Nutlin-3A

Nutlin-3a, an inhibitor of MDM2 that is reported to bind directly to MDM2, release, stabilize and activate p53 ^{10 (link)}, was acquired from Cayman Chemical Company. Brefeldin A, N-benzyloxycarbonyl-Val-Ala-Asp(O-Me) fluoromethyl ketone(zVAD-fmk) and other chemicals were purchased from Sigma Aldrich or Fisher Scientific or were synthesized according to literature procedures. The synthesis of Arylquin 1, which utilized 4-(N,N-dimethylamino)-2-aminobenzaldehyde in a Friedländer condensation with 2-fluorophenylacetontrile ¹⁵ , and other heterocyclic families is described in Supplementary Note. The condensation of 2-amino-4-(N,N-dimethylamino)benzaldehyde with 2-(2-fluorophenyl)acetyl chloride secured 7-(dimethylamino)-3-(2-fluorophenyl)quinolin-2(1H)-one, and treatment with Lawesson's reagent ¹⁶ provided 7-(dimethylamino)-3-(2-fluorophenyl)quinoline-2(1H)-thione. S-alkylation of this intermediate with (+)-biotinyl-iodoacetamidyl-3,6-dioxaoctanediamine led to biotinylated Arylquin 9 (Supplementary Note). Solvents were used from commercial vendors without further purification unless otherwise noted. Nuclear magnetic resonance spectra were determined on a Varian instrument (¹H, 400MHz; ¹³C, 100Mz). High resolution electrospray ionization (ESI) mass spectra were recorded on a LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA). The FT resolution was set at 100,000 (at 400 m/z). Samples were introduced through direct infusion using a syringe pump with a flow rate of 5 µL/min. MALDI mass spectra were obtained on a Bruker Utraflexstreme time-of-flight mass spectrometer (Billerica, MA), using DHB (2,5-dihydroxybenzoic acid) matrix. Purity of compounds was established by combustion analyses by Atlantic Microlabs, Inc., Norcross, GA. Compounds were chromatographed on preparative layer Merck silica gel F254 unless otherwise indicated.

For the generation of p53 knockout cells using CRISPR-Cas9 gene editing, sgRNAs targeting the TP53 gene were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 and lentiCRISPR v1 vectors (Addgene) as previously described49 (link). sgRNA sequences are as follows: i1.1 TCTGCAGGCCCAGGTGA.CCCagg, i1.2 GGGTTGGAAGTGTCTCA.TGCtgg, e3 ACTTCCTGAAAACAACG.TTCtgg, e5.1 GGGGGTGTGGAATCAAC. CCAagg, e5.2 GTTGATTCCACACCCCC.GCCcgg, i5 GATTCCTCACTGA TTGC.TCTtag, e7 CCGGTTCATGCCGCCCA.TGCagg, i9 GAAACTTTCCA CTTGAT.AAGagg, GFP GGAGCGCACCATCTTCT.TCAagg.
For enrichment assays, HCT116 and H460 cells were transfected with pX330 vectors carrying sgRNAs targeting coding exons of TP53. Six days after transfection, cells were either left untreated or were treated with 7 μM nutlin-3a or 1 μM RITA for up to 10 d. After harvesting the cells, genomic DNA was isolated using the QIAamp DNA Blood Mini Kit according to the manufacturer’s instruction and used for the T7 endonuclease I assay, deep sequencing and qPCR. For generating p53 knockout cell clones with small indel mutations, H460 and HCT116 were infected with lentiviral vectors (lentiCRISPR)50 (link) coexpression Cas9 and sgRNAs targeting central TP53 regions and selected with puromycin. For generating p53 knockout cell lines with deletions of exons 2 to 9, HCT116 cells were cotransfected with two pX330 plasmids containing sgRNAs targeting TP53 intron 1 and intron 9. Single-cell clones were tested for the presence of the deletion and absence of wild-type sequence by PCR, expanded and used for further experiments.
For sequencing of indel mutations, the region surrounding the predicted cleavage site was amplified using barcoded primers: e3_fw ACGGCAAGGGGGACTGTAG; e3_rev AGCCCCCTAGCAGAGACCTG; e5.1_fw GTGCTGTGACTGCTTGTAGATGGC; e5.1_rev CCTGACTTTC AACTCTGTCTCCTTCCTC; e5.2_fw TCCAGCCCCAGCTGCTCAC; e5.2_ rev TTGCCAACTGGCCAAGACCT. PCR products were purified and equimolar amounts were pooled. DNA (10 ng) were processed using the NEBNext ChIP-Seq Library Prep Master Mix Set (New England BioLabs). The resulting library was sequenced on a MiSeq (Illumina). Sequencing library quality and quantity was evaluated on a Bioanalyzer DNA High Sensitivity chip (Agilent) and by digital PCR, respectively. Sequencing was performed on a MiSeq (Illumina) using a 6-pM library concentration and MiSeq v2 reagent kit and flow cell in a 2 × 250 base paired-end run. Multiplexed reads were demultiplexed into separate amplicon-specific lanes by the barcoded primer combinations using an error-tolerant primer detection method using the cutadapt algorithm (maximal error rate = 0.04). Lanes were subsequently aligned with the Bowtie2 mapper (standard parametrization) to the reference genome (Ensembl revision 77, GRCh38). Reads covering the regions of interest were extracted from the aligned lanes and insertions or deletions were directly inferred from the CIGAR strings. We reported indel percentages as the number of reads carrying an insertion or deletion divided by the total number of reads covering the putative Cas9 cleavage site. Our estimates were confirmed by using the VarScan2 variant caller. As indel detection depends on an accurate alignment, we double-checked our findings using BWA (maximum gap openings = 3, max gap extensions = 100) as a second read mapper. Both aligners yielded comparable results (data not shown).