Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Propylsulfonic acid

Propylsulfonic acid

Propylsulfonic acid is a organic sulfonic acid compound with the chemical formula C3H7SO3H.
It is used as a reagent and intermediate in various chemical processes and research applications.
Propylsulfonic acid has applications in organic synthesis, analytical chemistry, and materials science.
Key properties include its strong acidity, solubility in polar solvents, and thermal stability.
Researchers can optimize their propylsulfonic acid studies using AI-driven tools like PubCompare.ai to identify the most effective protocols from the scientific literature, pre-prints, and patents.

Most cited protocols related to «Propylsulfonic acid»

1
Cerium Extraction on Propylsulfonic Acid Silica
Not available on PMC !

Example 5

Cerium on a propylsulfonic acid-modified silica—a commercial 50 mg column containing a silica-based propylsulfonic acid sorbent (“Cerex”, Baldwin Park, Calif.) was treated with 2 milliliters of methanol, 2 milliliters of water, 2 milliliters of saturated cerium chloride solution in water, 2 milliliters of water, and 2 milliliters of methanol.

US07256049B2. Devices and methods for separating phospholipids from biological samples (2007-08-14). Tandem Labs [US]. Inventors: Patrick Kevin Bennett [US], Kenneth Charles Van Horne [US].
Full text: Click here
Patent 2007
2
Synthesis of Compound 15 from 3-Phenoxyphenylacetic Acid
Compound 15 was prepared from 3-phenoxyphenylacetic acid (3 mmol), following steps iv—viii of general method A, as a white powder (380 mg, 25% overall yield). Anal. (C15H14K3O7PS·0.25C2H5OH·0.5H2O) C, H. 1H NMR (400 MHz, D2O): δ δ 2.00−2.10 (m, 2H, CH2), 2.65−2.80 (m, 2H, PhCH2), 2.90−3.00 (m, 1H, CHSO3K), 6.70−7.30 (m, 9H, aromatic). 31P NMR (D2O): δ 14.1.
Song Y., Lin F.Y., Yin F., Hensler M., Poveda C.A., Mukkamala D., Cao R., Wang H., Morita C.T., Pacanowska D.G., Nizet V, & Oldfield E. (2009). Phosphonosulfonates Are Potent, Selective Inhibitors of Dehydrosqualene Synthase and Staphyloxanthin Biosynthesis in Staphylococcus aureus. Journal of medicinal chemistry, 52(4), 976-988.
Publication 2009
1H NMR Acids Anus Powder
3
Functionalization of Iron Oxide Nanoparticles
Iron oxide@PMO-ICS (B, 2.0 g) was dispersed in toluene (10 mL). Then, 0.4 mL of the 3-[(trimethoxysilyl) propyl] thiol was slowly added to the mixture and stirred at room temperature for 24 h to afford Iron oxide@PMO-ICS-PrSH (C). The resulting solid was filtered, washed by distilled water and dried under vacuum for 1 h. Finally, 1.0 g of Iron oxide@PMO-ICS-PrSH (C) was dispersed in deionized H2O (4 mL) and H2O2 (6 mL) was slowly added to the above mixture stirred at room temperature for 24 h. The obtained black solid (Iron oxide@PMO-ICS-PrSO3H, 1) was filtered off and washed with deionized water twice (15 mL) and then dried at 100 °C for 2 h.
Akbari A., Dekamin M.G., Yaghoubi A, & Naimi-Jamal M.R. (2020). Novel magnetic propylsulfonic acid-anchored isocyanurate-based periodic mesoporous organosilica (Iron oxide@PMO-ICS-PrSO3H) as a highly efficient and reusable nanoreactor for the sustainable synthesis of imidazopyrimidine derivatives. Scientific Reports, 10, 10646.
Full text: Click here
Publication 2020
ferric oxide Peroxide, Hydrogen Sulfhydryl Compounds Toluene Vacuum
4
Pt-Loaded Sulfonic Acid-Functionalized SBA-15 Catalysts
The catalysts used in this work were organic-inorganic hybrid SBA-15 materials, which were functionalized with propylsulfonic (arenesulfonic) acid groups and loaded with platinum. Organosulfonic acid-functionalized SBA-15 materials were synthesized as described elsewhere (Mbaraka and Shanks, 2006 (link); Tang et al., 2010 (link)) with only slight modifications. Tetraethoxysilane (TEOS, 98%, Aldrich) and (3-mercaptopropyl)trimethoxysilane (MPTMS, 85 wt. %, Acros) or 2-(4-chloro-sulfonyl-phenyl) ethyl trimethoxysilane (CSPTMS, 50 wt. % in CH2Cl2, Acros) were adopted directly without further purification as the silica and the organosulfonic acid sources. Pluronic P123 (Aldrich), a triblock copolymer of polyethylene oxide-polypropylene oxide-polyethylene oxide with the molecular structure PEO20-PPO70-PEO20 (Mw = 5800), was used as a structure template to synthesizethe SBA-15. H2PtCl6 solution used as the platinum precursor was provided by Hangzhou Kaiming Catalyst Co., Ltd. Formaldehyde (HCHO, 37 wt.%, aqueous solution, Sinopharm Chemical reagents Co., China) was used as reducing agents. The functionalized SBA-15 hybrids with propylsulfonic or arenesulfonic acid groups were abbreviated as SBA-Pr and SBA-Ar, respectively. The nominal loading of platinum on the catalysts was fixed at 1 wt%.
Mo L., Yu W., Cai H., Lou H, & Zheng X. (2018). Hydrodeoxygenation of Bio-Derived Phenol to Cyclohexane Fuel Catalyzed by Bifunctional Mesoporous Organic–Inorganic Hybrids. Frontiers in Chemistry, 6, 216.
Full text: Click here
Publication 2018
Acids Formaldehyde Hybrids Molecular Structure PEO-PPO-PEO Platinum pluronic block copolymer P123 Reducing Agents SBA-15 Silicon Dioxide tetraethoxysilane trimethoxysilane
5
Synthesis of Oxazole Derivatives
Under an argon atmosphere, the benzonitrile derivative (1 mmol), amino alcohol (3 mL), and silica-supported propylsulfonic acid (0.1 g) were stirred for 4 h at 120°C. The reaction was cooled at room temperature and directly purified through silica-gel column chromatography to obtain the corresponding oxazole. The benzonitrile derivative, amino alcohol, chromatography eluent, yield (%), melting point (°C), recrystallization solvent, IR results, and 1H NMR results are reported for each of the compounds.
Madia V.N., Messore A., Pescatori L., Saccoliti F., Tudino V., De Leo A., Scipione L., Fiore L., Rhoden E., Manetti F., Oberste M.S., Santo R.D, & Costi R. (2018). In Vitro Antiviral Activity of New Oxazoline Derivatives as Potent Poliovirus Inhibitors. Journal of medicinal chemistry, 62(2), 798-810.
Publication 2018
1H NMR Amino Alcohols Argon Atmosphere benzonitrile Chromatography Gel Chromatography Oxazoles propylsulfonic acid Silica Gel Silicon Dioxide Solvents

Most recents protocols related to «Propylsulfonic acid»

1
Microwave-Assisted Synthesis of Quinolinol Derivative
Not available on PMC !

Example 21

[Figure (not displayed)]

To a mixture of Intermediate 12 (45 mg, 0.094 mmol) in NMP (1 mL) was added dimethylamine (2 M in THF, 0.25 mL, 0.50 mmol). The mixture was heated at 140° C. under microwave irradiation for 1.5 h. The mixture was cooled to room temperature, acidified by addition of 1 M HCl in ether and subjected to SCX purification (GENERAL METHOD 3-1, 1 g SiliaBond Propylsulfonic Acid® cartridge). The crude product was further purified by preparative reverse-phase HPLC to obtain 4-(dimethylamino)-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-7-ol di-formate as a light yellow solid (25 mg). LC/MS Rt=0.43 min. MS (M+1)=435.3. 1H NMR (METHANOL-d4) 8.71 (s, 1H), 8.46 (s, 2H), 8.28 (d, J=9.9 Hz, 1H), 8.21 (d, J=7.1 Hz, 1H), 7.39 (d, J=9.8 Hz, 1H), 7.23 (s, 1H), 6.82 (d, J=7.1 Hz, 1H), 5.49 (tt, J=11.0, 5.0 Hz, 1H), 3.54 (s, 6H), 3.08 (s, 3H), 2.05-1.93 (m, 5H), 1.66 (s, 6H), 1.52 (s, 6H).

