Luminol

Northern blot analysis was performed as described by Köhrer et al. (20 (link)) with minor variations for mini-gel format. Total tRNA samples (10 μg) were added of 2× sample buffer (0.1 M sodium acetate pH 5.0, 8 M urea, 0.05% bromophenol blue and 0.05% xylene cyanol), heated to 65°C for 5 min and loaded on freshly prepared semi-denaturing polyacrylamide gels (19:1 acrylamide/bisacrylamide) containing 7 M urea and 0.1 M sodium acetate pH 5.0. The gel was run at 5 W (100 V and 50 mA) in 0.1 M sodium acetate pH 5.0 for 3–4 h until the xylene cyanol reached the front. The RNA was transferred onto BrightStar™-Plus Nylon Membrane (ThermoFisher Scientific) at 2 mA/cm² in a semi-dry apparatus (Bio-Rad) for 35 min using transfer buffer (40 mM Tris–HCl, pH 8.0, 2 mM Na₂EDTA). The membrane was irradiated at 254 nm UV light for 50 s (120 mJ/cm² total) and pre-hybridized for 14–20 h at 42°C in 6× saline–sodium citrate buffer (SSC) containing 10× Denhardt's solution and 0.5% SDS. 5′-biotin-labeled DNA oligonucleotides complementary to tRNA^Pyl* and tRNA^M15 (CGGAAACCCCGGGAATCxAACCCGGCTGAACGGA, x = deoxyribose spacer), tRNA^C15 (CGGGAGAGGGGGGAATCGAACCCCCCTGTGTTGA), and ribosomal 5.8S RNA (CGCAAGTGCGTTCGAAGTGTCGATGATCAATGTG) were used as probes (100 pM) in the presence of a 100x excess (10 nM) of unlabeled ‘unfolder’-probes (tRNA^Pyl TCCGTTCGATCTACATGATCAGGTTTCC; tRNA^M15 TCCGTTCGGTCTCCCTGACCAGGTTTCC; tRNA^C15 TCAACACGGCCACCTTGGCCACTCTCCC). Membranes were hybridized for 12–24 h at 42°C in 6× SSC containing 0.1% SDS, washed at room temperature with 6× SSC (2 × 10 min), followed by washes at 4× and 2× SSC and incubated with streptavidin–horseradish peroxidase conjugate (1:10 000 in TBS + 0.1% Tween) for 1 h at room temperature. Membranes were washed with TBS + 0.1% Tween (3 × 10 min) and soaked in ECL reagent (0.1 M Tris–HCl pH 8.6, 22 % luminol, 10% p-coumaric acid, 10 % DMSO, 0.0001 % H₂O₂). After 1 min delay, signals were collected for 5 min in the dark (Gbox, Syngene). Signals were quantified using Image Studio software (LI-COR Biosciences, Ver5.2).

Luminol (5-amino-2,3-dihydro-1,4-phthalazinedione) and lucigenin (bis-N-methylacridinium nitrate) are used to detect reactive oxygen species (ROS). Luminol bioluminescence detects mainly to neutrophil myeloperoxidase (MPO) activity, and lucigenin bioluminescence detects NADPH oxidase activity and extracellular superoxide production of macrophages (39 (link),40 (link)). Na-luminol and lucigenin (Santa Cruz Biotechnology) were dissolved in phosphate buffered saline to form 20-mg/ml and 2.5-mg/ml stock solutions, respectively. Anesthetized mice were injected intraperitoneally with 150 mg/kg luminol (days 0, 1, 2, and 4) or 25 mg/kg lucigenin (days 0, 2, 6, and 10). Bioluminescence imaging was performed 10 minutes postinjection using an IVIS Lumina II. Acquisition time was 60 seconds, F-stop 1, Binning 8. Data were analyzed and ROIs were applied; luminescence was expressed as total radiance (photons/second/cm²/steradian) within the ROIs.

Cells were washed twice with PBS containing CaCl₂ and then lysed in a 100 mM NaCl, 1% NP40, 0.1% SDS, 50 mM Tris pH 8.0 RIPA buffer supplemented with a complete protease inhibitor cocktail (Roche, Mannheim, Germany) and phosphatase inhibitors (Sigma‐Aldrich). Protein expression was examined by Western blot using the anti‐ZEB1 (1/200, Sigma HPA027524, RRID:AB_1844977), anti‐ZEB2 (1/500, Sigma HPA003456, RRID:AB_10603840), anti‐MITF (clone C5, ab80651, 1/500, Abcam, RRID:AB_1603129), anti‐SOX10 (Santa Cruz, sc‐365692, RRID:AB_10844002) antibodies for primary detection. Loading was controlled using the anti‐GAPDH (1/20,000, Millipore) antibody. Horseradish peroxidase‐conjugated rabbit anti‐mouse, goat anti‐rabbit, and donkey anti‐goat polyclonal antibodies (Dako, Glostrup, Denmark) were used as secondary antibodies. Western blot detections were conducted using the Luminol reagent (Santa Cruz).

A quantitative assay was performed to measure the generation of ROS in different conditions. ROS generated in response to glucose treatment at different time points was measured using Luminol/HRP chemiluminescence assay for ROS detection. Briefly, PMNs were seeded in 96-well black plate (Corning 3,991 polystyrene flat bottom) in triplicates and 50 μM Luminol (Sigma- Aldrich A4685) and 1.2 U/ml horseradish peroxidase (Sigma- Aldrich P8250) were added to each well. As a positive control, PMNs were stimulated with 600 nM PMA (Sigma P8139). Plates were gently tapped to ensure mixing of all reagents. Luminescence was immediately measured by taking multiple readouts for up to 5 min in a luminometer (Perkin Elmer).