Rhodamine-dextran-amine dye

Example 1

In this example the binding molecules are pMHC complexes, the linker is a dextran-streptavidin-fluorochrome conjugate, and the label is a DNA oligonucleotide.

The sample is a HPBMC from humans, the isolating and/or detecting is done by flow cytometry (FACS), and the determining of the identity of the label is done by quantitative PCR (QPCR).

This is an example where the Sample (1) was blood from one CMV positive and HIV negative donor which was modified (1b) to generate Peripheral blood mononuclear cells (PBMCs).

The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The binding molecules (3) were peptide-MHC (pMHC) complexes displaying either CMV (positive antigen) or HIV (negative antigen) derived peptide-antigens. The binding molecules were modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding molecules were purified (2c) by HPLC and quality controlled in terms of the formation of functional pMHC multimers for staining of a control T-cell population.

The Labels (4) were oligonucleotides applied as DNA-barcodes. The oligonucleotides were synthetized (4a) by DNA Technology A/S (Denmark) and were synthetically modified (4b) with a terminal biotin capture-tag. The labels were combined oligonucleotide labels arising by annealing an A oligonucleotide (modified with biotin) to a partially complimentary B oligonucleotide label followed by enzymatic DNA polymerase extension of Oligo A and Oligo B to create a fully double stranded label. The detection molecule (5) was synthetized (5a) by attaching binding molecules in the form of biotinylated pMHC and labels in the form of biotin-modified double stranded oligonucleotides onto a streptavidin-modified dextran linker. The detection molecule further contained a modification (5b) in the form of a fluorochrome. Two different detection molecules were generated wherein the two individual detection molecules containing different pMHC were encoded by corresponding individual oligonucleotide labels.

An amount of sample, PBMC's (1b) was incubated with an amount of mixed detection molecules (5) under conditions (6c) that allowed binding of detection molecules to T cells in the sample.

The cell-bound detection molecules were separated from the non-cell bound detection molecules (7) by first a few rounds of washing the PBMC's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind detection molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the PBMC sample.

FACS isolated cells were subjected to quantitative PCR analysis of the oligonucleotide label associated with the detection molecules bound to the isolated cells to reveal the identity of the detection molecules that bound to the T cells present in the sample. This example thus revealed the presence of T cells in the blood expressing a T cell receptor that binds to peptide-MHC molecules represented within the library of Detection Molecules. It also revealed the feasibility of enriching for Detection Molecules based on the presence of T cells specific for the positive peptide-antigen (CMV) over the negative peptide-antigen (HIV) antigens.

• • 1. Sample preparation. The cell sample used in this example was obtained by preparing PBMC's from blood drawn from a donor that was CMV positive as well as HIV negative as determined by conventional MHC-multimer staining.
    
    • a. Acquiring sample: Blood was obtained from the Danish Blood Bank, in the form of buffy coats (BC). A peripheral blood mononuclear cell preparation obtained following standard donor blood preparations.
    • b. Modifying sample: Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood by density gradient centrifugation. The density gradient medium, Lymphoprep (Axis-Shield), which consists of carbohydrate polymers and a dense iodine compound, facilitate separation of the individual constituents of blood. Blood samples were diluted 1:1 in RPMI (RPMI 1640, GlutaMAX, 25 mM Hepes; gibco-Life technologies) and carefully layered onto the Lymphoprep. After centrifugation, 30 min, 490 g, PBMCs together with platelets were harvested from the middle layer of cells. The isolated cells, the buffy coat (BC), was washed twice in RPMI and cryopreserved at −150° C. in fetal calf serum (FCS; gibco-Life technologies) containing 10% dimethyl sulfoxide (DMSO; Sigma-Aldrich). BC's used in this example are listed in table 1 along with peptide-antigen specific T cells identified within these samples by conventional MHC multimer staining.
  • 2. Linker preparation: The linker used in this example was a dextran molecule, to which was attached streptavidin and fluorochromes. The streptavidin served as attachment sites for biotinylated oligonucleotides (Label) and biotinylated peptide-MHC complexes (Binding Molecules). The fluorochrome allowed separation of cells bound to detection molecules from cells not bound to detection molecules.
    
