Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Promega

Promega

Promega is a biotechnology company that specializes in the development and manufacture of research tools and reagents for life science applications.
Their products are widely used in areas such as molecular biology, cell biology, and biochemistry.
The PubCompare.ai platform can help researchers streamline their Promega-based research by providing access to a comprehensive database of protocols from literature, preprints, and patents.
Users can easily locate relevant protocols and use the platform's intelligent comparison tools to identify the best protocols and products for their specific needs.
This can help optimize Promega-based research, saving time and improving the efficiency of experimental workflows.

Most cited protocols related to «Promega»

1
Quantitative Real-Time PCR Protocol
DNase treatment, cDNA synthesis, primer design and SYBR Green I RT-PCR were carried out as described [23 (link)]. In brief, 2 μg of each total RNA sample was treated with the RQ1 RNase-free DNase according to the manufacturer's instructions (Promega). Treated RNA samples were desalted (to prevent carry over of magnesium) before cDNA synthesis using Microcon-100 spin columns (Millipore). First-strand cDNA was synthesized using random hexamers and SuperscriptII reverse transcriptase according to the manufacturer's instructions (Invitrogen), and subsequently diluted with nuclease-free water (Sigma) to 12.5 ng/μl cDNA. RT-PCR amplification mixtures (25 μl) contained 25 ng template cDNA, 2x SYBR Green I Master Mix buffer (12.5 μl) (Applied Biosystems) and 300 nM forward and reverse primer. Reactions were run on an ABI PRISM 5700 Sequence Detector (Applied Biosystems). The cycling conditions comprised 10 min polymerase activation at 95°C and 40 cycles at 95°C for 15 sec and 60°C for 60 sec. Each assay included (in duplicate): a standard curve of four serial dilution points of SK-N-SH or IMR-32 cDNA (ranging from 50 ng to 50 pg), a no-template control, and 25 ng of each test cDNA. All PCR efficiencies were above 95%. Sequence Detection Software (version 1.3) (Applied Biosystems) results were exported as tab-delimited text files and imported into Microsoft Excel for further analysis. The median coefficient of variation (based on calculated quantities) of duplicated samples was 6%.
Vandesompele J., De Preter K., Pattyn F., Poppe B., Van Roy N., De Paepe A, & Speleman F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology, 3(7), research0034.1-research0034.11.
Publication 2002
Anabolism Biological Assay Buffers Deoxyribonucleases DNA, Complementary Endoribonucleases Magnesium Oligonucleotide Primers prisma Promega Reverse Transcriptase Polymerase Chain Reaction RNA-Directed DNA Polymerase SYBR Green I Technique, Dilution
2
Plasmid Construction and Mutagenesis
Plasmid pDESTSIRV30, pDESTSIRV33 expressing the SIRV proteins (CAG38830 and CAG38833), pDESTAVRA expressing MRSA vraR protein (CAG40961) and pDESTFaBH2 expressing Pseudomonas aeruginosa FaBH2 protein (AAG06721)[28 (link)] were constructed using a modified Gateway technology with an N-terminal TEV protease cleavable His tag [29 (link)]. All the plasmids were propagated in DH5α E. coli cells (Stratagene, La Jolla) and plasmids were prepared using Qiagen miniprep kits (Qiagen, Germany). Pfu DNA polymerase, DpnI restriction enzyme are provided with QuikChange™ kit purchased from Stratagene, additional Pfu DNA polymerase was purchased from Promega when required. All the primers were synthesized by Eurogentec and simply purified by SePOP desalting. The melting temperature was calculated as Tm = 81.5 + 16.6(log([K+]/(1+0.7 [K+])) + 0.41(% [G+C]) – 500/(probe length in base) – 1.0(%mismatch) [30 (link)]. The Tm pp and Tm no were calculated for each primer. All primers and their Tm no and Tm pp are detailed in Table 1. PCR cycling was carried out using a Px2 thermal cycler (Thermo Electro Cooperation).
