Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Phenazines

Phenazines

Phenazines are a class of heterocyclic organic compounds characterized by a tricyclic aromatic system.
These versatile molecules exhibit a wide range of biological activities, including antimicrobial, antitumor, and redox-modulating properties.
Phenazines are produced by various microorganisms and have been studied extensively for their potential applications in medicine, agriculture, and environmental remediation.
Researchers can leverage AI-driven platforms like PubCompare.ai to optimize their Phenazine research, identify the most reproducible and accurate protocols, and enhance their studies with the best available products and methods.
This powerful tool can help accelerate discovery and advance our understanding of these fascinating compounds.

Most cited protocols related to «Phenazines»

1
Expanded Secondary Metabolite Detection in antiSMASH 2.0
Cited 25 times
In addition to the secondary metabolite cluster types supported in the original release of antiSMASH (type I, II and III polyketides, non-ribosomal peptides, terpenes, lantipeptides, bacteriocins, aminoglycosides/aminocyclitols, β-lactams, aminocoumarins, indoles, butyrolactones, ectoines, siderophores, phosphoglycolipids, melanins and a generic class of clusters encoding unusual secondary metabolite biosynthesis genes), version 2.0 adds support for oligosaccharide antibiotics, phenazines, thiopeptides, homoserine lactones, phosphonates and furans. The cluster detection uses the same pHMM rule-based approach as the initial release (17 (link)): in short, the pHMMs are used to detect signature proteins or protein domains that are characteristic for the respective secondary metabolite biosynthetic pathway. Some pHMMs were obtained from PFAM or TIGRFAM. If no suitable pHMMs were available from these databases, custom pHMMs were constructed based on manually curated seed alignments (Supplementary Table S1). These are composed of protein sequences of experimentally characterized biosynthetic enzymes described in literature, as well as their close homologs found in gene clusters from the same type. The models were curated by manually inspecting the output of searches against the non-redundant (nr) database of protein sequences. The seed alignments are available online at http://antismash.secondarymetabolites.org/download.html#extras. After scanning the genome with the pHMM library, antiSMASH evaluates all hits using a set of rules (Supplementary Table S2) that describe the different cluster types. Unlike the hard-coded rules in the initial release of antiSMASH, the detection rules and profile lists are now located in editable TXT files, making it easy for users to add and modify cluster rules in the stand-alone version, e.g. to accommodate newly discovered or proprietary compound classes without code changes. The results of gene cluster predictions by antiSMASH are continuously checked on new data arising from research performed throughout the natural products community, and pHMMs and their cut-offs are regularly updated when either false positives or false negatives become apparent.
The profile-based detection of secondary metabolite clusters has now been augmented by a tighter integration of the generalized PFAM (22 (link)) domain-based ClusterFinder algorithm (Cimermancic et al., in preparation) already included in version 1.0 of antiSMASH. This algorithm performs probabilistic inference of gene clusters by identifying genomic regions with unusually high frequencies of secondary metabolism-associated PFAM domains, and it was designed to detect ‘classical’ as well as less typical and even novel classes of secondary metabolite gene clusters. While antiSMASH 1.0 only generated the output of this algorithm in a static image, version 2.0 displays these additional putative gene clusters along with the other gene clusters in the HTML output. A key advantage of this is that these putative gene clusters will now also be included in the subsequent (Sub)ClusterBlast analyses.