    • i. In this example linkers were linear and branched dextran molecules with covalently attached streptavidin (5-10 per linker) and fluorochromes (2-20 per linker) in the form of PE. Linkers were essentially Dextramer backbone as described by Immudex.
  • 3. Binding molecules preparation: The binding molecules used in this example were two different class I MHC-peptide complexes. MHC heavy chains (HLA-A0201 and HLA-B0702) and B2M were expressed in E.coli as previously described (Hadrup et al. 2009) and each MHC-I complex generated with two peptide antigens. The individual specificities (allele and peptide combination) were generated in the following way:
    
    • a. Synthesis: Binding molecules in this example were specific pMHC monomers that were produced from UV-exchange of selected HLA-I monomers carrying a photolabile 9-residue peptide-ligand (p*). When exposed to UV-light (366 nm) the photolabile ligand will be cleaved and leave the binding groove empty. Due to the instability of empty MHC-I molecules, the complexes will quickly degrade if they are not rescued by replacement with another peptide that match that HLA-type. In this way specific pMHC monomers were produced by mixing excess of desired HLA ligands with p*MHC monomers. p*MHC monomers were refolded, biotinylated and purified as previously described (Hadrup et al. 2009).
      
      • i. HIV derived peptide ILKEPVHGV from antigen HIV polymerase and CMV derived peptide TPRVTGGGAM from antigen pp65 TPR (Pepscan Presto, NL) were diluted in phosphate buffered saline (DPBS; Lonza) and mixed to final concentrations 100 μg/ml:200 μM (HLA-A0201: ILKEPVHGV and HLA-B0702:TPRVTGGGAM). The mixtures were exposed to 366 nm UV light (UV cabinet; CAMAG) for one hour and optionally stored for up to 24 h at 4° C.
    • b. Modification: No further modifications
    • c. Purification: Before applying the peptide exchanged HLA monomer Binding Molecules for preparation of detection molecules these were centrifuged 5 min, 3300 g, to sediment any aggregated MHC molecules.
  • 4. Label preparation: In this example, two different double stranded oligonucleotides, DNA barcodes, of the same length but partially different sequence, were generated. Each of the DNA barcodes would become attached to a specific pMHC, and thus functioned as a Label for this specific Binding Molecule. The oligonucleotides were biotinylated, allowing easy attachment to the dextran-streptavidin conjugate linker.
    
    • a. Synthesis: The Labels were generated from partially complementary oligonucleotides which were purchased from DNA Technology (Denmark) and delivered as lyophilized powder. Stock dilutions of 100 μM oligonucleotides were made in nuclease free water and stored at −20° C.
      
      • i. The Label system used in this example was named 2OS and was developed to increase the complexity of a limited number of oligonucleotide sequences. This was enabled by applying a combinatorial strategy where two partially complementary oligonucleotides (an A oligonucleotide with a 5′ biotin tag and a B oligonucleotide) where annealed and then elongated to produce new unique oligonucleotide-sequences (AxBy) which were applied as a DNA-barcodes (Labels) (see FIG. 9 for design of the DNA-barcodes).By combining 2 unique oligonucleotide-sequences (A label precursor) that were partly complementary to 2 other unique oligonucleotide sequences (B label precursor) a combinatorial library of 4 different (AxBy) Labels were produced. Only 2 of these Labels were used in this example (A1B1 and A2B2). Refer to table 2 for an overview of the different 2OS A and B nucleotide sequences. Briefly:
      • Partly complementary A and B oligonucleotides were annealed to produce two combined A+B DNA barcodes (A1+B1 to produce A1B1 and A2+B2 to produce A2B2). The respective A and B oligonucleotides were mixed as stated in table 3, heated to 65° C. for 2 min and cooled slowly to <35° C. in 15-30 min. The annealed A and B oligonucleotides were then elongated as stated in table 3. Elongation reagents were mixed <15 min before use. After mixing, the reactions were incubated 5 min, RT, to allow elongation of the annealed oligonucleotides. The reagents used for annealing (left) and elongation (right) of partly complementary oligonucleotides is described in table 3. Reagents marked in italic were from the Sequenase Version 2.0 DNA Sequencing Kit (Affymetrix #70770).
    • b. Modification: All labels were diluted to working concentrations (2.17 uM) in nuclease free water with 0.1% Tween and stored at −20° C.
    • c. Purification: Labels were not purified further.
  • 5. Detection Molecules preparation: The Binding Molecules (pMHCs) and Labels (DNA-barcodes) were attached to the Linker (dextran-streptavidin-PE conjugate), to form Detection Molecules, in such a way that a given pMHC was always attached to a given DNA-barcode.
    