For single-site mutation, deletion or insertion, the PCR reaction of 50 μl contained 2–10 ng of template, 1 μM primer pair, 200 μM dNTPs and 3 units of Pfu DNA polymerase. The PCR cycles were initiated at 95°C for 5 minutes to denature the template DNA, followed by 12 amplification cycles. Each amplification cycle consisted of 95°C for 1 minute, Tm no -5°C for 1 minute and 72°C for 10 minutes or 15 minutes according to the length of the template constructs (about 500 bp per minute for Pfu DNA polymerase). The PCR cycles were finished with an annealing step at Tm pp-5 for 1 minute and an extension step at 72°C for 30 minutes. The PCR products were treated with 5 units of DpnI at 37°C for 2 hours and then 10 μl of each PCR reactions was analyzed by agarose gel electrophoresis. The full-length plasmid DNA was quantified by band density analysis against the 1636-bp band (equal to 10% of the mass applied to the gel) of the DNA ladders. An aliquot of 2 μl above PCR products, the PCR products generated using QuickChange™ or generated as described in [13 (link)] was transformed respectively into E. coli DH5α competent cells by heat shock. The transformed cells were spread on a Luria-Bertani (LB) plate containing antibiotics and incubated at 37°C over night. The number of colonies was counted and used as an indirect indication of PCR amplification efficiency. Four colonies from each plate were grown and the plasmid DNA was isolated. To verify the mutations, 500 ng of plasmid DNA was mixed with 50 pmole of T7 sequencing primer in a volume of 15 μl. DNA sequencing was carried out using the Sequencing Service, University of Dundee. For multiple site-directed mutations, deletions and insertions, the PCR was carried out in 50 μl of reaction containing 10 ng of template, 1 μM of each of the two primer pairs, 200 μM dNTPs and 3 units of Pfu DNA polymerase. The PCR cycles, DNA quantification, transformation and mutation verification were essentially the same as described above.
Liu H, & Naismith J.H. (2008). An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol. BMC Biotechnology, 8, 91.
Full text: Click here
Publication 2008
Antibiotics Cells Deletion Mutation DNA Restriction Enzymes Electrophoresis, Agar Gel Escherichia coli Gene Deletion Heat-Shock Response Insertion Mutation Methicillin-Resistant Staphylococcus aureus Mutation Oligonucleotide Primers Pfu DNA polymerase Plasmids Promega Proteins Pseudomonas aeruginosa TEV protease
3
Quantitative Proteomics of HeLa-E. coli Mixture
An Escherichia coli K12 strain was grown in standard LB medium, harvested, washed in PBS, and lysed in BugBuster (Novagen Merck Chemicals, Schwalbach, Germany) according to the manufacturer's protocol. HeLa S3 cells were grown in standard RPMI 1640 medium supplemented with glutamine, antibiotics, and 10% FBS. After being washed with PBS, cells were lysed in cold modified RIPA buffer (50 mm Tris-HCl, pH 7.5, 1 mm EDTA, 150 mm NaCl, 1% N-octylglycoside, 0.1% sodium deoxycholate, complete protease inhibitor mixture (Roche)) and incubated for 15 min on ice. Lysates were cleared by centrifugation, and after precipitation with chloroform/methanol, proteins were resuspended in 6 m urea, 2 m thiourea, 10 mm HEPES, pH 8.0. Prior to in-solution digestion, 60-μg protein samples from HeLa S3 lysates were spiked with either 10 μg or 30 μg of E. coli K12 lysates based on protein amount (Bradford assay). Both batches were reduced with dithiothreitol and alkylated with iodoacetamide. Proteins were digested with LysC (Wako Chemicals, GmbH, Neuss, Germany) for 4 h and then trypsin digested overnight (Promega, GmbH, Mannheim, Germany). Digestion was stopped by the addition of 2% trifluroacetic acid. Peptides were separated by isoelectric focusing into 24 fractions on a 3100 OFFGEL Fractionator (Agilent, GmbH, Böblingen, Germany) as described in Ref. 45 (link). Each fraction was purified with C18 StageTips (46 (link)) and analyzed via liquid chromatography combined with