Blin K., Medema M.H., Kazempour D., Fischbach M.A., Breitling R., Takano E, & Weber T. (2013). antiSMASH 2.0—a versatile platform for genome mining of secondary metabolite producers. Nucleic Acids Research, 41(Web Server issue), W204-W212.
Publication 2013
Amino Acid Sequence Aminocoumarins Aminoglycosides Anabolism Antibiotics Bacteriocins Biosynthetic Pathways Childbirth Classes Enzymes Furans Gene Clusters Generic Drugs Genes Genome Genomic Library homoserine lactone Indoles Lactams Melanins Natural Products Oligosaccharides Peptides Phenazines Phosphonates Polyketides Prognosis Protein Domain Proteins Ribosomes Secondary Metabolism Siderophores Terpenes
2
Quantification of Pyocyanin and Hydrogen Peroxide Production by P. aeruginosa
Cited 18 times
Pyocyanin production by P. aeruginosa strains in the LB medium at various growth times was measured by taking 200 µl of bacterial cell free supernatant in 96-well microtiter plates and absorbance was recorded at 691 nm (λmax of pyocyanin) [29] using a microplate reader (VERSA max, Bio-Strategy Pty Ltd, Australia).
H2O2 generation in the LB medium mediated by phenazine production by various P. aeruginosa strains at various growth times was measured using a colorimetric assay [17] (link). To a freshly prepared solution of 160 µl of sodium acetate (0.1 M) containing 0.1 µg of horseradish peroxidase (Thermo Scientific) and 10 µl of 1 mg/ml of o- dianisidine (Alfa Aesar) in methanol (Unichrom, Ajax Finechem Pty Ltd, Australia), 40 µl of the bacterial cell free supernatants were added in 96-well microtiter plates and incubated for 10 min at room temperature protected from light. The absorbance of H2O2 in the mixture solution was determined using a microplate reader (VERSA max, Bio-Strategy Pty Ltd, Australia) at 570 nm. For standards commercially available 30% H2O2 (Univar, USA) was diluted in LB medium to 0.01%. The absorbance of 0.01% H2O2 (absorbance = 0.11 at 570 nm) is measured as described above by mixing 40 µl 0.01% H2O2 with 160 µl of mixture solution.
Das T, & Manefield M. (2012). Pyocyanin Promotes Extracellular DNA Release in Pseudomonas aeruginosa. PLoS ONE, 7(10), e46718.
Full text: Click here
Publication 2012
Bacteria Biological Assay Cells Colorimetry Dianisidine Horseradish Peroxidase Light Methanol Peroxide, Hydrogen Phenazines Pseudomonas aeruginosa Pyocyanine Sodium Acetate Strains
3
Comprehensive Microbial Secondary Metabolite Prediction
Cited 13 times
We used PRISM 4 and antiSMASH 5 to predict the chemical structures of secondary metabolites encoded within 3759 complete bacterial genomes and 6362 metagenome-assembled genomes (MAGs). All bacterial genomes with an assembly level of ‘Complete’ were downloaded from NCBI Genome, and a set of dereplicated genomes as determined by the Genome Taxonomy Database15 (link) were retained to mitigate the impact of highly similar genomes on our analysis. Similarly, a set of 7902 MAGs23 (link) was obtained from NCBI BioProject (accession PRJNA348753) and the subset of dereplicated genomes was retained. Detected BGCs were matched between PRISM and antiSMASH if their nucleotide sequence overlapped over any range. A small number of PRISM BGC types were mapped to more than one antiSMASH BGC type, including aminoglycosides (‘amglyccycl’ and ‘oligosaccharide’), type I polyketides (‘t1pks’ and ‘transatpks’), and RiPPs (‘bottromycin’, ‘cyanobactin’, ‘glycocin’, ‘head_to_tail’, ‘LAP’, ‘lantipeptide’, ‘lassopeptide’, ‘linaridin’, ‘microviridin’, ‘proteusin’, ‘sactipeptide’, and ‘thiopeptide’). The “hybrid” category encompassed all BGCs assigned any combination of two or more cluster types, i.e., it was not limited to hybrid NRPS-PKS BGCs. The “other” category encompassed aryl polyenes, bacteriocins, butyrolactones, ectoines, furans, homoserine lactones, ladderanes, melanins, N-acyl amino acids, NRPS-independent siderophores, phenazines, phosphoglycolipids, resorcinols, stilbenes, terpenes, and type III polyketides. Producing organism taxonomy was based on genome phylogeny and retrieved from the Genome Taxonomy Database15 (link).