    • a. Synthesis: For preparation of Detection Molecules the 2OS DNA-barcodes were attached to the dextramer prior to addition of pMHC. 1 ul dextramer was used for every 3 ul of prepared Detection Molecule. Briefly, for generation of Detection Molecules:
      
      • i. The Label:linker conjugate were generated by addition of label in two fold excess over linker (label:linker, 2:1) i.e. 1×0.16 uM linker (dex), were mixed with 0.15×2.17 uM label (2OS DNA-barcode) and incubated at least 30 min, 4° C.
      • ii. Binding molecules, in the form of biotinylated UV-exchanged peptide-MHC monomer, were added to the label:linker conjugate to reach a concentration of 44 ug/ml of the given pMHC in 3 ul, and incubated 30 min, RT.
      • The final volume was reached by addition of 0.02% NaN₂ in PBS together with D-biotin (Avidity Bio200) in a final concentration of 12.6×10⁻⁶M. The detection molecule preparation was incubated 30 min, 4° C., and optionally stored for up to 4 weeks at 4° C. (overview of the amounts used can be found in table 4).
      • Two sets of two detection molecules were generated. Each set with the two specificities individually labeled. The label was inverted between the two sets as described below.
        
        • 1. 1×CMV specific pMHCs (HLA-A0201: ILKEPVHGV) coupled to 2OS-A1B1, 1×HIV specific pMHCs (HLA-B0702:TPRVTGGGAM) coupled to 2OS-A2B2.
        • 2. 1×CMV specific pMHCs (HLA-A0201: ILKEPVHGV) coupled to 2OS-A2B2, 1×HIV specific pMHCs (HLA-B0702:TPRVTGGGAM) coupled to 2OS-A1B1.
    • b. Modification: No further modifications were performed
    • c. Purification: The Detection Molecules were centrifuged 5 min, 3300 g, to sediment any aggregates before being added to the cell sample,
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules were mixed in one container to allow Detection Molecules to bind to T cells.
    
    • a. Amount of sample: 1×10E6-2×10E6 cells in the form of BC's, were used.
    • b. Amount of detection molecule: According to table 4. for staining in 100 ul 1.32 ug/ml calculated in relation to each binding molecule (specific peptide-MHC) on the Detection Molecule was required per incubation, i.e. 3 ul of each Detection Molecule.
    • c. Conditions: BCs were thawed in 10 ml, 37° C., RPMI with 10% fetal bovine serum (FBS), centrifuged 5 min, 490 g, and washed twice in 10 ml RPMI with 10% FBS. All washing of cells refer to centrifugation 5 min, 490 g, with subsequent removal of supernatant. 1×10E6-2×10E6 cells were washed in 200 ul barcode-buffer (PBS/0.5% BSA/2 mM EDTA/100 μg/ml herring DNA) and resuspended in this buffer to approximately 20 μl per sample. The barcode buffer is optimized to increase the stability of the oligonucleotides associated with the Detection molecules. The cells were incubated with 50 nM dasatinib, 30 min, 37° C., prior to incubation of cells with Detection Molecules.
      