electrospray tandem mass spectrometry on an LTQ Orbitrap (Thermo Fisher) with lock mass calibration (47 (link)). All raw files were searched against the human and E. coli complete proteome sequences obtained from UniProt (version from January 2013) and a set of commonly observed contaminants. MS/MS spectra were filtered to contain at most eight peaks per 100 mass unit intervals. The initial MS mass tolerance was 20 ppm, and MS/MS fragment ions could deviate by up to 0.5 Da (48 (link)). For quantification, intensities can be determined alternatively as the full peak volume or as the intensity maximum over the retention time profile, and the latter method was used here as the default. Intensities of different isotopic peaks in an isotope pattern are always summed up for further analysis. MaxQuant offers a choice of the degree of uniqueness required in order for peptides to be included for quantification: “all peptides,” “only unique peptides,” and “unique plus razor peptides” (42 (link)). Here we chose the latter, because it is a good compromise between the two competing interests of using only peptides that undoubtedly belong to a protein and using as many peptide signals as possible. The distribution of peptide ions over fractions and samples is shown in supplemental Fig. S1.
Cox J., Hein M.Y., Luber C.A., Paron I., Nagaraj N, & Mann M. (2014). Accurate Proteome-wide Label-free Quantification by Delayed Normalization and Maximal Peptide Ratio Extraction, Termed MaxLFQ. Molecular & Cellular Proteomics : MCP, 13(9), 2513-2526.
Publication 2014
Acids Antibiotics, Antitubercular Biological Assay Buffers Cells Centrifugation Chloroform Cold Temperature Deoxycholic Acid, Monosodium Salt Digestion Dithiothreitol Edetic Acid Escherichia coli Escherichia coli K12 Glutamine HeLa Cells HEPES Homo sapiens Immune Tolerance Iodoacetamide Ions Isotopes Liquid Chromatography Methanol Peptides Promega Protease Inhibitors Proteins Proteome Radioimmunoprecipitation Assay Retention (Psychology) Sodium Chloride Staphylococcal Protein A Tandem Mass Spectrometry Thiourea Tromethamine Trypsin Urea
4
Genome-wide Analysis of Somatic Copy Number Alterations in Cancer
DNA extracted from cancer specimens and normal tissue was labeled and hybridized to the Affymetrix 250K Sty I array to obtain signal intensities and genotype calls. Signal intensities were normalized against data from 1480 normal samples. Copy-number profiles were inferred using GLAD48 (link) and changes of > 0.1 copies in either direction were called SCNAs. The significance of focal SCNAs (covering < 0.5 chromosome arms) was determined using GISTIC18 (link), with modifications to score SCNAs directly proportional to amplitude and to allow summation of non-overlapping deletions affecting the same gene. Peak region boundaries were determined so that the change in the GISTIC score from peak to boundary had < 5% likelihood of occurring by random fluctuation. P-values for Figures 2b and 4 were determined by comparing the gene densities of SCNAs and fraction overlap of peak regions respectively to the same quantities calculated from random permutations of the locations of these SCNAs and peak regions. RNAi was performed by inducible and stable expression of shRNA lentiviral vectors and by siRNA transfection. Proliferation in inducible shRNA experiments was measured in triplicate every half-hour on 96-well plates by a real time electric sensing system (ACEA Bioscience) and in stable shRNA expression and siRNA transfection experiments by CellTiterGlo (Promega). Apoptosis was measured by immunoblot against cleaved PARP and FACS analysis of cells stained with antibody to annexin V and propidium iodide. Tumor growth in nude mice was measured by caliper twice weekly. Expression of MYC, MCL1, and BCL2L1 was performed with retroviral vectors in lung epithelial cells immortalized by introduction of SV40 and hTERT49 (link).
Full methods are described in Supplementary Methods.