US11672799B2. 1,4-disubstituted pyridazine quinolne analogs there of and methods for treating SMN-deficiency-related conditions (2023-06-13). Novartis AG [CH]. Inventors: Atwood Kim Cheung [US], Natalie Dales [US], Timothy Brian Hurley [US].
Full text: Click here
Patent 2023
1H NMR Anabolism dimethylamine Ethyl Ether Formates High-Performance Liquid Chromatographies Light Methanol Microwaves propylsulfonic acid Sodium Chloride
2
Synthesis and Purification of Heterocyclic Compound
Not available on PMC !

Example 19

[Figure (not displayed)]

To a mixture of Intermediate 12 (19.5 mg, 0.046 mmol) in MeOH (0.8 mL) was added NaOMe (25 wt % in methanol, 0.084 mL, 0.37 mmol). The mixture was heated at 120° C. under microwave irradiation for 1 h. An additional portion of NaOMe (25 wt % in methanol, 0.08 mL) was added and the mixture was then heated at 130° C. for 2 h. The mixture was cooled to room temperature, acidified by addition of 1 M HCl in ether and subjected to SCX purification (GENERAL METHOD 3-1, 1 g SiliaBond Propylsulfonic Acid® cartridge). The crude product was further purified by preparative reverse-phase HPLC to obtain the title compound as a white solid (8 mg). LC/MS Rt=0.39 min. MS (M+1)=422.3. 1H NMR (METHANOL-d4) δ 8.50 (s, 1H), 8.47 (d, J=5.6 Hz, 1H), 8.14 (d, J=10.1 Hz, 1H), 7.25 (s, 1H), 7.24 (d, J=10.1 Hz, 1H), 6.74 (d, J=5.6 Hz, 1H), 5.07 (t, J=12.1 Hz, 1H), 4.02 (s, 3H), 2.94 (s, 3H), 1.58-1.70 (m, 2H), 1.46-1.58 (m, 2H), 1.32 (s, 6H), 1.16 (s, 6H).

US11672799B2. 1,4-disubstituted pyridazine quinolne analogs there of and methods for treating SMN-deficiency-related conditions (2023-06-13). Novartis AG [CH]. Inventors: Atwood Kim Cheung [US], Natalie Dales [US], Timothy Brian Hurley [US].
Full text: Click here
Patent 2023
1H NMR Anabolism Ethyl Ether High-Performance Liquid Chromatographies Methanol Microwaves propylsulfonic acid
3
Isolation and Quantification of Perlolyrine
The βC perlolyrine was isolated from
foods by SPE using propylsulfonic acid-derivatized silica PRS cartridges
(Bond Elut, 500 mg, 3 mL volume, Agilent). Samples of solid foods
(2–5 g) or liquid samples (5 mL) were added with 0.6 M HClO4 (15–20 mL), homogenized using an Ultra-Turrax homogenizer,
and centrifuged at 10,000 rpm for 15 min at 0–5 °C. The
conditioning of PRS columns was made with 6 mL of methanol and 6 mL
of 0.1 M HCl. Aliquots (5 mL) were spiked with 0.5 mL of 1-ethyl-β-carboline
solution (EβC) (0.08 mg/L) as an internal standard (IS) and
subsequently loaded onto PRS columns using a vacuum manifold. After
washing with deionized water (2 mL) and 3 mL of 0.4 M K2HPO4 (pH 9.1), perlolyrine was eluted with 3 mL of 0.4
M K2HPO4 (pH 9.1):methanol (1:1) and it was
analyzed by HPLC-fluorescence and the presence of the compound confirmed
by HPLC-MS. The performance of the SPE procedure gave recoveries of
perlolyrine (40 μg/L) higher than 95% (n =
3), repeatability of 3% RSD (n = 3), and accuracy
of 2.2% mean error (n = 3) after analysis by HPLC-FLD,
as mentioned below. The LOD and LOQ values were 0.5 and 1.5 μg/L,
respectively.
Herraiz T., Peña A, & Salgado A. (2023). Identification, Formation, and Occurrence of Perlolyrine: A β-Carboline Alkaloid with a Furan Moiety in Foods. Journal of Agricultural and Food Chemistry, 71(36), 13451-13461.
Full text: Click here
Publication 2023
Fluorescence Food High-Performance Liquid Chromatographies Methanol perlolyrine potassium phosphate, dibasic propylsulfonic acid Silicon Dioxide Vacuum
4
Analysis and Isolation of Carboline Compounds in Soy Sauce
(a) Tetrahydro-β-carboline-3-carboxylic acids (THβC-3-COOHs) were analyzed from soy sauces by using benzenesulfonic acid (SCX)-columns following a previously described procedure that affords good performance and reliability with recoveries higher than 90% [45 (link),54 (link)]. The elution fraction of 0.4 M phosphate buffer-methanol (1:1), pH 9, containing the THβC-3-COOH was injected into RP-HPLC-fluorescence (excitation, 270 nm; emission, 343 nm) for quantitative analysis and into HPLC-MS for identification, as mentioned below. Quantitation was carried out from calibration curves constructed with standards of THβC-3-COOH isolated under the same procedure [45 (link),54 (link)].
(b) The aromatic β-carbolines were isolated for subsequent chromatographic analysis, identification and MAO inhibition studies by using a solid phase extraction procedure reported before that affords good performance and reliability with recoveries higher than 90% [22 (link),46 (link)]. Briefly, soy sauce diluted with 0.6 M HClO4 and added with 125 μL 1-ethyl-β-carboline (0.2 mg/L) as internal standard was passed through a propylsulfonic acid (PRS)-derivatized silica column that was eluted with water (6 mL), 0.4 M phosphate buffer, pH 9 (3 mL) and 0.2 M buffer phosphate-methanol (1:1), pH 9 (3 mL). The eluates of 0.2 M buffer phosphate-methanol (1:1), pH 9 (3 mL) containing the β-carbolines, were analyzed by HPLC and norharman and harman detected by fluorescence (300 nm, excitation and 433 nm, emission). Quantitation was obtained from calibration curves of standards isolated under the same procedure. The same PRS-SPE procedure but without an internal standard was used to isolate the fractions containing β-carboline for subsequent MAO inhibition studies. In this case, the eluting fractions of 0.4 M phosphate buffer, pH 9 (3 mL) and 0.2 M buffer phosphate-methanol (1:1), pH 9 (3 mL) were mixed and used for MAO inhibition. In order to isolate the β-carboline harman, PRS fractions of 0.2 M buffer phosphate-methanol (1:1) pH 9 were evaporated under vacuum and extracted with dichloromethane (Merck). The organic phase was evaporated, redissolved and injected into HPLC as mentioned below, with the peak corresponding to the β-carboline harman collected from successive HPLC injections. After removing acetonitrile, harman was extracted with dichloromethane in pH 9, concentrated to dryness, and redissolved in phosphate buffer containing 30% DMSO, and used for inhibition of MAO. Corresponding blanks following the same procedures but without β-carbolines were used in the assays.
, & Herraiz T. (2023). β-Carboline Alkaloids in Soy Sauce and Inhibition of Monoamine Oxidase (MAO). Molecules, 28(6), 2723.
Full text: Click here
Publication 2023
acetonitrile benzenesulfonic acid Biological Assay Buffers carboline-3-carboxylic acid Carbolines Fluorescence harman High-Performance Liquid Chromatographies Methanol Methylene Chloride norharman Phosphates propylsulfonic acid Psychological Inhibition Silicon Dioxide Solid Phase Extraction Soy Sauce Sulfoxide, Dimethyl Vacuum
5
Highly Potent SMN-Elevating Pyridazine Compounds
Not available on PMC !