      • i. The Detection molecules were added in the required amount. If necessary barcode-buffer was added to reach a total volume of 100 ul and cells were incubated 15 min, 37° C. 20 ul antibody mixture containing PerCP-conjugated anti-CD8 antibody and dump channel FITC-conjugated antibodies (table 5) along with 0.1 μl near-IR-viability dye (Invitrogen L10119) was added for every 100 ul of PBMC:detection molecule sample. The samples were incubated 30 min, 4° C., and cells were washed twice in 200 ul barcode-buffer. Optionally cells were fixed in 1% paraformaldehyde in DPBS overnight, 4° C., and washed twice in barcode-buffer. Fixed cells were stored for up to a week at 4° C.
  • 7. Enrichment of detection molecules with desired characteristics: The Detection Molecules were enriched by using flow cytometry, more specifically, Fluorescence-Activated-Cell-Sorting (FACS). Since all Detection Molecules carried a PE-fluorescent label, the cells that bound to Detection Molecules would fluoresce according to this fluorochromes emission peak. By applying a FACS sorter this feature could be used to separate cells that bound to detection molecules from cells that did not bind Detection Molecules i.e. to separate those cells that did fluoresce from those cells that did not fluoresce. As a result the Detection Molecules that bound to cells, and hence the associated Labels, were enriched for.
    
    • a. Apply: Cells were sorted on a BD FACSAria, equipped with three lasers (488 nm blue, 633 nm red and 405 nm violet). The flow cytometry data analyses were performed using the BD FACSDiva software version 6.1.2. The following gating strategy was applied: Lymphocytes were identified in a FSC/SSC plot. Additional gating on single cells (FSC-A/FSC-H), live cells (near-IR-viability dye negative), and CD4, CD14, CD16, CD19, CD40 negative (FITC)/CD8 positive cells (PerCP) were used to define the CD8 T cell population (table 5). The PE positive population, i.e. the cells that bound to detection molecules, were defined within the PerCP positive population
    • b. Wash: not applied
    • c. Separate: The PE positive cells were sorted by FACS, as described in 7a, into tubes that contained 200 μl barcode-buffer and that had been pre-saturated for 2 h-O.N. in 2% BSA. The sorted cells were centrifuged 5 min, 5000 g, to allow removal of excess buffer (<10 ul should reside in the container). Cells were stored at −80° C.
  • 8. Identification of enriched Detection Molecules: Since the Detection Molecules were enriched based on specific binding of the Binding Molecule (the pMHC) to cells, the identification of the associated Labels (oligonucleotide barcodes) amongst the sorted cells would also reveal the pMHCs that had bound to cells in the PBMC sample. In this example the enriched Detection Molecules were identified by quantitative PCR (QPCR) using Label-specific fluorescent reporter probes.
    
    • a. Apply: Labels derived from sorted cells were analyzed by QPCR with the Brilliant II QRT-PCR Low ROX Master Mix Kit (Agilent technologies, #600837) according to table 6. PCR was run on the thermal cycler: Mx3000P qPCR system (Agilent Technologies). The thermal profile is listed in table 7 and the label-specific fluorescent reporter probes were: Probe123: 5′6-FAM/GCCTGTAGTCCCACGCGATCTAACA/3′BHQ_1 for detection of label 2OS-A1B1 and Probe124: 5′HEX/CAACCATTGATTGGGGACAACTGGG/3′BHQ_1 for detection of label 2OS-A2B2. The label specific reporter probes were purchased from DNA Technology (Denmark) and delivered as lyophilized powder. Stock dilutions of 100 μM oligonucleotides were made in nuclease free water and stored at −20° C. Primers used for amplification in this experiment forward: GAAGTTCCAGCCAGCGTC, and reverse: CTGTGACTATGTGAGGCTTTC.
    • b. Analysis: combined with the above.

After sorting of PE labeled cells and QPCR the resultant Ct values confirmed that Detection Molecules were enriched, i.e. 2OS DNA-barcode Labels were successfully recovered, only when associated with the CMV epitope, while they were not detected when associated with the HIV epitope (FIG. 10). This was observed even when labels were inverted between the two Binding Molecules, implying that the recovery was not Label specific, but truly specific for the Binding molecule.

It was verified that the 2OS labels were recovered after cellular interaction, sorting and QPCR only if they were associated with positive control Detection molecules, and not if they were associated with negative control Detection molecules.