Beroukhim R., Mermel C.H., Porter D., Wei G., Raychaudhuri S., Donovan J., Barretina J., Boehm J.S., Dobson J., Urashima M., Mc Henry K.T., Pinchback R.M., Ligon A.H., Cho Y.J., Haery L., Greulich H., Reich M., Winckler W., Lawrence M.S., Weir B.A., Tanaka K.E., Chiang D.Y., Bass A.J., Loo A., Hoffman C., Prensner J., Liefeld T., Gao Q., Yecies D., Signoretti S., Maher E., Kaye F.J., Sasaki H., Tepper J.E., Fletcher J.A., Tabernero J., Baselga J., Tsao M.S., DeMichelis F., Rubin M.A., Janne P.A., Daly M.J., Nucera C., Levine R.L., Ebert B.L., Gabriel S., Rustgi A.K., Antonescu C.R., Ladanyi M., Letai A., Garraway L.A., Loda M., Beer D.G., True L.D., Okamoto A., Pomeroy S.L., Singer S., Golub T.R., Lander E.S., Getz G., Sellers W.R, & Meyerson M. (2010). The landscape of somatic copy-number alteration across human cancers. Nature, 463(7283), 899-905.
Publication 2010
Annexin A5 Apoptosis Arm, Upper bcl-X Protein Cells Chromosomes Cloning Vectors Electricity Epithelial Cells Gene Deletion Genes Genotype Immunoblotting Immunoglobulins Lung Malignant Neoplasms MCL1 protein, human Mice, Nude Neoplasms Promega Propidium Iodide Retroviridae RNA, Small Interfering RNA Interference Short Hairpin RNA Simian virus 40 Tissues Transfection
5
Versatile GFP and LacZ Cloning System
A GFP gene was flanked by BsaI restriction sites using PCR amplification of a GFP coding sequence using primers bsgfp3 (ttt ggtctc a aggt atggtgagcaagggcgaggag) and bsgfp2 (ttt ggtctc a aagc ttacttgtacagctcgtcc). The PCR fragment was cloned in pGEM-T (Promega), resulting in construct pE-GFP. The LacZ cassette and the flanking BsaI sites present in pX-lacZ was obtained by PCR amplification from pUC19 DNA using primers laczins3 (tttcgtctctgtcg aggt a gagacc gaattcgcagctggcacgacaggtttc) and laczins6 (tttcgtctcttacc aagc t gagacc acggttgtgggtcacagcttgtctgtaagcg). The plasmid backbone of pX-lacZ contains a kanamycin resistance gene (derived from pBIN19) for selection in E.coli and Agrobacterium and does not contain any BsaI restriction site other than the two sites flanking the LacZ fragment. Other elements of the constructs (attB site, viral sequences) are as described in [2] (link). The GFP sequences in plasmids pE-GFP3 and pE-GFP2 were obtained by PCR amplification using primers pairs calgef3/bsgfp5 (ggtctc a tatggtgagcaagggcgaggag/ggtctc a cttgtacagctcgtccatgccg) and bsgfp3 (ttt ggtctc a aggt atggtgagcaagggcgaggag)/bsgfp5 and cloned in pUC19 digested with SmaI. pE-S was obtained by PCR amplification of a Nicotiana plumbaginifolia apoplast signal peptide from cloned sequences using primers calgef1 (ggtctc a aggtatggctactcaacgaagggc) and calgef2 (ggtctc a catacctgagacgacagcgacgag) and cloned in pUC19 digested with SmaI. pE-H was made by cloning an adapter (ggtct cacaa gggca gcagc cacca ccacc accac cacta agctt tgaga cc) into the SmaI site of pUC19.
Plasmid pECV was made by first amplifying a LacZ fragment by PCR from pUC19 using primers ecv1 (ttt gaagacttgtcgggtctcaaggtgcagctggcacgacaggtttc) and ecv2 (ttt gaagactttaccggtctcaaagccgcgcgtttcggtgatgac). The primers introduce the BsaI restriction site flanking the LacZ gene. This fragment is cloned using BpiI into a vector backbone fragment amplified from pUC19spec (pUC19spec is identical to pUC19 except that the bla gene was replaced by a spectinomycin resistance gene, this backbone was chosen because it does not contain an internal BsaI restriction site) using primers bpi191 (tttt cgacaagtcttcattaatgaatcggccaacgcgc) and bpi192 (tttt ggtaaagtcttccgggagctgcatgtgtcag).
Engler C., Kandzia R, & Marillonnet S. (2008). A One Pot, One Step, Precision Cloning Method with High Throughput Capability. PLoS ONE, 3(11), e3647.
Full text: Click here
Publication 2008
Agrobacterium Cloning Vectors Escherichia coli Genes HMN (Hereditary Motor Neuropathy) Proximal Type I Kanamycin Resistance LacZ Genes Nicotiana Oligonucleotide Primers Open Reading Frames Plasmids Promega prostaglandin M Signal Peptides Spectinomycin Vertebral Column