Example 1

A cellular SMN ELISA was used to measure the effects of low molecular weight compounds on SMN protein elevation. Cells from a myoblast cell line derived from the SMNdelta7 mouse model (kind gift from Steve Burden, NYU) were seeded into a 384-well plate at a density of 3000 cells/well and treated with compounds for 24 hours. ELISA capture plates were prepared by coating 384-well plates (Immulon 4HBX) with 0.5 ug/mL of anti-SMN mAb (BD Science, Catalog number 610647) at 4° C. overnight. The plates were washed 5 times with 110 uL of PBS-Tween (0.05% Tween-20, PBST), blocked with 100 uL of 1% BSA in PBST for 2 hours and washed (5 times) with 100 uL of PBST. After 24 hours of compound treatment cells were lysed in a modified RIPA-buffer, on ice for 1 hour. 20 uL of lysate and 20 uL of 1% BSA were then added to the ELISA capture plates and incubated at 4° C. overnight. Plates were washed (5 times) with PBST and then incubated with 1:100 dilution of primary rabbit anti-SMN polyclonal antibody (Santa cruz, Catalog number SC-15320) at room temperature for 1 hour and subsequently washed (5 times) with 110 uL of PBST. This was followed by addition of 1:100 Goat anti-Rabbit IgG-HRP linked (Cell Signaling, Catalog number 7074) secondary antibody for 1 hour. Plates were then washed with PBST and incubated with 40 uL TMB substrate (Cell Signaling, Catalog number 7004 L) at room temperature for 1-10 minutes with shaking. The reaction was stopped by addition of 40 uL of stop solution (Cell signaling, Catalog number 7002 L) and absorption was measured at 450 nm. Data was reported as fold activation over DMSO control, and EC50.

ELISA assay condition 1: compound concentration range 20 nM-10 uM; ELISA assay condition 2: compound concentration 100 pM-10 uM. Data generated in Biological Example 1 using ELISA conditions 1 or 2.

Example 2

[Figure (not displayed)]

To a solution of Intermediate 11 (22 mg, 0.050 mmol) in MeOH (2 mL) under a nitrogen atmosphere was added palladium on carbon (10 wt %, 5.9 mg, 0.005 mmol) and a drop of concentrated HCl. The mixture was evacuated and back-filled with hydrogen (4×), and stirred rapidly overnight. The mixture was filtered through Celite®, rinsed with MeOH and concentrated. SCX purification (GENERAL METHOD 3-1, 1 g SiliaBond Propylsulfonic Acid® cartridge) and preparative reverse-phase HPLC purification provided 2-methyl-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-7-ol as a light yellow solid (11.5 mg). LC/MS Rt=0.39 min. MS (M+1)=406.0. 1H NMR (400 MHz, METHANOL-d4) δ 8.20 (s, 1H), 8.16 (d, J=9.6 Hz, 1H), 8.12 (d, J=8.6 Hz, 1H), 7.32 (s, 1H), 7.26 (d, J=9.6 Hz, 1H), 7.17 (d, J=8.6 Hz, 1H), 5.09 (t, J=12.1 Hz, 1H), 2.98 (s, 3H), 2.64 (s, 3H), 1.62-1.72 (m, 2H), 1.50-1.60 (m, 2H), 1.38 (s, 6H), 1.22 (s, 6H).

SMN2 Full Reporter Construct:

pSMN2 Splicing Luciferase reporter was constructed according to Zhang et al., (An in vivo reporter system for measuring increased inclusion of exon 7 in SMN2 mRNA: potential therapy of SMA. Gene Ther. 2001 October; 8(20):1532-8) via overlapping PCR. The final PCR fragment containing Exon6-Intron6-Exon7 (with a C insertion before 49T)-Intron7-Exon8-Luciferase was inserted to BamHI and NotI site of pCAG-IRESblast expression vector (Chen et al., Establishment and Maintenance of Genomic Methylation Patterns in Mouse Embryonic Stem Cells by Dnmt3a and Dnmt3b. Mol Cell Biol. 2003 August; 23(16):5594-605).

Human SMN2 exon1-exon6 cDNA were amplified by PCR (Forward primer: ACGGATCCATGGCGATGAGCAGCGG; reverse primer: GCCAGTATGATAGCCACTCATGTACC), and Exon6-Intron6 (Forward primer: ATAATTCCCCCACCACCTCCC; reverse primer: CATTCCCTACAATCAATTTCAAATCAGAG) were fused by overlap PCR to create Exon1-Intron6 fragment, and was inserted into pSMN2 splicing Luciferase reporter via BamHI and HindIII sites to create pSMN2 exon1-6 splicing reporter. SMN2 promoter 5.1 kb fragment was amplified from human genomic DNA by PCR (Forward primer: CAGCTAGCACGCGTAAGCTCTGATTGGTGAGCGATGGTGG; reverse primer: CACTCGAGAGCAAACCCGCGGGTGCGCAGCG), and inserted between MluI site and BamHI site (Blunted using DNA blunting kit, Takara, Cat #6025) of pSMN2 exon1-6 splicing reporter to replace chicken β-actin promoter and the human cytomegalovirus immediate early enhancer, to finalize the pSMN2-Full-reporter.

SMN2 Full Reporter Stable Clone in NSC34 Cells:

pSMN2-Full reporter was stably transfected into NSC34 cells using Lipofectamine 2000, which were subsequently selected in blasticidin-containing medium for two weeks. Blasticidin-resistant colonies were screened by Luciferase signal and response to SAHA as well as by RT-PCR for alternative splicing of Exon7.

Reporter Gene Assay:

NSC34 SMN2 Full reporter stable line was cultured in DMEM (Invitrogen, Cat:11965)+10% FBS+7 μg/ml Blasticidin. Cells in culture media without Blasticidin were seeded into a 384-well plate at a density of 6000 cells/well and treated with compounds for 24 hours. Luciferase signal was assessed by BrightGlo assay. Eequal volume of BrightGlo reagent (Promega, Cat #E2620) was added to the cells and incubated for 10 minutes at room temperature. Luminescent signal was read in either BioTek or Envision plate reader.

Reporter gene assay conditions: compound concentration range 3 nM-10 uM.

