Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Pristane

Pristane

Pristane is a naturally occurring alkane chemical compound with the formula C19H40.
It is commonly used as a reference standard and in research applications, particularly in the study of autoimmune diseases and inflammation.
PubCompare.ai's AI-powered platform can help streamline your Pristane research by locating relevant protocols from literature, preprints, and patents, and providing AI-driven comparisons to identify the best Pristane protocols and products.
This can optimzie your research process and results.
Unlock reproducibilty and accuracy in your Pristane studies with PubCompare.ai.

Most cited protocols related to «Pristane»

1
Induction and Evaluation of Experimental Arthritis
Cited 9 times
PIA was induced in 8–11 week old rats by an intradermal injection of 100 μl pristane (2,6,10,14-tetramethylpentadecane, 95%, Acros Organics, Morris Plains, NJ, USA) at the dorsal side of the tail base if not stated otherwise. Adjuvant, oil-induced and collagen-induced arthritides were induced by intradermal injections of 100 μl IFA (Difco Laboratories, Detroit, MI, USA) containing 0.4 mg of Mycobacterium butyricum (Difco), 300 μl pure IFA, and 0.3 mg pepsin-digested collagen type II (CII) purified from rat chondrosarcoma [24 ], dissolved in 150 μl 0.1 M acetic acid and emulsified in an equal volume of IFA, respectively. Synthetic pristane was obtained from Sigma-Aldrich (P2870; St. Louis, MO, USA). Treated and non-treated rats or rats subjected to different immunization protocols were housed together in cages. The evaluation of clinical arthritis is described in detail in S1 Text. In brief, 1 point was given for each inflamed knuckle or toe and up to 5 points was given for an affected ankle (in total 15 points per paw, 60 points per rat). Scores were not given for deformations if not accompanied by erythema. The day of disease remission is defined here as the first of at least three consecutive scoring days with declining arthritis scores. The 'first relapse' (Table 1) is the first of at least three consecutive scoring days with increasing scores following a period of disease remission. The frequency of chronic arthritis is defined as the proportion of rats with a mean score of ≥5 or at least two days with scores >6 following day 60 after immunization.
Tuncel J., Haag S., Hoffmann M.H., Yau A.C., Hultqvist M., Olofsson P., Bäcklund J., Nandakumar K.S., Weidner D., Fischer A., Leichsenring A., Lange F., Haase C., Lu S., Gulko P.S., Steiner G, & Holmdahl R. (2016). Animal Models of Rheumatoid Arthritis (I): Pristane-Induced Arthritis in the Rat. PLoS ONE, 11(5), e0155936.
Full text: Click here
Publication 2016
Acetic Acid Ankle Arthritis Arthritis, Collagen-Induced Chondrosarcoma Collagen Type II Erythema Intradermal Injection Menstruation Disturbances Metacarpophalangeal Joint Mycobacterium Pepsin A Pharmaceutical Adjuvants pristane Rattus norvegicus Relapse Tail Vaccination
2
Isolation and Characterization of Immune Cells
Cited 7 times
Isolation of total bone marrow cells and total splenocytes was performed as previously reported (12 (link), 19 (link)). Cell pellets were then suspended in 1 ml 1 × red blood cell (RBC) lysis buffer (eBioscience, San Diego, CA) and incubated for 5 min at room temperature, followed by neutralization of the lysis buffer with 5 ml of C10 medium. This solution was further centrifuged and the pellets were resuspended in 5 ml of fresh C10. Our C10 medium is complete RPMI 1640 supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 1% 100 MEM non-essential amino acids, 10 mM HEPES, 55 μM 2-mercaptoethanol, 2 mM L-glutamine, and 100 U/ml penicillin–streptomycin (all from Life Technologies, Grand Island, NY). The resulting mononuclear cells were stained for flow cytometry as we reported previously (12 (link)). For bone marrow dendritic cell analysis, the following anti-mouse monoclonal antibodies were used: CD11c-APC, CD11b-PE, CD11b-PErCp-Cy5, Siglec-H-PerCP-Cy5.5, I-E/I-A(MHC-II)-FITC (Biolegend, San Diego, CA), and Ly6C-APC-Cy7 (BD Biosciences, San Jose, CA). For analysis of splenic T-cell subsets, we used anti-mouse CD3-APC, CD4-PE-Cy7, CD8-PerCP-Cy5.5, CD44-FITC, and CD62L-APC-Cy7 (Biolegend). Stained cells were analyzed with a BD FACSAria II flow cytometer (BD Biosciences). Flow cytometry data were analyzed with FlowJo.