Most recents protocols related to «Promega»

1
Adipocyte Lipid Accumulation Inhibition by Compound A
Not available on PMC !

Example 8

Human subcutaneous pre-adipocytes (Zenbio (RTP, NC, U.S.A.)) were received pre-plated in white-walled 96-well plates. A schematic description of the protocol used for examining the effects of Compound A on lipid accumulation in differentiating human adipocytes is shown in FIG. 9. Upon arrival of cells (Day 1) 150 μL media in the wells was replaced with adipocyte differentiation media (Zenbio (RTP, NC, U.S.A.)). The following day media was replaced as described for Day 1. Media was subsequently replaced as described every two to three days. On Day 6, 150 μL of the adipocyte differentiation media was replaced with vehicle (0.1% DMSO), or the SCD1 inhibitors at the concentrations indicated. After two days (Day 8) 150 μL media was replaced with 150 μL adipocyte maintenance media containing vehicle (0.1% DMSO) or the SCD1 inhibitors at the concentrations indicated as described above. Following a further four days of incubation (Day 12) cells were stained with AdipoRed™ (Lonza Bioscience (Walkersville, MD, U.S.A.)) according to the manufacturer's instructions. Cytotoxicity following incubation of adipocytes with Compound A was determined in separate wells, not used for Adipored™ staining, and was measured using CellTiter-Glo® (Promega (Madison, WI)) according to the manufacturer's instructions. Following a 10 min room temperature incubation the luminescence measured as relative light units (RLU) was determined in a luminescent plate reader. For adipocytes treated with concentrations of 1.2-100 nM Compound A for 6 days, cell viability as determined by RLU following CellTiter-Glo® remained greater than 75% of the value obtained with vehicle-treated adipocytes. The RLU dropped to 72% of vehicle in adipocytes treated with 1 μM Compound A (data not shown). These findings indicate that the decrease in lipid accumulation in the differentiating primary human adipocytes following Compound A treatment is not associated with cytotoxicity at least up to 100 nM Compound A.

Calculation of the IC50 for inhibition of triglyceride accumulation in human adipocytes was determined by non-linear regression analysis of the RFU, using a variable slope, 4-parameter fit (GraphPad PRISM®). FIG. 10 Shows the reduction in lipid accumulation following treatment of differentiating primary human adipocytes with 100 nM Compound A and analogs Compounds B, D, E, G and H for six days. FIG. 11 shows a representative study comparing the concentration-dependent reduction in lipid accumulation with Compounds A, G and H. Compound D was tested at 5 μM only. The relative IC50 values for Compound A, G and H in this study were 9.3 nM, 24.2 nM and 56 nM respectively.

US11865113B2. Methods of treating a patient afflicted with non-alcoholic steatohepatitis (NASH) (2024-01-09). Lipidio Pharmaceuticals Inc. [US]. Inventors: Nigel R. A. Beeley [US], J. Gordon Foulkes [US], Kieran George Mooney [US], Charles Rodney Greenaway Evans [GB], Keith Arthur Johnson [US], Howard G. Welgus [US], Celia P. Jenkinson [US].
Full text: Click here
Patent 2024
Adipocytes Cells Cell Survival Cytotoxin Homo sapiens inhibitors Light Lipids Luminescence prisma Promega Psychological Inhibition Sulfoxide, Dimethyl Triglycerides
2
Antibody-Dependent Cellular Cytotoxicity Assay
Not available on PMC !

Example 12

Antibody dependent cellular cytotoxicity (ADCC) activity of exemplary Fc variants (Rituximab Fab) was examined.

ADCC assays were performed using the ADCC Reporter Bioassay with CD20+ WIL2-S target cells from Promega (catalogue # G7014) following the manufacturer's protocol. All Fc variants were tested in the context of the anti-CD20 antibody, Rituximab. Antibody concentrations were titrated fivefold ranging from 5 μg/mL to 0.0016 μg/mL. The values of antibody concentration (x-axis) and fold induction of the luminescent reporter gene (y-axis) were fit to a four parameter logistic regression (4PL) curve. The curve fit was then used to determine the EC50 (the midpoint of the 4PL) and the maximum induction for each Fc variant.

The results are shown in FIGS. 19A-19B. Exemplary Fc variants retain and in some cases enhance ADCC activity.