Activity Table: Data generated in Biological Example 3 were generated using methods described
in Biological example 1 or Biological example 2.
Biological
Example
ExamplenumberSMN ActivityCompound name
Preparation 111280 nM, 2.6 fold4-chloro-2-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
Preparation 121 30 nM, 2.6 fold4-chloro-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
Preparation 131 7 nM, 2.6 fold4-chloro-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-6-ol
 1-11 20 nM, 2.9 fold6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 1-21340 nM, 2.4 fold6-(6-(methyl(1,2,2,6,6-
pentamethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 1-31255 nM, 2.5 fold6-(6-((3aR,6aS)-5-
methylhexahydropyrrolo[3,4-c]pyrrol-
2(1H)-yl)pyridazin-3-yl)quinolin-7-ol
 2-11 20 nM, 3.0 fold2-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 3-11 70 nM, 3.1 fold7-(6-(methyl(1,2,2,6,6-
pentamethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
 3-21 5 nM, 2.75 fold7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
 3-31 83 nM, 2.5 fold7-(6-((2,2,6,6-tetramethylpiperidin-4-
yl)oxy)pyridazin-3-yl)isoquinolin-6-ol
 3-41 60 nM, 2.3 fold7-(6-((3aR,6aS)-5-
methylhexahydropyrrolo[3,4-c]pyrrol-
2(1H)-yl)pyridazin-3-yl)isoquinolin-6-ol
 3-51 14 nM, 2.54 fold1-cyclopropyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
 3-61 8 nM, 2.43 fold7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinoline-
1,6-diol
 3-71 2 nM, 2.9 fold6-hydroxy-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinoline-1-
carbonitrile
 4-11 6 nM, 2.6 fold6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-7-ol
 5-11300 nM, 2.6 fold8-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 6-11 7 nM, 2.82 fold7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-6-ol
 6-21 4 nM, 3.2 fold2-methyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-6-ol
 7-11 14 nM, 2.8 fold3-chloro-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 7-21 8 nM, 2.6 fold3-bromo-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 7-31 8 nM, 3.1 fold7-hydroxy-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoline-3-
carbonitrile
 7-41200 nM, 2.2 fold6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-3-(1-methyl-
1H-imidazol-4-yl)quinolin-7-ol
 7-51 50 nM, 2.5 fold3-(1H-imidazol-1-yl)-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 7-61300 nM, 2.9 fold6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoline-3,7-
diol
 8-11 86 nM, 2.9 fold3-ethyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 8-21190 nM, 2.50 fold3-isopropyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
 9-11 30 nM, 2.25 fold7-hydroxy-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-2(1H)-
one
 9-21 7 nM, 2.25 fold7-hydroxy-1-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-2(1H)-
one
10-11 10 nM, 3.3 fold4-methoxy-2-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
10-21 65 nM, 2.6 fold2-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-4-(pyrrolidin-1-
yl)quinolin-7-ol
10-31110 nM, 2.6 fold2-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-4-
morpholinoquinolin-7-ol
10-41 12 nM, 2.7 fold4-(dimethylamino)-2-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
10-51 20 nM, 3.3 fold4-ethoxy-2-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
11-11 60 nM, 2.6 fold2-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-4-(1-methyl-
1H-pyrazol-4-yl)quinolin-7-ol
12-11 3 nM, 2.4 fold4-methoxy-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-6-ol
13-11 9 nM, 2.7 fold7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoxalin-6-ol
14-11 63 nM, 2.91 fold6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-3-(tetrahydro-
2H-pyran-4-yl)quinolin-7-ol
15-11 16 nM, 2.68 fold3-chloro-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-6-ol
15-21 19 nM, 2.52 fold3-bromo-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-6-ol
15-31 7 nM, 3.28 fold3-methyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-6-ol
16-11258 nM, 2.44 fold5-bromo-3-methyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-6-ol
17-11685 nM, 2.56 fold6-hydroxy-1-methyl-7-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-4(1H)-
one
18-11 15 nM, 3.24 fold2,3-dimethyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoxalin-6-ol
18-21 9 nM, 3.31 fold2-methyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoxalin-6-ol
18-31 16 nM, 2.72 fold3-methyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoxalin-6-ol
19-11 10 nM, 2.65 fold4-methoxy-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
20-11 84 nM, 2.86 fold4-(azetidin-1-yl)-2-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
20-21 48 nM, 2.68 fold7-hydroxy-2-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoline-4-
carbonitrile
20-31 65 nM, 2.72 fold4-cyclopropyl-2-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
20-41166 nM, 2.72 fold4-(3,6-dihydro-2H-pyran-4-yl)-2-
methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
20-51286 nM, 2.69 fold2-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-4-(tetrahydro-
2H-pyran-4-yl)quinolin-7-ol formate salt
20-61165 nM, 3.18 fold2-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-4-(oxetan-3-
yl)quinolin-7-ol
21-11 60 nM, 3.01 fold4-(dimethylamino)-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol di-
formate salt
22-11110 nM, 2.58 fold7-hydroxy-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinazolin-
4(1H)-one
23-11 41 nM, 3.6 fold6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinazolin-7-ol
24-11 71 nM, 1.74 fold7-hydroxy-1-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-3,4-
dihydroquinolin-2(1H)-one
25-11 23 nM, 2.72 fold7-hydroxy-1-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-3,4-
dihydroquinolin-2(1H)-one
26-11 16 nM, 2.58 fold7-hydroxy-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinoline-1-
carbonitrile
26-21 7 nM, 3.14 fold7-hydroxy-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoline-2-
carbonitrile
26-31 6 nM, 3.47 fold6-hydroxy-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoline-2-
carbonitrile
26-41 7 nM, 2.57 fold6-hydroxy-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinoline-1-
carboxamide
26-51 1 nM, 2.16 fold7-hydroxy-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoline-2-
carboxamide
26-61 7 nM, 2.6 fold6-hydroxy-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoline-2-
carboxamide
26-71 17 nM, 2.64 foldmethyl 6-hydroxy-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinoline-2-
carboxylate
27-11 46 nM, 2.49 fold6-hydroxy-7-(6-(piperazin-1-
yl)pyridazin-3-yl)quinoline-2-
carbonitrile
27-21395 nM, 2.42 fold7-hydroxy-6-(6-(piperazin-1-
yl)pyridazin-3-yl)quinoline-2-
carbonitrile
27-31199 nM, 2.74 fold7-(6-(piperazin-1-yl)pyridazin-3-
yl)isoquinolin-6-ol
28-11155 nM, 1.9 fold7-(6-(1,2,3,6-tetrahydropyridin-4-
yl)pyridazin-3-yl)quinolin-6-ol
29-11 14 nM, 2.96 fold1-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-7-ol
29-21 9 nM, 2.53 fold1-methyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
29-32 40 nM, Amax 24531,3-dimethyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
30-12 30 nM, Amax 20087-hydroxy-3-methyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinoline-1-
carbonitrile
31-12 25 nM, Amax 30141-amino-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
32-12133 nM, Amax 33137-hydroxy-1,3-dimethyl-6-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinazoline-
2,4(1H,3H)-dione
33-12 3 uM, Amax 23966-hydroxy-5-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-
yl)benzo[d]oxazol-2(3H)-one
34-12150 nM, Amax 34482-methyl-5-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-2H-indazol-6-
ol
34-22220 nM, Amax 35341-methyl-5-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-1H-indazol-6-
ol
35-11 3 nM, 2.43 fold6-hydroxy-2-methyl-7-(6-
(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-
1(2H)-one hydrochloride salt
35-22363 nM, Amax 43212-ethyl-6-hydroxy-7-(6-((2,2,6,6-
tetramethylpiperidin-4-yl)oxy)pyridazin-
3-yl)isoquinolin-1(2H)-one
35-31 13 nM, 2.26 fold1-ethoxy-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
35-41 96 nM, 3.26 fold7-(6-((2,2,6,6-tetramethylpiperidin-4-
yl)oxy)pyridazin-3-yl)isoquinoline-1,6-
diol
36-11282 nM, 2.32 fold7-(6-(methyl(2,2,6,6-tetramethyl-
piperidin-4-yl)amino)-pyridazin-3-yl)-3-
phenylisoquinolin-6-ol
36-21 9 nM, 2.64 fold3-methyl-7-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-yl)amino)-
pyridazin-3-yl)isoquinolin-6-ol
36-32 30 nM, Amax 26903-cyclopropyl-7-(6-(methyl(2,2,6,6-
tetramethyl-piperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
36-42190 nM, Amax 19563-isopropyl-7-(6-(methyl(2,2,6,6-
tetramethyl-piperidin-4-
yl)amino)pyridazin-3-yl)isoquinolin-6-ol
36-52580 nM, Amax 16033-propyl-7-(6-((2,2,6,6-
tetramethylpiperidin-4-yl)oxy)-
pyridazin-3-yl)isoquinolin-6-ol
36-62640 nM, Amax 12983-isopropyl-7-(6-((2,2,6,6-
tetramethylpiperidin-4-yl)oxy)-
pyridazin-3-yl)isoquinolin-6-ol
37-11124 nM, 2.33 fold3-methyl-7-(6-(piperazin-1-yl)pyridazin-
3-yl)isoquinolin-6-ol