Abdelhamid L., Cabana-Puig X., Swartwout B., Lee J., Li S., Sun S., Li Y., Ross A.C., Cecere T.E., LeRoith T., Werre S.R., Wang H., Reilly C.M, & Luo X.M. (2020). Retinoic Acid Exerts Disease Stage-Dependent Effects on Pristane-Induced Lupus. Frontiers in Immunology, 11, 408.
Full text: Click here
Publication 2020
2-Mercaptoethanol Amino Acids, Essential Anti-Antibodies Bone Marrow Cells Buffers CD44 protein, human Cells CY5.5 cyanine dye Dendrites Erythrocytes Fetal Bovine Serum Flow Cytometry Fluorescein-5-isothiocyanate Glutamine HEPES isolation ITGAM protein, human Muromonab-CD3 Mus Pellets, Drug Penicillins Pyruvate SELL protein, human Sialic Acid Binding Immunoglobulin-like Lectins Sodium Spleen Streptomycin T-Lymphocyte Subsets
3
Kidney Histopathology and Spleen Apoptosis Assessment
Cited 6 times
Kidney (4 mm) was fixed in 10% formalin, paraffin embedded, and stained with Periodic acid–Schiff (PAS) stain (Sigma-Aldrich) for the semi-quantitative evaluation21 (link),22 (link). Glomerular injury was determined by percentage of moderate-severe glomerular injury (mesangial expansion >50%, crescentic formation and/or glomerulosclerosis) at 400x magnification and interstitial injury was semi-quantitatively estimated at 200x magnification using 10 randomly selected fields by the criteria of damage-area (cell infiltration, interstitial edema and tubular injuries) as following: 0, <5% area; 1, 5–10% area; 2, 10–25% area; 3, 25–50% area; and 4, >50% area. The immune complex deposition in glomeruli was visualized by immunofluorescence prepared in Cryogel (Leica Biosystems, Richmond, IL, USA), stained with goat anti-mouse IgG (Alexa Fluor 488, Abcam, Cambridge, MA, USA) and detected by ZEISS LSM 800 (Carl Zeiss, Germany). Spleen apoptosis was detected by immunohistochemistry with anti-active caspase 3 antibody (Cell Signaling Technology, Beverly, MA, USA) (expressed as positive cells per high-power field)22 (link) and flow cytometry. The fluorochrome-conjugated antibodies against different molecules were used including; i) apoptosis indicators, annexin V and propidium iodide (PI), ii) B220 (B cell) and iii) F4/80 (macrophage) (BioLegend, San Diego, CA, USA) with FlowJo software23 (link).
Thim-uam A., Surawut S., Issara-Amphorn J., Jaroonwitchawan T., Hiengrach P., Chatthanathon P., Wilantho A., Somboonna N., Palaga T., Pisitkun P, & Leelahavanichkul A. (2020). Leaky-gut enhanced lupus progression in the Fc gamma receptor-IIb deficient and pristane-induced mouse models of lupus. Scientific Reports, 10, 777.