Cheminformatic metrics, including molecular weight, number of hydrogen bond donors and acceptors, octanol-water partition coefficients, and Bertz topological complexity, were calculated in RDKit. Both platforms occasionally generated very small, non-specific structure predictions (for example, a single unspecified amino acid or a single malonyl unit) that did not provide actionable information about the chemical structure of the encoded product; to remove these from consideration, we applied a molecular weight filter to remove structures under 100 Da output by either platform. To evaluate the internal structural diversity of each set of predicted structures, we computed the distribution of pairwise Tcs for each set45 , taking the median pairwise Tc instead of the mean as a summary statistic to ensure robustness against outliers. Structural similarity to known natural products was assessed using the RDKit implementation of the ‘natural product-likeness’ score22 (link), and by the median Tc between predicted structures and the known secondary metabolite structures deposited in the NP Atlas database46 (link).
Skinnider M.A., Johnston C.W., Gunabalasingam M., Merwin N.J., Kieliszek A.M., MacLellan R.J., Li H., Ranieri M.R., Webster A.L., Cao M.P., Pfeifle A., Spencer N., To Q.H., Wallace D.P., Dejong C.A, & Magarvey N.A. (2020). Comprehensive prediction of secondary metabolite structure and biological activity from microbial genome sequences. Nature Communications, 11, 6058.
Full text: Click here
Publication 2020
Amino Acids Aminoglycosides Bacteriocins Base Sequence bottromycin cyanobactins Donors Furans Genome Genome, Bacterial Head homoserine lactone Hybrids Hydrogen Bonds Melanins Metagenome Natural Products Octanols Oligosaccharides Phenazines Polyenes Polyketides prisma Prokaryotic Cells Resorcinols Secondary Metabolism Siderophores Stilbenes Tail Terpenes
4
Killing Assay for Caenorhabditis elegans
Cited 6 times
Killing assays were performed as previously described [8] (link). In order to have fourth larval stage (L4) worms for killing assays, 10 gravid worms were picked to a 60 mm plate with NGM agar and a lawn of E. coli OP50 as a food source. Gravid worms were kept on plates for 16 hours at 15°C, after which they were removed. Plates were returned to 15°C for 8 hours, after which they were transferred to 20°C. Eggs hatched and grew to L4 stage approximately 36 hours after transfer. Proper staging of L4 worms was critical to the reproducibility of the assay, as worms that were younger or older were killed less quickly than L4 stage worms.
Killing agar plates were prepared by spreading 5 µL of overnight culture of PA14 in LB on a 35 mm petri plate containing 4 mL of PGS agar (1% bacto-peptone, 1% glucose, 1% NaCl, 150 mM sorbitol, 1.7% bacto-agar). Plates were incubated for 24 hours at 37°C and then transferred to 23°C for 24 hours. L4 stage worms were put on the plates, which remained at room temperature until the completion of the assay. Worms were scored as live or dead based on movement elicited by tapping their heads gently with a thin wire.
To mix the agars of plates seeded with different PA14 strains, bacteria were scraped off the surface of the agar with a cell scraper after which the agar was melted by heating in a microwave. The hot agars were mixed, repoured into plates, and allowed to cool. In experiments where phenazines or buffer were added, plate agar was melted, concentrated buffer and/or phenazine stock solution (in DMSO) was added and mixed, after which plates were repoured and allowed to cool.
Cezairliyan B., Vinayavekhin N., Grenfell-Lee D., Yuen G.J., Saghatelian A, & Ausubel F.M. (2013). Identification of Pseudomonas aeruginosa Phenazines that Kill Caenorhabditis elegans. PLoS Pathogens, 9(1), e1003101.
Full text: Click here
Publication 2013
Agar Bacteria Bacto-peptone Biological Assay Buffers Cells Eggs Escherichia coli Food Glucose Head Helminths Larva Microwaves Movement Phenazines PRO 140 Sodium Chloride Sorbitol Strains Sulfoxide, Dimethyl Youth
5
C. elegans Pathogenesis and Genetic Manipulations
Cited 5 times