Comparison of the SMN ELISA (as described in Biological Example 1) potency and fold activation for unsubstituted, ortho-hydroxy and ortho-alkoxy 6,6-heterocyclic substituted pyridazines:

[Figure (not displayed)]

Sub-Exam-SMN ELISAFold
StructurestitutionpleEC50activation
[Figure (not displayed)]
R = H R = OH  1-10.66  0.0202.2 2.9
[Figure (not displayed)]
R = H R = OH R = OMe  6-10.37  0.007 1.17 2.5 2.8 1.7
[Figure (not displayed)]
R = H R = OH  3-20.25  0.0052.7 2.8
[Figure (not displayed)]
R =H R = OH  4-10.32  0.0062.7 2.6
[Figure (not displayed)]
R = OH R = OEt13-1 0.009 Inactive2.7 —

Example 3

[Figure (not displayed)]

[Figure (not displayed)]

[Figure (not displayed)]

[Figure (not displayed)]

[Figure (not displayed)]

[Figure (not displayed)]

[Figure (not displayed)]

Example 6

[Figure (not displayed)]

[Figure (not displayed)]

Example 7

[Figure (not displayed)]

[Figure (not displayed)]

[Figure (not displayed)]

To a vial containing 3-bromo-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-7-ol (Example 7-2, 52 mg, 0.11 mmol), Pd(PPh3)4(13 mg, 0.01 mmol), and zinc cyanide (26 mg, 0.22 mmol) was added DMF (1 mL). The mixture was sealed and heated in a Biotage® Initiator microwave reactor at 120° C. for 1 h. Copper iodide (4 mg, 0.02 mmol) was added and the reaction mixture was heated under microwave irradiation at 120° C. for 1 h. The crude reaction mixture was cooled to room temperature, filtered through Celite® and purified via reverse phase preparative HPLC (15 to 45% acetonitrile in water, 5 mM ammonium hydroxide modifier). The product-containing fractions were concentrated in vacuo to afford 7-hydroxy-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-3-carbonitrile as a brown solid (5 mg). LC/MS Rt=0.51 min. MS (M+1)=417.2. 1H NMR (400 MHz, DMSO-d6) δ 9.01 (d, J=2.0 Hz, 1H), 8.87 (d, J=2.0 Hz, 1H), 8.64 (s, 1H), 8.20-8.36 (m, 2H), 7.38-7.46 (m, 2H), 5.10 (br s, 1H), 2.99 (s, 3H), 1.44-1.74 (m, 4H), 1.32 (s, 6H), 1.17 (s, 6H).

[Figure (not displayed)]

[Figure (not displayed)]

[Figure (not displayed)]

A 1 M solution of BBr3 in DCM (1.2 mL, 1.2 mmol) was added to 7-methoxy-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-3-ol (Example 7-5 Step 2, 50 mg, 0.12 mmol) in DCM (0.6 mL) and the reaction was stirred at room temperature for 3 h. MeOH was added to the reaction and the solvent was concentrated under reduced pressure. The crude material was purified via preparative reverse-phase HPLC (5 to 20% acetonitrile in water, 0.1% formic acid modifier). The solvent was concentrated in vacuo to afford the formate salt of 6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-3,7-diol (3 mg). LC/MS Rt=0.42 min. MS (M+1)=408.3. 1H NMR (400 MHz, DMSO-d6) δ 13.07 (br s, 1H), 8.49 (d, J=2.5 Hz, 1H), 8.37 (s, 1H), 8.32 (d, J=10.0 Hz, 1H), 8.29 (s, 2H), 7.50 (d, J=2.5 Hz, 1H), 7.41 (d, J=10.0 Hz, 1H), 7.29 (s, 1H), 4.91-5.18 (m, 1H), 2.99 (s, 3H), 1.62 (d, J=7.5 Hz, 4H), 1.35 (s, 6H), 1.20 (s, 6H).

Example 10

[Figure (not displayed)]

To a mixture of Intermediate 11 (150 mg, 0.32 mmol) in MeOH (1.5 mL) was added NaOMe (25 wt % in methanol, 0.36 mL, 1.6 mmol). The mixture was heated at 120° C. under microwave irradiation for 1 h. An additional portion of NaOMe (25 wt % in methanol, 0.2 mL) was added and the mixture was then heated at 130° C. for 2 h. The mixture was diluted with aqueous NaHCO3 solution and extracted with DCM. The combined organic extracts were dried over Na2SO4, and concentrated in vacuo to give a light brown solid. The crude product was purified by silica gel chromatography (0-10% 2 M NH3 in MeOH/DCM), then by preparative reverse-phase HPLC to obtain the title compound as a white solid (82 mg). LC/MS Rt=0.41 min. MS (M+1)=436.3. 1H NMR (METHANOL-d4) δ 8.39 (s, 1H), 8.11 (d, J=10.1 Hz, 1H), 7.27 (d, J=10.1 Hz, 1H), 7.24 (s, 1H), 6.66 (s, 1H), 5.09 (t, J=12.1 Hz, 1H), 4.06 (s, 3H), 3.00 (s, 3H), 2.59 (s, 3H), 1.64-1.74 (m, 2H), 1.51-1.62 (m, 2H), 1.39 (s, 6H), 1.23 (s, 6H).

[Figure (not displayed)]

To a mixture of Intermediate 11 (22 mg, 0.046 mmol) in NMP (0.8 mL) was added pyrrolidine (26.3 mg, 0.370 mmol). The mixture was heated at 130° C. under microwave irradiation for 2 h. The mixture was cooled to room temperature, acidified by addition of 1 M HCl in ether and subjected to SCX purification (GENERAL METHOD 3-1, 1 g SiliaBond Propylsulfonic Acid® cartridge). The crude product was further purified by preparative reverse-phase HPLC to obtain 2-methyl-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)-4-(pyrrolidin-1-yl)quinolin-7-ol as a light yellow solid (7.5 mg). LC/MS Rt=0.44 min. MS (M+1)=475.2. 1H NMR (METHANOL-d4) δ 8.59 (s, 1H), 8.14 (d, J=9.6 Hz, 1H), 7.14 (d, J=9.6 Hz, 1H), 6.77 (s, 1H), 6.23 (s, 1H), 5.20 (t, J=12.4 Hz, 1H), 3.91 (br s, 4H), 2.99 (s, 3H), 2.48 (s, 3H), 2.03-2.17 (m, 4H), 1.71 (d, J=3.5 Hz, 2H), 1.51-1.64 (m, 2H), 1.39 (s, 6H), 1.24 (s, 6H).

The following example compounds were prepared from the Intermediate 11 and the appropriate sodium alkoxide or amine according to the preparations of Example 10-1 or Example 10-2.