Example 2

In this example the binding molecules are pMHC complexes, the linker is a dextran-streptavidin-fluorochrome conjugate, and the label is a DNA oligonucleotide.

The sample is a HPBMC, the isolating and/or detecting is by FACS, and the determining of the identity of the label is by QPCR.

This is an example where the Sample (1) was blood from one CMV positive and HIV negative donor which was modified (1b) to generate Peripheral blood mononuclear cells (PBMCs).

The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The example is similar to example 1 except that a 1000 fold excess of Detection Molecules with irrelevant Binding Molecules but without label were included. The Binding Molecules used (3) are peptide-MHC (pMHC) complexes displaying either CMV (positive antigen) or HIV (negative antigen) derived peptide-antigens or pMHC complexes displaying irrelevant peptide antigen. The Binding Molecules were modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding Molecules were purified (2c) by HPLC.

The Labels (4) were single stranded oligonucleotides applied as DNA-barcodes. The oligonucleotides were synthetized (4a) by DNA Technology A/S (Denmark) and were synthetically modified (4b) with a terminal biotin capture-tag.

The Detection Molecule (5) was synthetized (5a) by attaching binding molecules in the form of biotinylated pMHC and Labels in the form of biotin-modified oligonucleotides, DNA-barcodes, onto a streptavidin-modified dextran linker. The detection molecule further contained a modification (5b) in the form of a fluorochrome. Three different detection molecules were generated wherein the two of these individual detection molecules containing CMV- and HIV-directed pMHC were encoded for by corresponding individual DNA-barcodes. Detection Molecules with irrelevant Binding Molecules (p*MHC) were not encoded for with a DNA-barcode.

An amount of sample, PBMC's (1b) was incubated with an amount of mixed detection molecules (5) in a ratio of 1:1:998 (Labeled-CMV:Labeled-HIV:unlabeled-irrelevant directed Binding Molecules) under conditions (6c) that allowed binding of detection molecules to T cells in the sample.

The cell-bound detection molecules were separated from the non-cell bound detection molecules (7) by first a few rounds of washing the PBMC's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind detection molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the PBMC sample.

FACS isolated cells were subjected to quantitative PCR analysis of the oligonucleotide label associated with the detection molecules bound to the isolated cells to reveal the identity of the detection molecules that bound to the T cells present in the sample. This example thus revealed the presence of T cells in the blood expressing a T cell receptor that binds to peptide-MHC molecules represented within the library of Detection Molecules. It also revealed the feasibility of enriching for Detection Molecules based on the presence of T cells specific for the positive peptide-antigen (CMV) over the negative peptide-antigen (HIV) antigens. In this setting, it was proved that it was possible to specifically enrich Detection Molecules associated with positive peptide-antigen when excess of irrelevant Detection Molecule was included in the sample incubation.

• • 1. Sample preparation. The cell sample used in this example was obtained in the same way as described in example 1
  • 2. Linker preparation: The linker used in this example was prepared as in example 1
  • 3. Binding Molecules preparation: The binding molecules used in this example were two different class I MHC-peptide complexes. MHC heavy chains (HLA-A02 and HLA-B07) and B2M were expressed in E.coli as previously described (Hadrup et al. 2009) and each MHC-I complex generated with two peptide antigens or left with an irrelevant photolabile 9-mer peptide. The individual specificities (allele and peptide combination) were generated in the following way:
    
    • a. Synthesis: As in example 1.
      
      • i. HIV derived peptide ILKEPVHGV from antigen HIV polymerase and CMV derived peptide TPRVTGGGAM from antigen pp65 TPR (Pepscan Presto, NL) were diluted in phosphate buffered saline (DPBS; Lonza) and mixed to final concentrations 100 μg/ml:200 μM (HLA-A0201: ILKEPVHGV and HLA-B0702:TPRVTGGGAM). The mixtures were exposed to 366 nm UV light (UV cabinet; CAMAG) for one hour and optionally stored for up to 24 h at 4° C. The irrelevant Binding Molecules, p*HLA-A0201 and p*HLA-B0702 were mixed in equal amounts (pg/ml) and diluted to 100 μg/ml in DPBS.
    • b. Modification: No further modifications
    • c. Purification: Before applying the peptide exchanged HLA monomer Binding Molecules for preparation of detection molecules these were centrifuged 5 min, 3300 g, to sediment any aggregated MHC molecules. The p*MHC monomers were not purified further.
  • 4. Label preparation: In this example Labels were synthetic oligonucleotides modified with biotin for coupling to the Linker.
    