Full text: Click here
Publication 2020
alexa fluor 488 Annexin A5 anti-IgG Antibodies Antibodies, Anti-Idiotypic Apoptosis B-Lymphocytes Caspase 3 Cells Complex, Immune Cryogels Edema Flow Cytometry Fluorescent Dyes Formalin Goat Immunofluorescence Immunohistochemistry Injuries Kidney Kidney Glomerulus Macrophage Mesangiums, Glomerular Mus Paraffin Periodic Acid Propidium Iodide Spleen
4
Quantifying Intestinal Permeability and Leaky Gut
Cited 6 times
Gut permeability was determined by the detection of fluorescein isothiocyanate-dextran (FITC-dextran), a non-absorbable molecule through the intestine, in serum after oral administration18 . Briefly, 0.5 ml of FITC-dextran (molecular weight 4.4 kDa; FD4; Sigma, St. Louis, MO, USA) at a concentration of 25 mg/ml in sterile phosphate buffer solution (PBS) was orally administered and collected blood through tail vein at 3 h later. Serum FITC-dextran was measured by fluorospectrometry (NanoDrop 3300; Thermo Scientific, Wilmington, DE). In addition, leaky-gut was also determined by the spontaneous increased endotoxin (LPS) and (1→3)-β-D-glucan (BG) in serum. Serum LPS and BG was analyzed with HEK-Blue LPS Detection (InvivoGen, San Diego, CA, USA) and Fungitell assay (Associates of Cape Cod, East Falmouth, MA, USA), respectively. Values of LPS < 0.01 EU/mL and BG <7.8 pg/mL were recorded as 0.
Thim-uam A., Surawut S., Issara-Amphorn J., Jaroonwitchawan T., Hiengrach P., Chatthanathon P., Wilantho A., Somboonna N., Palaga T., Pisitkun P, & Leelahavanichkul A. (2020). Leaky-gut enhanced lupus progression in the Fc gamma receptor-IIb deficient and pristane-induced mouse models of lupus. Scientific Reports, 10, 777.
Full text: Click here
Publication 2020
Biological Assay BLOOD Buffers Endotoxins fluorescein isothiocyanate dextran Glucans Intestines Permeability Phosphates Serum Sterility, Reproductive Tail Veins
5
Validating miR-26a Regulation of TLR3 3'UTR
Cited 6 times
A 198-bp-long tlr3 3′UTR element containing the putativebinding site of miR-26a (miR-26a sequence: 5′-UUCAAGUAAUCCAGGAUAGGCU-3′) was cloned downstream of the luciferase gene between the SacI and HindIII sites within the pMIR-Report™ Luciferase (Ambion, Austin, USA) vector to construct a pMIR-TLR3 vector. The mutated tlr3 3′UTR element containing site mutations at numbers 2, 4, and 6 in the putative miR-26a:tlr3 seed-pair region was obtained using the PCR-directed mutation method and cloned into the same vector, namely the mutated pMIR-TLR3 vector. The pRL-TK vector (Promega, Fitchburg, USA) served as a control. Plasmids were prepared with the EZNA™ Endo-free Plasmid Maxi Kit (Omega Bio-tek, Norcross, USA). The constructs were sequenced to prove sequence integrity (Genscript company, Nanjing, China).
Hela cells cultured in DMEM high glucose medium (Hyclone, Logan, USA) containing 10% FBS (Hyclone) were used for dual luciferase reporter assay. Briefly, both the firefly pMIR-Report™ Luciferase (Ambion) and renilla pRL-TK (Promega) vectors (90 ng:10 ng per well) were transfected into Hela cells (2 × 104 cells per well seeded for 24 h before transfection) simultaneously with 10 nM miR-26a mimic/inhibitor (GenePharma, Shanghai, China) or negative control (NC) using Lipofectamin 2000™ (Invitrogen, Carlsbad, USA) transfection reagents in a 48-well culture plate. Sequences from 5′ to 3′ end are listed as follows: NC mimics sense UUCUCCGAACGUGUCACGUTT, anti-sense ACGUGACACGUUCGGAGAATT; miR-26a mimics sense UUCAAGUAAUCCAGGAUAGGCU, anti-sense CCUAUCCUGGAUUACUUGAAUU; NC inhibitor CAGUACUUUUGUG UAGUACAA (2′Ome-modified), miR-26a inhibitor AGCCUAUCCUGGAUUACUU GAA (2′Ome-modified).
