Methacarn

For RNAi analysis of pc2, EST clone PL05006A1C09 [98] (link), which corresponds to pc2, was shuttled to plasmid pPR244 using a Gateway reaction (Invitrogen, Carlsbad, CA) [47] (link). For npy-8 RNAi, a 3′ RACE product specific to npy-8 was cloned in pJC53.2. RNAi feedings were performed essentially as described previously [112] (link), with some modifications. In pc2 RNAi experiments, ∼6.25 mL of IPTG-induced culture was pelleted, frozen at −80°C, and resupended in 30 µL of a mixture of homogenized beef liver and water. ∼5 mature sexual animals (>1 cm in length) received 1–2 feedings over the course of ∼48 h. npy-8 RNAi experiments were performed similarly to pc2 RNAi except feedings included 50% less bacteria and animals were fed every 5–7 d over the indicated time course; for some feedings, bacteria were omitted. On occasion, because of either refusal to feed or improper nutrition, some animals (both controls and treatment groups) decreased in size over the long time courses of the npy-8 RNAi experiments. Therefore, only animals >1 cm in length at the time of fixation were included in our analyses at time points greater than 4 wk. For all RNAi experiments with bacterially expressed dsRNA, control feedings were performed with bacteria containing empty plasmid pPR242.
For RNAi experiments conducted with juvenile planarians, dsRNA was generated by in vitro transcription [113] (link),[114] (link). To generate dsRNA, templates cloned in pJC53.2 were amplified with a modified T7 oligonucleotide (GGATCCTAATACGACTCACTATAGGG), cleaned up using the DNA Clean & Concentrator kit (Zymo Research, Orange, CA, D4003), and eluted in 10 µL of water. 4 µL of each PCR product was used as template for in vitro transcription in a reaction containing 5.5 µL DEPC-treated water, 5 µL 100 mM mix of rNTPs (Promega, E6000), 2 µL high-yield transcription buffer (0.4 M Tris pH 8.0, 0.1 M MgCl2, 20 mM spermidine, 0.1 M DTT), 1 µL thermostable inorganic pyrophosphatase (New England Biolabs, Madison, WI, M0296S), 0.5 µL Optizyme recombinant ribonuclease inhibitor (Fisher Scientific, Pittsburg, PA, BP3222-5), and 2 µL HIS-Tagged T7 RNA polymerase [115] (link). Samples were incubated at 37°C for 4–5 h and then treated with RNase-free DNase (Fisher Scientific, Pittsburg, PA, FP2231). Synthesized RNA was then melted by heating at 75°C, 50°C, and 37°C each for 3 min. 2.5–10 µg of each dsRNA solution was mixed with 45 µL of 3∶1 liver to water mix and used to feed up to 8 worms. For these experiments, animals without visible gonopores (juveniles) were fed every 4–5 d for the indicated time period and starved 1 wk before fixation. Unless otherwise specified, as a negative control, animals were fed dsRNA synthesized from the ccdB and camR-containing insert of pJC53.2.
To analyze the structure of the testes, animals were killed in 2% HCl for 3 min, fixed in either Methacarn (6 MeOH:3 Chloroform: 1 Glacial Acetic Acid) or 4% formaldehyde for 1–2 h, dehydrated in MeOH, bleached in 6% H₂O₂ in MeOH, and stained with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, St. Louis, MO). Alternatively, samples were processed for in situ hybridization, as described above. Following staining, animals were mounted in Vectashield, flattened, and imaged on either a Zeiss SteREO Lumar (Carl Zeiss, Germany) or a Zeiss LSM 710 confocal microscope (DAPI was excited with a 405 nm laser).

Muscle biopsy samples were obtained from the gastrocnemius of the more symptomatic limb of each patient. All muscle samples were obtained from the anteromedial aspect of the gastrocnemius belly, at a level 10 cm distal to the tibial tuberosity. The muscle samples were obtained with a 6-mm Bergstrom needle or using an open technique in those instances when the patient was having a vascular operation which involved an incision in his/her calf. The samples were placed immediately in cold methacarn. After 48 h in methacarn, the specimens were transferred to cold ethanol:H₂O (50:50 v/v) and subsequently embedded in paraffin.