C. elegans were grown on standard NGM plates with E. coli OP50 [37] (link) unless otherwise noted. The previously published C. elegans strains used in this study were: N2 Bristol [37] (link), pmk-1(km25)[5] (link), AY101 [acIs101[pDB09.1(pF35E12.5::GFP); pRF4(rol-6(su1006))] [10] (link), XA7702 mdt-15(tm2182)[19] (link), [21] (link), CF512 fer-15(b26);fem-1(hc17)[38] (link), and AU0133 [agIs17(pirg-1::GFP; pmyo-2::mCherry)] [14] (link). The C. elegans strains created for this study were: AU0307 [agIs44(pF08G5.6::GFP::unc-54-3′UTR; pmyo-2::mCherry)], AU0316 [mdt-15(tm2182); agIs44], AU0325 [mdt-15(tm2182); agEx116 (mdt-15;pmyo-3::mCherry)], AU0326 [mdt-15(tm2182); agEx117 (mdt-15;pmyo-3::mCherry)], AU0327 [mdt-15(tm2182); agEx118 (mdt-15;pmyo-3::mCherry)] and AU0323 [mdt-15(tm2182); agIs44; agEx114 (mdt-15;pmyo-3::mCherry)].
The strain carrying agIs44 was constructed by PCR amplification from N2 genomic DNA of an 851 bp region upstream of the start codon of the F08G5.6 gene (primers GACTTGTCAAATGAACAATTTTATCAAATCTCA and CGCCTAGGTGTCAATTGATAATGAATA) and ligated to the GFP coding region and unc-54-3′UTR sequences amplified from pPD95.75 using published primers, and a previously described protocol [39] (link). The agIs44 construct was transformed into N2 animals with the co-injection marker pmyo-2::mCherry using established methods [40] (link). A strain carrying the pF08G5.6::GFP::unc-54-3′UTR and pmyo-2::mCherry transgenes in an extrachromosomal array was irradiated, and strains carrying the integrated array agIs44 were isolated. AU0307 was backcrossed to N2 five times.
The mdt-15 rescuing arrays agEx116, agEx117 and agEx118 contain a 4.8 kb mdt-15 genomic fragment, which includes 707 bp upstream and 1075 bp downstream of the mdt-15 coding region, amplified from N2 genomic DNA (primers GGAGTATCAGAAGCTCACGATGCTC and CCAAATAATACTAACCACCACATATCTTCCATT). This mdt-15 genomic fragment was transformed into N2 animals or AU0316 with the co-injection marker pmyo-3::mCherry using established methods.
RNAi clones presented in this study were from the Ahringer [41] (link) or Vidal [42] (link) RNAi libraries unless otherwise stated. The atf-7[12] (link) and the pmk-1[5] (link) RNAi clones have been previously reported. All RNAi clones presented in this study have been confirmed by sequencing. The P. aeruginosa strain PA14 were used for all studies, unless otherwise indicated. The P. aeruginosa strains used in Figure S1 have been previously described [13] (link) and were (in order of descending virulence toward C. elegans): CF18, PA14, MSH10, S54485, PA01, PAK, 19660, and E2. The P. aeruginosa PA14 phenazine null mutant (Δphz) lacks both the phzA1-G1 and phzA2-G2 operons and has been previously described [43] (link). The BL21 E. coli strain that expresses the bacterial toxin Exotoxin A (ToxA) has been previously described [15] (link).
Pukkila-Worley R., Feinbaum R.L., McEwan D.L., Conery A.L, & Ausubel F.M. (2014). The Evolutionarily Conserved Mediator Subunit MDT-15/MED15 Links Protective Innate Immune Responses and Xenobiotic Detoxification. PLoS Pathogens, 10(5), e1004143.
Full text: Click here
Publication 2014
Animals Bacterial Toxins Caenorhabditis elegans Clone Cells Codon, Initiator Escherichia coli Exotoxins Genes Genome Oligonucleotide Primers Operon Phenazines PRO 140 Pseudomonas aeruginosa RNA Interference Strains Transgenes Virulence