MS (M + 1),
ExampleCompoundLC/MS Rt1H NMR 400 MHz
10-3[Figure (not displayed)]
491.3 0.41 minMETHANOL-d4 δ 8.27 (s, 1H), 8.05 (d, J = 10.1 Hz, 1H), 7.28 (d, J = 10.1 Hz, 1H), 7.26 (s, 1H), 6.72 (s, 1H), 5.12 (t, J = 11.6 Hz, 1H), 3.92-4.06 (m, 4H), 3.19-3.29 (m, 4H), 3.01 (s, 3H), 2.58 (s, 3H), 1.65-1.76 (m, 2H), 1.52-1.65 (m, 2H), 1.40 (s, 6H), 1.24 (s, 6H)
2-Methyl-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)-4-morpholinoquinolin-7-ol
10-4[Figure (not displayed)]
449.3 0.42 minMETHANOL-d4 δ 8.38 (s, 1H), 8.15 (d, J = 9.6 Hz, 1H), 7.24 (d, J = 9.6 Hz, 1H), 7.09 (s, 1H), 6.55 (s, 1H), 5.18 (t, J = 12.0 Hz, 1H), 3.19 (s, 6H), 3.01 (s, 3H), 2.55 (s, 3H), 1.68-1.78 (m, 2H), 1.57-1.68 (m, 2H), 1.42 (s, 6H), 1.27 (s, 6H)
4-(Dimethylamino)-2-methyl-6-
(6-(methyl(2,2,6,6-tetramethylpiperidin-4-
yl)amino)pyridazin-3-yl)quinolin-7-ol
10-5[Figure (not displayed)]
450.1 0.43 minMETHANOL-d4 δ 8.46 (s, 1H), 8.14 (d, J = 9.6 Hz, 1H), 7.30 (d, J = 9.6 Hz, 1H), 7.26 (s, 1H), 6.67 (s, 1H), 5.13 (t, J = 12.6 Hz, 1H), 4.32 (q, J = 7.1 Hz, 2H), 3.02 (s, 3H), 2.59 (s, 3H), 1.67- 1.74 (m, 2H), 1.62 (m, 5H), 1.39 (s, 6H), 1.24 (s, 6H)
4-Ethoxy-2-methyl-6-(6-(methyl(2,2,6,6-
tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-7-ol

Example 15

[Figure (not displayed)]

Using procedures described in Example 7-1, Steps 1-2, beginning with 6-(6-methoxyquinolin-7-yl)-N-methyl-N-(2,2,6,6-tetramethylpiperidin-4-yl)pyridazin-3-amine (Example 6-1 Step 3, 50 mg, 0.123 mmol), 3-chloro-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-6-ol (6 mg) was obtained as a light yellow solid. LC/MS Rt=0.57 min. MS (M+1)=426.2.

[Figure (not displayed)]

Using procedures described in Example 7-2, Steps 1-2, beginning with 6-(6-methoxyquinolin-7-yl)-N-methyl-N-(2,2,6,6-tetramethylpiperidin-4-yl)pyridazin-3-amine (Example 6-1 Step 3, 200 mg, 0.493 mmol), 3-bromo-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-6-ol (48 mg) was obtained as a light yellow solid. LC/MS Rt=0.60 min. MS (M+1)=472.1. 1H NMR (400 MHz, METHANOL-d4) δ 8.71 (d, J=2.3 Hz, 1H), 8.44 (s, 1H), 8.42 (d, J=2.2 Hz, 1H), 8.34 (d, J=9.9 Hz, 1H), 7.40 (d, J=9.9 Hz, 1H), 7.30 (s, 1H), 5.37-5.17 (m, 1H), 3.08 (s, 3H), 1.75 (dd, J=36.1, 12.5 Hz, 4H), 1.47 (s, 6H), 1.32 (s, 6H).

[Figure (not displayed)]

Example 16

[Figure (not displayed)]

To a solution of 3-methyl-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-6-ol (Example 15-3, 36 mg, 0.089 mmol) in DCM (1 mL) was added N-bromosuccinimide (19 mg, 0.11 mmol). After stirring for one hour, the mixture was diluted with ethyl acetate, washed with saturated sodium bisulfite, brine, dried over magnesium sulfate and concentrated under reduced pressure. The crude material was purified by silica gel chromatography according to GENERAL METHOD 4-1 to provide 5-bromo-3-methyl-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-6-ol (20 mg) as a yellow solid. LC/MS Rt=0.58 min. MS (M+1)=486.4. 1H NMR (400 MHz, METHANOL-d4) δ ppm 8.58 (d, J=2.0 Hz, 1H), 8.38 (s, 1H), 8.34 (d, J=10.1 Hz, 1H), 8.32 (s, 1H), 7.40 (d, J=10.1 Hz, 1H), 5.22 (m, 1H), 3.07 (s, 3H), 2.59 (s, 3H), 1.73-1.82 (m, 2H), 1.60-1.72 (m, 2H), 1.46 (s, 6H), 1.30 (s, 6H).

Example 20

[Figure (not displayed)]

To a mixture of Intermediate 11 (31 mg, 0.070 mmol) in NMP (0.8 mL) was added azetidine (0.047 mL, 0.70 mmol). The mixture was heated at 130° C. under microwave irradiation for 2 h. The mixture was cooled to room temperature, acidified by addition of 1 M HCl in ether and subjected to SCX purification (GENERAL METHOD 3-1, 1 g SiliaBond Propylsulfonic Acid® cartridge). The crude product was further purified by preparative reverse-phase HPLC to obtain 4-(azetidin-1-yl)-2-methyl-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-7-ol as a light yellow solid (16 mg). LC/MS Rt=0.48 min. MS (M+1)=461.3. 1H NMR (METHANOL-d4) δ 8.17 (s, 1H), 8.11 (d, J=9.6 Hz, 1H), 7.14 (d, J=9.6 Hz, 1H), 6.74 (s, 1H), 5.81 (s, 1H), 5.22 (t, J=12.4 Hz, 1H), 4.62 (t, J=7.6 Hz, 4H), 2.99 (s, 3H), 2.56 (dt, J=15.5, 7.6 Hz, 2H), 2.44 (s, 3H), 1.66-1.75 (m, 2H), 1.54-1.66 (m, 2H), 1.40 (s, 6H), 1.25 (s, 6H).

[Figure (not displayed)]

A mixture of Intermediate 11 (40 mg, 0.091 mmol), zinc cyanide (21 mg, 0.18 mmol) and tetrakis(triphenylphosphine)palladium(0) (11 mg, 9.1 μmol) in NMP (1 mL) was evacuated, filled with N2 (4×) and heated under microwave irradiation at 150° C. for 1.5 h. The reaction mixture was filtered through celite, washed with MeOH, concentrated, and subjected to SCX purification (GENERAL METHOD 3-1, 1 g SiliaBond Propylsulfonic Acid® cartridge). The crude product was purified by preparative reverse-phase HPLC to obtain 7-hydroxy-2-methyl-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-4-carbonitrile as a yellow solid (22 mg). LC/MS Rt=0.54 min. MS (M+1)=431.3. 1H NMR (METHANOL-d4) δ 8.37 (s, 1H), 8.24 (d, J=9.6 Hz, 1H), 7.60 (s, 1H), 7.42 (s, 1H), 7.33 (d, J=9.6 Hz, 1H), 5.23 (t, J=11.9 Hz, 1H), 3.05 (s, 3H), 2.71 (s, 3H), 1.70-1.81 (m, 2H), 1.58-1.69 (m, 2H), 1.43 (s, 6H), 1.27 (s, 6H).