The lucifease activity was detected using Dual-Luciferase® Reporter 1000 Assay System (Promega) by a plate-reading luminometer (Luminoskan ascent 392, Thermo, Waltham, USA) 24 h after transfection, and the relative luciferase activity value was achieved against the renilla luciferase control.
Jiang C., Zhu W., Xu J., Wang B., Hou W., Zhang R., Zhong N., Ning Q., Han Y., Yu H., Sun J., Meng L, & Lu S. (2014). MicroRNA-26a negatively regulates toll-like receptor 3 expression of rat macrophages and ameliorates pristane induced arthritis in rats. Arthritis Research & Therapy, 16(1), R9.
Full text: Click here
Publication 2014
austin Biological Assay Cells Cloning Vectors Culture Media Endometriosis Genes Glucose HeLa Cells Luciferases Luciferases, Firefly Luciferases, Renilla Mutation Plasmids Promega Sea Pansy Transfection

Most recents protocols related to «Pristane»

1
Pristane-Induced Autoimmunity in Sh2b3E372K Mice
12-week-old Sh2b3E372K mice were injected with either 0.25 ml pristane or PBS intraperitoneally (randomly assigned). Retro-orbital blood was collected from injected mice before pristane injection and set periods thereafter to measure serum immunoglobulins and anti-nuclear antibodies (ANAs) by ELISA and assess cellular phenotypes. 6 months post-pristane injection mice were euthanized. Kidneys were either fixed on 10% formalin and stained for H&E to look at renal pathology or cryopreserved in OCT for immunofluorescence analysis.
Zhang Y., Morris R., Brown G.J., Lorenzo A.M., Meng X., Kershaw N.J., Kiridena P., Burgio G., Gross S., Cappello J.Y., Shen Q., Wang H., Turnbull C., Lea-Henry T., Stanley M., Yu Z., Ballard F.D., Chuah A., Lee J.C., Hatch A.M., Enders A., Masters S.L., Headley A.P., Trnka P., Mallon D., Fletcher J.T., Walters G.D., Šestan M., Jelušić M., Cook M.C., Athanasopoulos V., Fulcher D.A., Babon J.J., Vinuesa C.G, & Ellyard J.I. (2024). Rare SH2B3 coding variants in lupus patients impair B cell tolerance and predispose to autoimmunity. The Journal of Experimental Medicine, 221(4), e20221080.
Full text: Click here
Publication 2024
2
Pristane-Induced Lupus Model in Mice
Pristane-induced lupus-like disease was initiated by injecting 500 µL of 2,6,10,14-tetramethyl-pentadecane or Pristane (Sigma) into the peritoneal cavity of 7–10 weeks-old female mice. For control individuals, genotype- and age-matched female mice were injected with 500 µL of phosphate buffer saline pH 7.4 (PBS) (Gibco). Mice were attributed to PBS- or Pristane-injected groups randomly and maintained in the same cage for the whole procedure. Pristane- and PBS-injected mice were analyzed 8 weeks or 24 weeks after injection.
TCHEN J., SIMON Q., CHAPART L., THAMINY M.K., VIBHUSHAN S., SAVEANU L., LAMRI Y., SAIDOUNE F., PACREAU E., PELLEFIGUES C., BEX-COUDRAT J., KARASUYAMA H., MIYAKE K., HIDALGO J., FALLON P.G., PAPO T., BLANK U., BENHAMOU M., HANOUNA G., SACRE K., DAUGAS E, & CHARLES N. (2024). PD-L1- and IL-4-expressing basophils promote pathogenic accumulation of T follicular helper cells in lupus. Nature Communications, 15, 3389.
Full text: Click here
Publication 2024
3
Pristane-Induced Lupus (PIL) Mouse Model
Not available on PMC !