Most recents protocols related to «Phenazines»

1
Engineering Attenuated Pseudomonas Strain for Alginate
Not available on PMC !

Example 1

To generate an attenuated strain of P. aeruginosa for production of alginate, the following virulence factor genes were sequentially deleted from the chromosome of the wild-type strain PAO1: toxA, plcH, phzM, wapR, and aroA. toxA encodes the secreted toxin Exotoxin A, which inhibits protein synthesis in the host by deactivating elongation factor 2 (EF-2). plcH encodes the secreted toxin hemolytic phospholipase C, which acts as a surfactant and damages host cell membranes. phzM encodes phenazine-specific methyltransferase, an enzyme required for the production of the redox active, pro-inflammatory, blue-green secreted pigment, pyocyanin. wapR encodes a rhamnosyltransferase involved in synthesizing O-antigen, a component of lipopolysaccharide (LPS) of the outer membrane of the organism. aroA encodes 3-phosphoshikimate 1-carboxyvinyltransferase, which is required intracellularly for aromatic amino acid synthesis. Deletion of aroA from the P. aeruginosa genome has previously been shown to attenuate the pathogen. Each gene was successfully deleted using a homologous recombination strategy with the pEX100T-Not1 plasmid. The in-frame, marker-less deletion of these five gene sequences was verified by Sanger sequencing and by whole genome resequencing (FIG. 1 and FIG. 8). This engineered strain was designated as PGN5. The whole genome sequence of PGN5 has been deposited to NCBI Genbank with an accession number of CP032541. All five in-frame gene deletions were detected and validated to be the deletion as designed using PCR (FIG. 7).

To verify gene deletion and attenuation of the PGN5 strain, the presence of the products of the deleted genes was measured and was either undetectable, or significantly reduced in the PGN5 strain. To test for the toxA gene deletion in PGN5, a Western blot analysis was performed for the presence of Exotoxin A in the culture medium. Exotoxin A secretion was detected in wild-type PAO1 control, but not in the PGN5 strain (FIG. 2A). To confirm the loss of plcH, hemolysis was assessed on blood agar. The hemolytic assay was carried out by streaking PAO1, PGN5, P. aeruginosa mucoid strain VE2, and a negative control, Escherichia coli strain BL21 on blood agar plates. A clear zone was observed surrounding PAO1 and VE2 cell growth, indicating complete (β-) hemolysis (FIG. 2B). In contrast, the blood agar remained red and opaque surrounding PGN5 and BL21 growth, indicating negligible or no hemolytic activity in these strains (FIG. 2B). To assess for deletion of phzM, the amount of pyocyanin secreted by PAO1 and PGN5 was extracted and measured. The amount of pyocyanin detected was significantly reduced in PGN5 (FIG. 2C). In fact, the difference in pigment production between PAO1 and PGN5 was immediately apparent on agar plates (FIG. 3A-3B). To test for wapR gene deletion, an LPS extraction was performed, followed by silver-stained SDS-PAGE and Western blot on the following strains: PAO1, PGN4 (PGN5 without aroA deletion), VE2, and PAO1wbpL, which serves as a negative control due to a deletion in the O-antigen ligase gene, and thus produces no O-antigen. The presence of O-antigen was detected in PGN4, but the level of LPS banding was significantly reduced compared to the LPS banding profile observed in PAO1 and VE2 (FIG. 2D). Lastly, to test for aroA deletion, ELISA was performed to detect the presence of 3-phosphoshikimate 1-carboxyvinyltransferase in cell lysates prepared from PAO1 and PGN5. The ELISA results showed that the amount of 3-phosphoshikimate 1-carboxyvinyltransferase was significantly reduced in PGN5, compared to that in PAO1 (FIG. 2E). Additionally, the deletion of aroA resulted in slower growth in the PGN5 strain, a growth defect that was restored with the addition of 1 mg/mL of aromatic amino acids (W, Y, F) to the culture medium (data not shown).