[Figure (not displayed)]

[Figure (not displayed)]

A mixture of Intermediate 11 (27 mg, 0.061 mmol), 3,6 dihydro-2H-pyran-4-boronic acid pinacol ester (38.7 mg, 0.18 mmol), tetrakis(triphenylphosphine)palladium(0) (7 mg, 6 μmol) and NaHCO3 (1 M aqueous solution, 0.18 ml, 0.18 mmol) in 1,4-dioxane (0.8 mL) was evacuated, filled with N2 (4×) and heated under microwave irradiation at 120° C. for 1 h. The reaction mixture was filtered through Celite®, washed with MeOH, concentrated, and subjected to SCX purification (GENERAL METHOD 3-1, 1 g SiliaBond Propylsulfonic Acid® cartridge). The crude product was further purified by Silica Gel Chromatography (GENERAL METHOD 4-1) to obtain 4-(3,6-dihydro-2H-pyran-4-yl)-2-methyl-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinolin-7-ol as a yellow solid (27 mg). LC/MS Rt=0.43 min. MS (M+1)=488.3. 1H NMR (METHANOL-d4) δ 8.36 (s, 1H), 8.12 (d, J=10.1 Hz, 1H), 7.38 (s, 1H), 7.30 (d, J=10.1 Hz, 1H), 7.08 (s, 1H), 6.01 (t, J=1.5 Hz, 1H), 5.14 (t, J=12.1 Hz, 1H), 4.41 (q, J=2.5 Hz, 2H), 4.04 (t, J=5.3 Hz, 2H), 3.03 (s, 3H), 2.65 (s, 3H), 2.56 (dd, J=4.5, 2.5 Hz, 2H), 1.67-1.74 (m, 2H), 1.52-1.64 (m, 2H), 1.39 (s, 6H), 1.20-1.27 (m, 6H).

[Figure (not displayed)]

A mixture of Example 20-4 (14 mg, 0.029 mmol), Pd—C (3 mg, 10 wt % on carbon, 3 μmol), Pd(OH)2 (2.0 mg, 20 wt % on carbon, 3 μmol) and one drop of concentrated HCl aqueous solution in methanol (10 mL) was evacuated, filled with H2 (4×) and shaken under H2 (50 psi) on a Parr shaker hydrogenator at room temperature overnight. The reaction mixture was filtered through Celite®, washed with MeOH, concentrated, and subjected to SCX purification (GENERAL METHOD 3-1, 1 g SiliaBond Propylsulfonic Acid® cartridge). The crude product was further purified by preparative reverse-phase HPLC to obtain 2-methyl-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)-4-(tetrahydro-2H-pyran-4-yl)quinolin-7-ol formate salt as a yellow solid (6 mg). LC/MS Rt=0.42 min. MS (M+1)=490.4. 1H NMR (METHANOL-d4) δ 8.42 (s, 1H), 8.40 (s, 1H), 8.23 (d, J=9.8 Hz, 1H), 7.30 (s, 1H), 7.25 (d, J=9.8 Hz, 1H), 7.11 (s, 1H), 5.40 (p, J=8.0 Hz, 1H), 4.07-3.97 (m, 2H), 3.68 (m, 3H), 2.97 (s, 3H), 2.57 (s, 3H), 1.94-1.75 (m, 8H), 1.57 (s, 6H), 1.42 (s, 6H).

[Figure (not displayed)]

To a mixture of Intermediate 11 (46 mg, 0.11 mmol), 3-iodooxetane (27 mg, 0.15 mmol), FeSO4.7H2O (10 mg, 0.034 mmol) and H2SO4 (0.024 mL, 0.45 mmol, ˜1 drop) in DMSO (0.5 mL) was added H2O2(30% aqueous solution, 0.035 mL, 0.34 mmol) at room temperature. After 30 min, another portion of FeSO4.7H2O (9.5 mg, 0.034 mmol) was added and the mixture was stirred at room temperature for 40 min. Further FeSO4.7H2O (9.5 mg, 0.034 mmol) and H2O2(30% aqueous solution, 0.035 mL, 0.34 mmol) was added and the mixture was stirred at room temperature for 60 min, treated with Na2S2O3 (0.5 mL, 20% aqueous solution), and subjected to SCX purification (GENERAL METHOD 3-1, 2 g SiliaBond Propylsulfonic Acid® cartridge). The crude product was further purified by preparative reverse-phase HPLC to obtain 2-methyl-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)-4-(oxetan-3-yl)quinolin-7-ol (5 mg) as a yellow solid. MS (M+1)=462.3. 1H NMR (METHANOL-d4) δ 8.22 (d, J=10.1 Hz, 1H), 8.05 (s, 1H), 7.39 (s, 1H), 7.26-7.35 (m, 2H), 5.29 (dd, J=8.1, 5.6 Hz, 2H), 5.08 (q, J=7.9, 1H), 4.97 (dd, J=7.1, 5.7 Hz, 2H), 3.03 (s, 3H), 2.69 (s, 3H), 1.71 (dd, J=12.6, 3.6 Hz, 2H), 1.59 (t, J=12.4 Hz, 2H), 1.40 (s, 6H), 1.24 (s, 6H).

Example 26

[Figure (not displayed)]

[Figure (not displayed)]

7-Hydroxy-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-2-carbonitrile was prepared from 6-chloro-7-methoxyquinoline according to the synthesis of Example 26-1. LC/MS Rt=0.51. MS (M+1)=417.2 1H NMR (400 MHz, DMSO-d6) δ 8.70 (s, 1H), 8.54 (dd, J=8.5, 0.8 Hz, 1H), 8.33 (d, J=9.9 Hz, 1H), 7.82 (d, J=8.3 Hz, 1H), 7.51-7.37 (m, 2H), 5.21-4.94 (m, 1H), 2.99 (s, 3H), 1.68-1.42 (m, 4H), 1.30 (s, 6H), 1.14 (s, 6H).

[Figure (not displayed)]

6-Hydroxy-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-2-carbonitrile was prepared from 7-Bromo-6-methoxyquinoline according to the synthesis of Example 26-1. LC/MS Rt=0.54. MS (M+1)=417.2 1H NMR (400 MHz, DMSO-d6) δ 8.71 (s, 1H), 8.50 (d, J=9.9 Hz, 1H), 8.41 (d, J=8.5 Hz, 1H), 7.90 (d, J=8.5 Hz, 1H), 7.48-7.39 (m, 2H), 5.26-4.78 (m, 1H), 3.00 (s, 3H), 1.66-1.41 (m, 5H), 1.29 (s, 6H), 1.12 (s, 6H).

[Figure (not displayed)]

[Figure (not displayed)]

7-Hydroxy-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-2-carboxamide was isolated as a by-product from the methoxy deprotection of 7-methoxy-6-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-2-carbonitrile (Example 26-2) using GENERAL METHOD 2-1. LC/MS Rt=0.48. MS (M+1)=435.3 1H NMR (400 MHz, DMSO-d6) δ 8.64 (s, 1H), 8.45 (d, J=8.4 Hz, 1H), 8.35 (d, J=9.9 Hz, 1H), 8.24 (d, J=2.9 Hz, 1H), 7.96 (d, J=8.4 Hz, 1H), 7.71 (d, J=2.8 Hz, 1H), 7.50-7.38 (m, 2H), 5.31-4.88 (m, 1H), 2.99 (s, 3H), 1.57 (s, 4H), 1.30 (s, 6H), 1.14 (s, 6H).