The mice (n=35) received an intraperitoneal injection of pristane (0.5 ml) (Sigma-Aldrich) for disease development. A control group of healthy mice (n=7) received normal saline (1.3 ml) for 6 weeks. Following 4 weeks of pristane treatment, the development of a PIL model was assessed by evaluating lupus-like pathology: presence of autoantibodies like anti-dsDNA, anti-ENA and high proteinuria.
For detection of anti-dsDNA and anti-ENA autoantibodies post pristane injection, blood was collected from the tail vein at 4 weeks, and serum was isolated. Using ELISA kits (MyBioSource) the serum levels of IgG autoantibodies against dsDNA and ENA were measured following the manufacturer's instructions. Urine was collected on 35 th day from the control, and the four PIL groups of mice in the morning into a clean microcentrifuge tube. Urine was dropped into a urine analysis strip (Uristix, Siemen) and analyzed according to the manufacturer's instructions.
The PIL mice were then divided into five groups (n=7 per group) and administered intraperitoneal injections daily for the next 6 weeks. The treatment groups were as follows: group 1 (No treatment Lupus group) received normal saline (1.3 ml); group 2 received Dex drug; group 3 received DW; group 4 received IW (4.76 nM) subcutaneously on alternate days; and group 5 received W.
Priya K., Thacker H., Chaubey M., Rai M., Singh S., Rawat S., Giri K., Mohanty S., & Rai G. (2024). Dexamethasone and IFN-γ primed mesenchymal stem cells conditioned media immunomodulates aberrant NETosis in SLE via PGE2 and IDO.
Publication 2024
4
Bacterial Transformation Screening Protocol
Not available on PMC !
For screening experiments, we tested seven bacterial strains with known transformation capabilities for their effectiveness to transform IBU (Table 1). The strains are deposited into the strain collection of the Department of Biology of the University of Greifswald (SBUG). Growth on pristane (52)
Hinzke T., Schlüter R., Mikolasch A., Zühlke D., Müller P., Riedel K., Lalk M., Becher D., Sheikhany H., & Schauer F. (2024). Transformation of the drug ibuprofen byPriestia megaterium: Reversible glycosylation and generation of hydroxylated metabolites.
Publication 2024
5
Assessing Biodegradation through Hydrocarbon Ratios
To assess the nature and extent of biodegradation in the different treatments, the ratios of more refractory isoprenoid hydrocarbons pristane (2,6,10,14-tetramethylpentadecane, Pr) and phytane (2,6,10,14-tetramethylhexadecane, Ph) versus n-heptadecane (nC17) and n-octadecane (nC18) respectively were obtained. As an additional parameter, the ratio of the unresolved complex mixture (UCM, also known as the “hump”, an indicator of biodegradation21 ) versus total petroleum hydrocarbons (TPH) was determined.
Eze M.O, & Amuji C.F. (2024). Elucidating the significant roles of root exudates in organic pollutant biotransformation within the rhizosphere. Scientific Reports, 14, 2359.
Full text: Click here
Publication 2024

Top products related to «Pristane»

1
Pristane by Merck Group
Sourced in United States, Italy, Japan
Pristane is a hydrocarbon compound used as a reagent in laboratory settings. It serves as a key component in various experimental procedures, providing a reliable and consistent source of aliphatic hydrocarbons. Pristane's core function is to facilitate specific laboratory applications where a controlled and standardized hydrocarbon environment is required.
2
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
3
Lsrii flow cytometer by BD
Sourced in United States, Germany, United Kingdom, Canada, France, Australia, Switzerland, Uruguay
The BD LSRII flow cytometer is a multi-parameter instrument designed for advanced flow cytometry applications. It features a modular design that allows for customization to meet specific research needs. The LSRII utilizes laser excitation and sensitive detectors to analyze the physical and fluorescent properties of individual cells or particles passing through a fluid stream.
4
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
5
Pristane oil by Merck Group
Sourced in United States
Pristane oil is a laboratory reagent used as a diluent and dispersant in various applications, such as cell culture and immunology experiments. It is a clear, colorless liquid with a high purity profile. Pristane oil serves as a medium for the suspension and dispersion of compounds, facilitating their effective use in research and analytical procedures.