US11873477B2. Bacterial cultures and methods for production of alginate (2024-01-16). Marshall University Research Corporation [US]. Inventors: Hongwei D. Yu [US], Meagan E. Valentine [US], Richard M. Niles [US], Thomas Ryan Withers [US], Brandon D. Kirby [US].
Full text: Click here
Patent 2024
1-Carboxyvinyltransferase, 3-Phosphoshikimate Agar Alginate Anabolism Aromatic Amino Acids Biological Assay BLOOD Cardiac Arrest Chromosomes Culture Media Deletion Mutation Enzyme-Linked Immunosorbent Assay Enzymes Escherichia coli Exotoxins Gene Deletion Genes Genetic Markers Genome Hemolysis Homologous Recombination Inflammation Ligase Lipopolysaccharides Methyltransferase O Antigens Oxidation-Reduction Pathogenicity Peptide Elongation Factor 2 Phenazines Phospholipase C Pigmentation Plasma Membrane Plasmids Protein Biosynthesis Pseudomonas aeruginosa Pyocyanine Reading Frames SDS-PAGE secretion SERPINA3 protein, human Silver Strains Surface-Active Agents Tissue, Membrane Toxins, Biological Virulence Factors Western Blot Western Blotting
2
Cytotoxicity Evaluation of Nanomaterials
The antibiotic G418 and the culture medium Dulbecco′s Modified Eagle′s Medium (DMEM) were from Sigma-Aldrich (St. Louis, MO, USA). The CellTiter 96®Aqueous One Solution Cell Proliferation Assay kit was from Promega (Tecnolab, Buenos Aires, Argentina). Ferric chloride hexahydrate, sodium dodecyl sulfate (SDS), and hematoxylin and eosin (H&E) dyes were provided by Biopack (Buenos Aires, Argentina). Ferrous sulfate heptahydrate and potassium ferrocyanide were from Mallinckrodt Chemical Works (Saint Louis, MO, USA). Sodium hydroxide and acetic acid were purchased from Cicarelli (San Lorenzo, Santa Fe, Argentina). Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride), 2′,7′-dichlorofluorescin diacetate (DCFDA), osmium tetroxide, uranyl acetate, lead citrate, and Spurr’s resin were acquired by Sigma (Sigma-Aldrich, Saint Louis, MO, USA). All other reagents were of analytical grade.
Principe G., Lezcano V., Tiburzi S., Miravalles A.B., Rivero P.S., Montiel Schneider M.G., Lassalle V, & González-Pardo V. (2023). In Vitro Studies of Pegylated Magnetite Nanoparticles in a Cellular Model of Viral Oncogenesis: Initial Studies to Evaluate Their Potential as a Future Theranostic Tool. Pharmaceutics, 15(2), 488.
Full text: Click here
Publication 2023
Acetic Acid antibiotic G 418 Antibiotics Biological Assay Cell Proliferation Citrates Culture Media dichlorofluorescin Dyes Eagle Eosin ferric chloride hexahydrate ferrous sulfate Hematoxylin Osmium Tetroxide Phenazines potassium ferrocyanide Promega Sodium Hydroxide spurr resin Sulfate, Sodium Dodecyl uranyl acetate
3
Quantification of Bacterial Phenazine Compounds
10 μl of biofilm subcultures were spotted onto 4 mL of 1% tryptone 1% agar in 30 mm circular petri plates and grown for 72 hours at 25°C. The biofilm and agar were placed into 5 mL of 100% methanol and nutated overnight at room temperature to extract the phenazines. To measure the amount of aeruginosins, 600 μl of the methanol extract was added to 600 μl of chloroform, briefly vortexed, and allowed to settle into fractions. After separation, 100 μl of the top aqueous fraction was put into a 96-well plate and read in a plate reader. To quantify aeruginosin levels, the samples were excited at 520 nm and the emission read at 620 nm. The results presented are all normalized relative to the signal of PA14 biofilms. To measure levels of PCA, PCN, and PYO, the methanol extract was filtered through 0.22 μm cellulose acetate Spin-X centrifuge tube filters (Costar), then 200 μl loaded into HPLC vials for analysis. The resulting peaks were identified and quantified relative to samples of purified PCA, PCN, and PYO run in known concentrations.
