for the fusion protein of TAM-I-SceI-TAM (TST) was generated by PCR amplification of the TAM domain from TAM-CRE [21] (link), and the I-SceI coding sequence from pCBASce, which were cloned in frame into pCAGGS-BSKX [45] (link), as shown in Figure S1. The EJ2SceGFP gene (EJ2-GFP) was generated by cloning gcctagggataacagggtaattagatgacaagcc into the XCM1 site of pCAGGS-NZEGFP [46] (link). EJ2SceGFP was then cloned into pim-DR-GFP [47] (link), and downstream of pgk-puro to generate pim-EJ2-GFP and EJ2-GFP-Puro, respectively. For EJ5-GFP, first an I-SceI site was cloned between the AgeI and BclI sites of pim-EJ2-GFP (EJ5sceGFP), and also at the HindIII site of pgk-puro (puroSce). Then, an EcoRI/I-SceI fragment of puroSce was cloned into EJ5SceGFP, followed by cloning an I-SceI site into the EcoRI site of this vector. Pim-EJ5-GFP was then completed by replacement of an EcoRI fragment that was lost in the previous step.
ES cells were cultured as previously described [45] (link), and HEK293 cells (HEK293-A7, New England Biolabs) were cultured according to the directions of the supplier, except we used DMEM high-glucose without phenol red containing Hepes buffer (Invitrogen). HEK293 cells were grown on plates treated with 0.01% poly-lysine (Sigma).
Mouse ES cell lines with DR-GFP and SA-GFP targeted to hprt or Pim1 were described previously [18] (link), [45] (link)–[47] (link). Pim-EJ2-GFP was used to target the Pim1 locus of AB2.2 wild-type ES cells [48] (link), and Ku70-/- ES cells [49] (link), using methods previously described [45] (link), except targeting was detected by PCR. Pim-DR-GFP, Hprt-SA-GFP, and EJ2-GFP-Puro were randomly integrated into HEK293 cells by electroporation with 1×10⁷ cells suspended in 800 µl PBS in a 0.4 cm cuvette, followed by pulsing the cells at 250 V, 950 µF, and selecting single clones with 3 µg/ml puromycin. Similarly, EJ2-GFP-Puro was randomly integrated into Ercc1-/- and Rad52-/- ES cells as above, except using electroporation conditions of 680 V and 10 µF. Integration of an intact copy of each randomly integrated reporter was confirmed in single clones by Southern blot analysis with a GFP fragment as the probe (data not shown).
Stable cell lines expressing TST were generated by electroporation as described above, except with voltages varying between 200–250V, with 20–30 µg of TST expression plasmid and a selection plasmid. We used two different selection cassettes, with 10 µg of pgk-bsd (gift from Dr. Pentao Liu) for the HEK293 and 5 µg of pmc1neo for the ES cells. Clones were selected in the relevant antibiotic for 6–10d at 400 µg/ml G418 or 5–10mg/ml blasticidin (Invitrogen). Individual selected clones were screened for significant induction of GFP+ cells following 24h treatment with 0.3 µM and 3 µM 4-hydroxytamoxifen (4OHT, dissolved in ethanol, Sigma) for ES and HEK293 cells, respectively.

Live Midn^−/− Sp2/0 cells fused with splenic UBC-Cre-ER^T2;Midn^fl/fl or Midn^fl/fl B cells (1 × 10⁵/well) were seeded in a 96-well plate. 4-hydroxytamoxifen (SML1666; Sigma-Aldrich) was dissolved in 95% ethanol/5% isopropanol at a concentration of 13 mM. After 24 h in culture, the cells were treated for 24 h with 4-hydroxytamoxifen at a concentration of 8.3 µM or with vehicle (95% ethanol and 5% isopropanol) diluted in the same manner as 4-hydroxytamoxifen. Every 24 h, the cells were centrifuged at 700 × g for 5 min and resuspended in 20 µl PBS. Suspended cells (10 μl) and an equal volume of Trypan Blue (10 μl) were mixed to count the total number of live cells using a TC20 Automated Cell Counter (Bio-Rad). A standard growth curve was generated by graphing cell counts every 24 h.