US11858980B2. Engineered polypeptides and uses thereof (2024-01-02). VISTERRA, INC. [US]. Inventors: Karthik Viswanathan [US], Boopathy Ramakrishnan [US], Brian Booth [US], Kristin Narayan [US], Andrew M. Wollacott [US].
Full text: Click here
Patent 2024
Antibodies Antibodies, Anti-Idiotypic Biological Assay Cytotoxicities, Antibody-Dependent Cell dichlorodifluoromethane Epistropheus Figs Immunoglobulins Induction, Genetic Luminescence Promega Rituximab
3
Characterization of Anti-CD25 Antibodies
Not available on PMC !

Example 8

Antibody-dependent cell-mediated cytotoxicity assays (ADCC assays) were performed for the characterization of anti-human CD25 antibodies using CD25-expressing SR786 cells, herein called target (T) cells, incubated for 20 minutes at 37 C with different concentrations of anti-human CD25 antibodies in a low-IgG FBS-supplemented medium (4% FBS in RPMI). ADCC effector (E) cells are then added to the cell-mAbs mixture at an E:T ratio of 1:1. The effector cells are Jurkat cells stably transfected with a luciferase reporter system and over-expressing CD16/FcgammaRIIIA (Promega). After overnight incubation at 37 C, the cells are lysed and luciferase activity is measured by mean of luminescence release from the hydrolysis of a specific luciferase substrate, following manufacturer instruction (Promega Bio-Glow protocol). Graphs of the raw data are produced using Graphpad Prism v7 to generate dose response curves. The Relative Luminescences Units (RLU) are plotted on a XY chart against the log of the antibody concentration, and the data fir to a non-linear regression curve from which the EC50 is calculated.

US11873341B2. Anti-CD25 for tumour specific cell depletion (2024-01-16). Tusk Therapeutics Ltd. [GB], Cancer Research Technology Limited [GB]. Inventors: Anne Goubier [GB], Beatriz Goyenechea Corzo [GB], Josephine Salimu [GB], Kevin Moulder [GB], Pascal Merchiers [GB], Sergio Quezada [GB].
Full text: Click here
Patent 2024
Anti-Antibodies anti-c antibody Biological Assay Cells Cytotoxicities, Antibody-Dependent Cell FCGR3A protein, human Homo sapiens Hydrolysis IL2RA protein, human Immunoglobulins Jurkat Cells Luciferases Luminescence Monoclonal Antibodies prisma Promega T-Lymphocyte
4
Evaluation of MPV.10.34.d IRC Effectiveness
Not available on PMC !

Example 11

MPV.10.34.d IRC Effectiveness in Human Assays

While the in vitro functional test results of the above experiments were promising, the next desired step in the analysis was to perform similar experiments in human-based assays. To this end, the response of mock human cellular immune system components to tumor cells exposed to MPV.10.34.d IRC was examined in vitro. Human CMV (HCMV) was selected for this study since human CMV is highly prevalent (infecting 50-90% of the human population) and mostly asymptomatic in healthy individuals. (See, Longmate et al., Immunogenetics, 52(3-4):165-73, 2001; Pardieck et al., F1000Res, 7, 2018; and van den Berg et al., Med. Microbiol. Immunol., 208(3-4):365-373, 2019). Importantly, HCMV establishes a life-long persistent infection that requires long-lived cellular immunity to prevent disease. Hence, it is rational to hypothesize that a complex adaptive cell-mediated anti-viral immunity developed over many years to strongly control a viral infection in an aging person can be repurposed and harnessed to treat cancer.

In these experiments, CD8+ T cell responses to CMV peptides were tested in three different human tumor cell lines, including HCT116, OVCAR3, and MCF7. All three of these human tumor cell lines are HLA-A*0201 positive.

In vitro cytotoxicity assays. HTC112, human colon cancer cells, MCF7, human breast cancer cells, and OVCAR3, human ovarian cancer cells (all from ATCC, Manassas, VA, US) were seeded overnight at 0.01 to 0.2×106 per well per 100 μL per 96 well plate. The next day (about 20 to 22 hrs later), each cell line was incubated for one hour at 37° C. under the following conditions: (1) CMV peptide at a final concentration of 1 μg/mL (positive control), (2) MPV.10.34.d at a final concentration of 2.5 μg/mL (negative control), (3) CMV-conjugated MPV.10.34.d IRC at a final concentration of 2.5 μg/mL, (4) CMV-conjugated HPV16 IRC at a final concentration of 2.5 μg/mL, and (5) no antigen (negative control). After 1 hour, the cells were washed vigorously with 200 μL of media for three times to remove non-specific binding. Human patient donor CMV T cells (ASTARTE Biologics, Seattle, WA, US) were added at the E:T (effector cell:target cell) ratio of 10:1 and incubated in a tissue culture incubator for 24 hrs at 37 C, 5% CO2. The total final volume of each sample after co-culture was 200 μL. Cell viability was measured after co-culturing. Cell viability was measured with CELLTITER-GLO® (Promega, Madison, WI, US). This assay provides a luciferase-expressing chemical probe that detects and binds to ATP, a marker of cell viability. The amount of ATP generated from tumor cells was quantified according to manufacturer protocols. In these assays, reduced luciferase activity indicates cell death and suggests greater immune redirection and greater cytotoxicity.