[Figure (not displayed)]

6-Hydroxy-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-2-carboxamide was isolated as a by-product from the methoxy deprotection of 6-methoxy-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-2-carbonitrile (Example 26-3) using GENERAL METHOD 2-1. LC/MS Rt=0.52. MS (M+1)=435.3 1H NMR (400 MHz, Methanol-d4) δ 8.53 (s, 1H), 8.28 (d, J=9.9 Hz, 1H), 8.23 (s, 1H), 8.14 (d, J=8.5 Hz, 1H), 7.38 (s, 1H), 7.28 (d, J=9.8 Hz, 1H), 5.22 (m, 1H), 3.06 (s, 3H), 1.80 (dd, J=12.8, 3.4 Hz, 2H), 1.63 (t, J=12.0 Hz, 2H), 1.45 (s, 6H), 1.29 (s, 6H).

[Figure (not displayed)]

Methyl 6-hydroxy-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-2-carboxylate was isolated as a by-product in the deprotection of 6-methoxy-7-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)quinoline-2-carbonitrile (Example 26-3) by GENERAL METHOD 2-1. LC/MS Rt=0.57. MS (M+1)=450.3 1H NMR (400 MHz, Methanol-d4) δ 8.53 (s, 1H), 8.35-8.19 (m, 2H), 8.06 (dd, J=8.5, 1.5 Hz, 1H), 7.42-7.29 (m, 2H), 5.35-5.08 (m, 1H), 4.04 (d, J=1.5 Hz, 3H), 3.05 (s, 3H), 1.74 (dd, J=12.7, 3.6 Hz, 2H), 1.63 (t, J=12.5 Hz, 2H), 1.43 (s, 6H), 1.27 (s, 6H).

Example 34

[Figure (not displayed)]

[Figure (not displayed)]

1-Methyl-5-(6-(methyl(2,2,6,6-tetramethylpiperidin-4-yl)amino)pyridazin-3-yl)-1H-indazol-6-ol was prepared in the same manner as Example 34-1 (9.4 mg). LC/MS Rt=0.48. MS (M+1)=395.3. 1H NMR (400 MHz, Methanol-d4) δ 8.24-8.12 (m, 2H), 7.95 (d, J=1.0 Hz, 1H), 7.32 (d, J=9.9 Hz, 1H), 6.93 (d, J=0.9 Hz, 1H), 5.14-4.99 (m, 1H), 3.97 (s, 3H), 3.01 (s, 3H), 1.69 (dd, J=12.7, 3.6 Hz, 2H), 1.57 (t, J=12.4 Hz, 2H), 1.38 (s, 6H), 1.23 (s, 6H).

US11672799B2. 1,4-disubstituted pyridazine quinolne analogs there of and methods for treating SMN-deficiency-related conditions (2023-06-13). Novartis AG [CH]. Inventors: Atwood Kim Cheung [US], Natalie Dales [US], Timothy Brian Hurley [US].
Full text: Click here
Patent 2023

Top products related to «Propylsulfonic acid»

1
Bond elut by Agilent Technologies
Sourced in United States
Bond Elut is a solid-phase extraction (SPE) product line offered by Agilent Technologies. It is designed for sample preparation and analyte extraction in various analytical applications.
2
Formaldehyde by Sinopharm
Sourced in China
Formaldehyde is a colorless, flammable gas with a pungent odor. It is widely used as a chemical reagent and preservative in various laboratory applications.
3
Mira3 by TESCAN
Sourced in Czechia, United States, Japan, Germany, China, United Kingdom, France, Australia
The MIRA3 is a high-performance scanning electron microscope (SEM) designed for a wide range of applications. It features a field-emission electron source, which provides high-resolution imaging capabilities. The MIRA3 is equipped with advanced detectors and analytical tools to enable comprehensive material characterization.
4
Ftir 8400s spectrometer by Shimadzu
Sourced in Japan, Germany
The FTIR-8400S spectrometer is a Fourier Transform Infrared (FTIR) spectrometer manufactured by Shimadzu. It uses infrared light to identify and measure the concentration of various compounds in a sample. The FTIR-8400S provides analytical data by detecting the absorption and transmission of infrared light through the sample.
5
Em10c by Zeiss
Sourced in Germany
The EM10C is a compact and versatile electron microscope from Zeiss. It is designed for routine imaging and analysis of a wide range of samples, providing high-quality images and data. The EM10C features a user-friendly interface and advanced optics for reliable performance.
6
Silica gel 60 by Merck Group
Sourced in Germany, United States, Japan, Italy, Switzerland, India, Egypt, Sweden, Canada, China, United Kingdom, Brazil
Silica gel 60 is a porous, amorphous form of silicon dioxide commonly used as a stationary phase in column chromatography. It has a high surface area and is effective at adsorbing a wide range of organic and inorganic compounds. Silica gel 60 is available in various particle sizes and pore sizes to suit different chromatographic applications.
7
Avance drx 500 spectrometer by Bruker
Sourced in Germany, United States, France
The Avance DRX-500 spectrometer is a nuclear magnetic resonance (NMR) instrument manufactured by Bruker. It is designed to perform high-resolution NMR spectroscopy for the analysis of chemical and biological samples. The spectrometer operates at a frequency of 500 MHz and is capable of providing detailed information about the structure, composition, and dynamics of molecules.
8
Protease inhibitor by Merck Group
Sourced in United States, Germany, China, United Kingdom, Italy, Macao, Sao Tome and Principe, Canada, Japan, France, Switzerland, Israel
Protease inhibitors are a class of pharmaceutical compounds that work by inhibiting the activity of proteases, which are enzymes that break down proteins. They are commonly used in the treatment of various conditions, including viral infections and certain types of cancer. Protease inhibitors function by binding to and blocking the active site of proteases, preventing them from carrying out their enzymatic activities.
9
Speed vac concentrator centrifuge by Thermo Fisher Scientific
Sourced in United States
The Speed-Vac concentrator centrifuge is a versatile laboratory equipment used to concentrate liquid samples through evaporation. It provides a controlled environment for rapid solvent removal from samples, maintaining sample integrity during the process.
10
Bca protein assay by Thermo Fisher Scientific
Sourced in United States, United Kingdom, China, Australia, Germany, France, Italy, Switzerland, Belgium, Japan, Netherlands, Spain, Canada
The BCA protein assay is a colorimetric detection and quantification method used to measure the total protein concentration in a sample. It utilizes the reduction of copper ions by proteins in an alkaline medium, which produces a purple-colored reaction product that can be measured spectrophotometrically.

More about "Propylsulfonic acid"

Propylsulfonic acid, also known as 1-Propanesulfonic acid, is an organic sulfonic acid compound with the chemical formula C3H7SO3H.
This versatile reagent and intermediate is widely used in various chemical processes and research applications, including organic synthesis, analytical chemistry, and materials science.
Key properties of propylsulfonic acid include its strong acidity, excellent solubility in polar solvents, and high thermal stability, making it a valuable tool for researchers and chemists.
The compound can be used in a variety of applications, such as acting as a catalyst, a pH adjuster, or a component in buffer solutions.
When it comes to optimizing propylsulfonic acid studies, researchers can leverage AI-driven tools like PubCompare.ai to identify the most effective protocols from the scientific literature, preprints, and patents.
This platform allows users to compare and evaluate different experimental methods, ensuring that they can select the most reproducible and accurate procedures for their research.
In addition to PubCompare.ai, other relevant tools and techniques that may be useful in propylsulfonic acid research include Bond Elut for solid-phase extraction, Formaldehyde for chemical derivatization, MIRA3 for molecular imaging, FTIR-8400S spectrometer for infrared spectroscopy, EM10C for electron microscopy, Silica gel 60 for chromatography, Avance DRX-500 spectrometer for NMR analysis, Protease inhibitors for protein studies, and Speed-Vac concentrator centrifuge for sample preparation.
By leveraging these resources and techniques, researchers can optimize their propylsulfonic acid studies, leading to more reproducible and accurate results, and advancing the field of organic chemistry and materials science.