Evans C.R., Smiley M.K., Thio S.A., Wei M., Price-Whelan A., Min W, & Dietrich L.E. (2023). Spatial heterogeneity in biofilm metabolism elicited by local control of phenazine methylation. bioRxiv.
Publication Preprint 2023
acetylcellulose Agar Biofilms Chloroform High-Performance Liquid Chromatographies Methanol Phenazines PRO 140 Strains
4
Protein Expression in Wound Granulation Tissue
The protein expression of collagen type 3 (COL3A1), basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF) in granulation tissue from seven-day-old wounds was determined by western blotting (Feng et al., 2012 (link)). The harvested wound tissue was homogenized in radioimmunoprecipitation assay buffer (RIPA) (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 1 mM Phenazine Metho Sulfate Fluoride PMSF; pH 7.4) and centrifuged at 10,000×g for 10 min at 4°C. Protein concentration was estimated by using a Bradford reagent.
An equal amount of protein was electrophoresed onto the 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) at 80 V for 45 min. The proteins were trans-blotted poly vinylidene fluoride (PVDF) membrane and incubated with COL3A1, bFGF, VEGF and β-actin primary antibodies (1:1000) overnight at 4°C, at room temperature with the corresponding secondary antibodies (1: 2000) for 1–2 h. The desired proteins were detected by a Western Max-HRP-Chromogenic detection kit and 5-Bromo-4-chloro-3'-indolyl phosphate p-toluidine salt-Nitro Blue Tetrazolium (BCIP-NBT) solution using β-actin as the internal control.
Subramanian S., Duraipandian C., Alsayari A., Ramachawolran G., Wong L.S., Sekar M., Gan S.H., Subramaniyan V., Seethalakshmi S., Jeyabalan S., Dhanasekaran S., Chinni S.V., Mat Rani N.N, & Wahab S. (2023). Wound healing properties of a new formulated flavonoid-rich fraction from Dodonaea viscosa Jacq. leaves extract. Frontiers in Pharmacology, 14, 1096905.
Full text: Click here
Publication 2023
5-bromo-4-chloro-3-indolyl phosphate toluidine salt Actins Antibodies azo rubin S Buffers Collagen Type III Edetic Acid Fibroblast Growth Factor 2 Fluorides Granulation Tissue Nonidet P-40 Phenazines polyvinylidene fluoride Proteins Radioimmunoprecipitation Assay SDS-PAGE Sodium Chloride Sulfates, Inorganic Tetrazolium Salts Tissue, Membrane Tissues Tromethamine Vascular Endothelial Growth Factors Wounds
5
Electrochromic Absorption of Chromatophores
The measurement of the electrochromic absorption band shift of Crt is described (Zhou et al., 2018 (link)). Briefly, the chromatophore from R. sphaeroides was diluted to a final concentration of OD850 = 0.55 cm−1 in 10 mM MOPS (pH 7.3) buffer containing 20 mM ascorbate sodium (Vc-Na), 2 μM phenazine methyl sulfate (PMS), and 5 mM IL. The test system was based on the Cary-60 UV-Vis absorption spectrometer and modified using a homemade accessory (Supplementary Figure S1). The absorption spectra of the chromatophore, measured under excitation “without” or “with” an additional continuous actinic laser, were termed “Dark” and “Light,” respectively. The electrochromic absorption band shift was characterized by the differential spectra of “Light”-minus-“Dark.” All tests were repeated five times.
Liu X.L., Chen M.Q., Jiang Y.L., Gao R.Y., Wang Z.J, & Wang P. (2023). Rhodobacter sphaeroides as a model to study the ecotoxicity of 1-alkyl-3-methylimidazolium bromide. Frontiers in Molecular Biosciences, 10, 1106832.
Full text: Click here
Publication 2023
Actins Buffers Chromatophore CM 55 dimethyl sulfate Light morpholinopropane sulfonic acid Phenazines Sodium Ascorbate