The results are provided in FIG. 25. CMV-conjugated MPV.10.34.d IRC (“VERI-101” in FIGS. 25A, 25B, and 25C) was equally effective as CMV-conjugated HPV16 IRC (“CMV AIR-VLP” in FIGS. 25A, 25B, and 25C) in redirecting human healthy donor CMV pp65-specific CD8+ T-cells (Astarte Biologics, Inc., Bothell, WA, US) to kill immortalized HLA.A2 positive human colon cancer cells (HCT116), human ovarian cancer cells (OVCAR3), and human breast cancer cells (MCF7). The control samples (“No Ag” or “VERI-000” in FIGS. 25A, 25B, and 25C) showed no background tumor killing. Together, these data demonstrate that MPV.10.34.d IRC redirects mouse and human immune responses against tumor cells in vitro.

US11858964B2. Virus-inspired compositions and methods of redirecting preexisting immune responses using the same for treatment of cancer (2024-01-02). VerImmune Inc. [US]. Inventors: Joshua Weiyuan Wang [US], Ken Matsui [US], Philip Alan Storm [US], Kristin Marie Peters [US].
Full text: Click here
Patent 2024
Acclimatization Antigens Antiviral Agents Biological Assay Biological Factors Cancer of Colon CD8-Positive T-Lymphocytes Cell Death Cell Line, Tumor Cell Lines Cells Cell Survival Cellular Immune Response Cellular Immunity Cytotoxin Figs HLA-A2 Antigen Homo sapiens Human papillomavirus 16 In Vitro Testing Luciferases Malignant Neoplasms Mammary Carcinoma, Human MCF-7 Cells Mus Neoplasms Ovarian Cancer Patients Peptides Persistent Infection Promega Response, Immune Response Elements System, Immune T-Lymphocyte Tissue Donors Tissues UL83 protein, Human herpesvirus 5 Virus Virus Diseases
5
Clonal Plant Genomic DNA Sequencing
Not available on PMC !

Example 9

Leaf tissue is collected from clonal plants separated for transplanting and analyzed as individuals. Genomic DNA is extracted using a Wizard@ 96 Magnetic DNA Plant System kit (Promega, U.S. Pat. No. 6,027,945 & U.S. Pat. No 6,368,800) as directed by the manufacturer. Isolated DNA is PCR amplified using the appropriate forward and reverse primer.

PCR amplification is performed using Hotstar Taq DNA Polymerase (Qiagen) using touchdown thermocycling program as follows: 96° C. for 15 min, followed by 35 cycles (96° C., 30 sec; 58° C. -0.2° C. per cycle, 30 sec; 72° C., 3 min and 30 sec), 10 min at 72° C. PCR products are verified for concentration and fragment size via agarose gel electrophoresis. Dephosphorylated PCR products are analyzed by direct sequence using the PCR primers (DNA Landmarks, or Entelechon). Chromatogram trace files (.scf) are analyzed for mutation relative to the wild-type gene using Vector NTI Advance 10™ (Invitrogen). Based on sequence information, mutations are identified in several individuals. Sequence analysis is performed on the representative chromatograms and corresponding AlignX alignment with default settings and edited to call secondary peaks.