6
Hitrap protein g hp column by GE Healthcare
Sourced in United States, United Kingdom, Germany, Sweden
The HiTrap Protein G HP column is a chromatography column used for the purification of antibodies. It contains Protein G, a recombinant protein that binds to the Fc region of immunoglobulins. The column is designed for high-performance liquid chromatography (HPLC) and can be used to purify a wide range of antibody types, including IgG, IgM, and IgA.
7
Prism 5 by GraphPad
Sourced in United States, Germany, United Kingdom, Israel, Canada, Austria, Belgium, Poland, Lao People's Democratic Republic, Japan, China, France, Brazil, New Zealand, Switzerland, Sweden, Australia
GraphPad Prism 5 is a data analysis and graphing software. It provides tools for data organization, statistical analysis, and visual representation of results.
8
Superscript 2 first strand synthesis kit by Thermo Fisher Scientific
Sourced in United States
The SuperScript II First-Strand Synthesis Kit is a reagent kit designed for the reverse transcription of RNA to complementary DNA (cDNA). The kit includes the necessary components for the reverse transcription reaction, including the SuperScript II reverse transcriptase enzyme, buffer, and other required reagents.
9
Facscalibur by BD
Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Belgium, Switzerland, Singapore, Uruguay, Australia, Spain, Poland, India, Austria, Denmark, Netherlands, Jersey, Finland, Sweden
The FACSCalibur is a flow cytometry system designed for multi-parameter analysis of cells and other particles. It features a blue (488 nm) and a red (635 nm) laser for excitation of fluorescent dyes. The instrument is capable of detecting forward scatter, side scatter, and up to four fluorescent parameters simultaneously.
10
Rpmi 1640 by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Canada, Japan, Australia, Italy, Switzerland, Belgium, New Zealand, Austria, Netherlands, Israel, Sweden, Denmark, India, Ireland, Spain, Brazil, Norway, Argentina, Macao, Poland, Holy See (Vatican City State), Mexico, Hong Kong, Portugal, Cameroon
RPMI 1640 is a common cell culture medium used for the in vitro cultivation of a variety of cells, including human and animal cells. It provides a balanced salt solution and a source of essential nutrients and growth factors to support cell growth and proliferation.

More about "Pristane"

Pristane, a naturally occurring alkane compound with the formula C19H40, is a versatile research tool with a wide range of applications, particularly in the study of autoimmune diseases and inflammation.
This saturated hydrocarbon is commonly used as a reference standard and is a key component in various research protocols.
Beyond its primary use, Pristane is closely associated with several other important laboratory reagents and instruments.
The TRIzol reagent, for instance, is often utilized in conjunction with Pristane for RNA extraction and purification.
The LSRII flow cytometer, a powerful analytical tool, can be employed to study the effects of Pristane on immune cell populations.
Penicillin and streptomycin, broad-spectrum antibiotics, are frequently included in cell culture media alongside Pristane to prevent microbial contamination.
Pristane oil, a liquid form of the compound, is also used in research applications, such as inducing autoimmune responses in animal models.
Purification and analysis of Pristane-related experiments often involve the use of a HiTrap Protein G HP column, which can isolate immunoglobulins, and the GraphPad Prism 5 software, a popular tool for data visualization and statistical analysis.
To ensure accurate and reproducible results, researchers may utilize the SuperScript II First-Strand Synthesis Kit for cDNA synthesis, and the FACSCalibur flow cytometer for multiparameter cell analysis.
The RPMI 1640 medium, a widely used cell culture medium, provides a suitable environment for Pristane-related experiments.
By leveraging these complementary tools and techniques, researchers can optimize their Pristane studies, unlock new insights, and advance the understanding of autoimmune disorders and inflammation.
PubCompare.ai's AI-powered platform can further streamline this process by identifying the best Pristane protocols and products, ultimately enhancing the reproducibility and accuracy of your research.