Orange G

PCR of the URA5 gene was conducted in a final volume of 50 µL. Each reaction contained 50 ng of DNA, 1X PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2; Applied Biosystems, Foster City, CA), 0.2 mM each of dATP, dCTP, dGTP, and dTTP (Roche Diagnostics GmbH), 3 mM magnesium acetate, 1.5 U AmpliTaq DNA polymerase (Applied Biosystems), and 50 ng of each primer URA5 (5'ATGTCCTCCCAAGCCCTCGACTCCG 3') and SJ01 (5'TTAAGACCTCTGAACACCGTACTC 3'). PCR was performed for 35 cycles in a Perkin-Elmer thermal cycler (model 480) at 94°C for 2-min initial denaturation, 45 s of denaturation at 94°C, 1 min annealing at 61°C, and 2-min extension at 72°C, followed by a final extension cycle for 10 min at 72°C. Amplification products were mixed with one fifth volume of loading buffer (15% Ficoll 400, 0.25% orange G, MilliQ water), 15 µL of PCR products were double digested with Sau96I (10 U/µL) and HhaI (20 U/µL) for 3 h or overnight and separated by 3% agarose gel electrophoresis at 100 V for 5 h. RFLP patterns were assigned visually by comparing them with the patterns obtained from the standard strains (VNI-VNIV and VGI-VGIV) (Jackson et al. unpub. data).

Renal tissue was fixed for at least 72 h in 5% buffered formaldehyde solution (Fischar), before dehydration in descending alcohol solution and embedding in paraffin (Thermo Fisher Scientific) were performed as described previously (18 (link)). For all histological staining procedures, 2 µm renal sections were prepared. Histopathological evaluation of renal and splenic tissue using periodic acid Schiff (PAS) staining were performed as described previously (18 (link)). Staining for kidney injury molecule-1 (KIM-1), BTK, lymphocyte antigen 6 complex (Ly6g), F4-80, CD3, Ki67 and cleaved caspase-3 (CC-3) were used to evaluate renal sections immunohistochemically. Generally, sections were deparaffinized and hydrated as described previously (18 (link)). Blocking of endogenous peroxidase was performed using 3% H₂O₂ (Carl Roth) and target retrieval solution (pH 6; Dako) was utilized for antigen retrieval in a pressure cooker. Bovine serum albumin (BSA; Sigma Aldrich) or 20% serum (PAA Laboratories) as well as avidin and biotin solution (15 min each; Vector Laboratories) were used each to block unspecific binding sites (Supplementary Table S3). Renal sections were incubated with primary antibody (Supplementary Table S4) overnight at 4°C. Sections were further incubated with secondary antibody (Supplementary Table S5) and with VectaStain ABC kit (Vector Laboratories) for 30 min each (Supplementary Table S3 for detailed information). As substrate, 3,3-diaminobenzidine (DAB; Vector Laboratories) was used and sections were counterstained with hemalaun (Carl Roth). Finally, renal sections were dehydrated and mounted for observation. Tris(hydroxymethyl)aminomethan (TRIS) buffer (pH 7.6) containing 50 mM TRIS (Carl Roth), 300 mM sodium chloride (Carl Roth), 0.04% Tween^® 20 (Sigma Aldrich) was used to wash renal sections between the staining processes. Staining of thrombocytes (glycoprotein-1b (GP1b)) and fibrin deposition (acid fuchsin–Orange G stain (SFOG)) was performed as described previously (18 (link), 19 (link)).