US11879132B2. Plants having increased tolerance to herbicides (2024-01-23). BASF AGRO B.V. [NL]. Inventors: Raphael Aponte [DE], Stefan Tresch [DE], Dario Massa [DE], Matthias Witschel [DE], Tobias Seiser [DE], Jill Marie Paulik [US].
Full text: Click here
Patent 2024
Base Sequence Clone Cells Cloning Vectors Electrophoresis, Agar Gel Genes Genome Mutation Oligonucleotide Primers Plant Leaves Plants Promega Sequence Analysis Taq Polymerase Tissues

Top products related to «Promega»

1
Dual luciferase reporter assay system by Promega
Sourced in United States, China, Germany, United Kingdom, Switzerland, Japan, France, Italy, Spain, Austria, Australia, Hong Kong, Finland
The Dual-Luciferase Reporter Assay System is a laboratory tool designed to measure and compare the activity of two different luciferase reporter genes simultaneously. The system provides a quantitative method for analyzing gene expression and regulation in transfected or transduced cells.
2
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
3
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
4
M mlv reverse transcriptase by Promega
Sourced in United States, China, Germany, United Kingdom, France, Switzerland, Japan, Argentina, Italy, Australia, Canada, Spain, Netherlands
M-MLV reverse transcriptase is an RNA-dependent DNA polymerase enzyme used to synthesize complementary DNA (cDNA) from a single-stranded RNA template. It catalyzes the conversion of RNA into DNA, a critical step in gene expression and protein synthesis analysis.
5
Celltiter glo luminescent cell viability assay by Promega
Sourced in United States, Germany, United Kingdom, Switzerland, Italy, France, Japan, Spain, Sweden, Belgium, China, Australia
The CellTiter-Glo Luminescent Cell Viability Assay is a quantitative method for determining the number of viable cells in a cell-based assay. The assay measures the amount of ATP present, which is an indicator of metabolically active cells.
6
Dual luciferase reporter assay kit by Promega
Sourced in United States, China, Germany, United Kingdom, Switzerland, Finland, Italy, Japan
The Dual-Luciferase Reporter Assay Kit is a laboratory tool that allows for the measurement and quantification of two different reporter luciferase enzymes in a single sample. The kit provides the necessary reagents to perform this dual-reporter analysis, which can be used to study gene expression and regulatory elements.
7
Trypsin by Promega
Sourced in United States, Germany, United Kingdom, China, Japan, France, Switzerland, Sweden, Italy, Netherlands, Spain, Canada, Brazil, Australia, Macao
Trypsin is a serine protease enzyme that is commonly used in cell culture and molecular biology applications. It functions by cleaving peptide bonds at the carboxyl side of arginine and lysine residues, which facilitates the dissociation of adherent cells from cell culture surfaces and the digestion of proteins.
8
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
9
Pgem t easy vector by Promega
Sourced in United States, China, Germany, United Kingdom, Japan, France, Italy, Australia, Switzerland, Spain, Israel, Canada
The pGEM-T Easy Vector is a high-copy-number plasmid designed for cloning and sequencing of PCR products. It provides a simple, efficient method for the insertion and analysis of PCR amplified DNA fragments.
10
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.

More about "Promega"

Promega is a leading biotechnology company that specializes in the development and manufacture of high-quality research tools and reagents for life science applications.
Their extensive product portfolio covers a wide range of areas, including molecular biology, cell biology, and biochemistry.
The Promega portfolio includes a variety of essential products, such as the Dual-Luciferase Reporter Assay System, which is a powerful tool for gene expression analysis, and the Lipofectamine 2000 and Lipofectamine 3000 transfection reagents, which are widely used for efficient delivery of genetic material into cells.
Additionally, Promega offers the TRIzol reagent for RNA extraction, the M-MLV reverse transcriptase for cDNA synthesis, and the CellTiter-Glo Luminescent Cell Viability Assay for evaluating cell proliferation and cytotoxicity.
The PubCompare.ai platform, powered by Promega's extensive research expertise, provides researchers with a comprehensive database of protocols from literature, preprints, and patents.
This platform allows users to easily locate relevant protocols and utilize intelligent comparison tools to identify the best protocols and products for their specific research needs.
This can help streamline Promega-based research, save time, and improve the efficiency of experimental workflows.
By leveraging Promega's cutting-edge products and the PubCompare.ai platform, researchers can optimize their Promega-based research, unlocking new possibilities in fields such as molecular biology, cell biology, and biochemistry.
Whether you're working with the PGEM-T Easy vector, Trypsin, TRIzol, or any other Promega product, the PubCompare.ai platform can help you revolutionize your research and achieve your goals more efficiently.