Top products related to «Phenazines»

1
3 amino 7 dimethylamino 2 methyl phenazine hydrochloride by Merck Group
Sourced in Germany
3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride is a chemical compound used in laboratory applications. It serves as a staining agent for microscopy and analytical techniques. The product's core function is to provide a coloring agent for visualization and identification purposes in various research and diagnostic settings.
2
Nitroblue tetrazolium by Merck Group
Sourced in United States, Germany, United Kingdom, India, Italy, Chile, China, Switzerland, Poland
Nitroblue tetrazolium is a chemical compound used in various laboratory applications. It serves as an indicator for the detection of reducing substances, particularly enzymes that catalyze redox reactions. The compound undergoes reduction to form a dark blue, insoluble formazan product, which can be quantified to measure the activity or presence of the target analyte.
3
Multiskan spectrum microplate spectrometer by Thermo Fisher Scientific
Sourced in United States
The Multiskan Spectrum microplate spectrometer is a versatile laboratory instrument designed for absorbance measurements. It is capable of performing spectral scanning and endpoint analysis across a broad wavelength range. The device is equipped with a xenon flash lamp and a monochromator to provide accurate and reliable absorbance data.
4
C18 reverse phase column by Agilent Technologies
Sourced in United States, Japan
The C18 reverse-phase column is a type of high-performance liquid chromatography (HPLC) column used for the separation and analysis of a wide range of organic compounds. It features a stationary phase consisting of silica particles chemically modified with octadecyl (C18) functional groups, which provide a hydrophobic surface for the separation of analytes based on their relative hydrophobicity.
5
Celltiter 96 aqueous non radioactive cell proliferation assay by Promega
Sourced in United States, France, Germany, United Kingdom
The CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay is a colorimetric method for determining the number of viable cells in proliferation or cytotoxicity assays. The assay is based on the cellular conversion of a tetrazolium salt into a colored formazan product.
6
Gallic acid by Merck Group
Sourced in United States, Germany, Italy, Spain, France, India, China, Poland, Australia, United Kingdom, Sao Tome and Principe, Brazil, Chile, Ireland, Canada, Singapore, Switzerland, Malaysia, Portugal, Mexico, Hungary, New Zealand, Belgium, Czechia, Macao, Hong Kong, Sweden, Argentina, Cameroon, Japan, Slovakia, Serbia
Gallic acid is a naturally occurring organic compound that can be used as a laboratory reagent. It is a white to light tan crystalline solid with the chemical formula C6H2(OH)3COOH. Gallic acid is commonly used in various analytical and research applications.
7
Nitro blue tetrazolium by HiMedia
Sourced in India
Nitro blue tetrazolium is a colorimetric reagent used in various biochemical and cell biology applications. It is a yellowish-brown powder that is soluble in water and organic solvents. When reduced, it forms a dark-blue or purple formazan product, which can be used to detect and quantify the presence of various redox-active compounds or enzymatic activities.
8
Cytotox 96 by Promega
Sourced in United States, United Kingdom, France, Japan
The CytoTox 96 is a colorimetric assay for the quantitative measurement of lactate dehydrogenase (LDH) released upon cell lysis. It provides a simple and reliable method for determining the cytotoxic potential of various compounds or treatments.
9
Flash hplc system by Gilson
Sourced in France
The Flash-HPLC system is a high-performance liquid chromatography (HPLC) instrument designed for rapid and efficient separation and purification of chemical compounds. It provides fast, automated, and reproducible purification of samples, enabling researchers to quickly and accurately isolate and identify target compounds.
10
N6 2ae nad by Dojindo Laboratories
N6-2AE-NAD is a synthesized chemical compound that functions as a cofactor for various enzymatic reactions. It is a derivative of nicotinamide adenine dinucleotide (NAD), a key coenzyme involved in cellular metabolism.

More about "Phenazines"

Phenazines are a versatile class of heterocyclic, aromatic compounds characterized by a tricyclic structure.
These fascinating molecules exhibit a wide range of biological activities, including antimicrobial, antitumor, and redox-modulating properties.
Produced by various microorganisms, phenazines have garnered significant interest for their potential applications in medicine, agriculture, and environmental remediation.
Researchers can leverage advanced AI-driven platforms like PubCompare.ai to optimize their phenazine research.
This powerful tool helps identify the most reproducible and accurate protocols from literature, preprints, and patents, enabling researchers to enhance their studies with the best available products and methods.
By leveraging advanced comparisons, scientists can accelerate their discovery process and deepen their understanding of these intriguing compounds.
Some key phenazine-related terms and subtopics include 3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride, a phenazine derivative with potential biological activities, and Nitroblue tetrazolium, a commonly used phenazine-based dye for various assays.
Researchers may also utilize Multiskan Spectrum microplate spectrometers, C18 reverse-phase columns, and CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assays to study phenazine-related processes and effects.
Additionally, Gallic acid, Nitro blue tetrazolium, CytoTox 96, and Flash-HPLC systems can be employed in phenazine research.
The compound N6-2AE-NAD, a phenazine-based NAD analog, has also been studied for its potential applications.
By harnessing the power of AI-driven platforms and leveraging the latest tools and techniques, researchers can unlock new insights and accelerate their understanding of the fascinating world of phenazines.