    • a. Synthesis: The Labels were oligonucleotides, DNA barcodes, which were purchased from DNA Technology (Denmark) and delivered as lyophilized powder. Stock dilutions of 100 μM oligonucleotide were made in nuclease free water and stored at −20° C.
      
      • i. The Label system used in this example was named 1OS and comprised of single stranded oligonucleotides which were applied as a DNA barcodes (Oligo 4: 5GAGATACGTTGACCTCGTTGAANNNNNNTCTTGAACTATGA ATCGTCTCACTTAAGCTCTTGGTTGCAT and Oligo 5: 5GAGATACGTTGACCTCGTTGAANNNNNNTCTATAGGTGTC TACTACCTCACTTAAGCTCTTGGTTGCAT were used in this experiment, 5 indicates a 5′ biotin modification).
    • b. Modification: All Labels were diluted to working concentrations (2.17 uM) in nuclease free water with 0.1% Tween and stored at −20° C.
    • c. Purification: Labels were not purified further.
  • 5. Detection Molecules preparation: The Binding Molecules (pMHCs) and Labels (oligonucleotides) were attached to the Linker (dextran-streptavidin-PE conjugate), to form Detection Molecules, in such a way that a given pMHC was always attached to a given DNA-barcode.
    
    • a. Synthesis: In this example the Detection Molecules were prepared by attaching 1OS DNA-barcodes prior to addition of pMHC. Detection Molecules were essentially generated in the same way as described in example 1, with the difference that two different sets of two detection molecules were generated.
      
      • Each set had two specificities individually labeled. The Labels were inverted between the two sets as described below. Moreover a third Detection Molecule was generated without any Label, but comprised of the Linker and a Binding Molecule (p*MHC), this detection molecule was included in both sets of Detection Molecules as described below in the indicated stoichiometry:
      • 1. 1×CMV specific pMHCs (HLA-A0201: ILKEPVHGV) coupled to Oligo4, 1×HIV specific pMHCs (HLA-B0702:TPRVTGGGAM) coupled to Oligo5 and 998× non-labeled p*MHC (HLA-A0201:p* and HLA-B0702:p*).
        
        • 2. 1×CMV specific pMHCs (HLA-A0201: ILKEPVHGV) coupled to Oligo5, 1×HIV specific pMHCs (HLA-B0702:TPRVTGGGAM) coupled to Oligo4 and 998× non-labeled p*MHC (HLA-A0201:p* and HLA-B0702:p*).
    • b. Modification: Since the total volume of each set of Detection Molecules exceeded 100 μl this volume was reduced to reach a desired concentration of specific Binding Molecules in the pooled solution of Detection Molecules.
      
      • i. Size exclusion spin columns (Nanosep 300K Omega, Pall Corporation) with a cut-off at 300 kDa were saturated by adding 500 μl 2% BSA/DPBS and centrifuging 5000 g, until the volume had passed through. Subsequently, the columns were washed twice by adding 500 μl DPBS and centrifuging 5000 g until no volume was left in the columns. Each pooled set of detection molecules were added to a spin column and centrifuged 5000 g, 4° C., until the desired volume resided in the column (80 μl per incubation with sample). The reduced volume of each set of Detection Molecules was moved to new containers.
    • c. Purification: The Detection Molecules were centrifuged 5 min, 3300 g, to sediment any aggregates before being added to the sample.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules were incubated in the same way as described in example 1.
  • 7. Enrichment of Detection Molecules with desired characteristics: The Detection Molecules were enriched for in the same way as described in example 1.
  • 8. Identification of enriched Detection Molecules: Enriched Detection Molecules were essentially identified in the same way as described in example 1, with the difference that two different label-specific fluorescent reporter probes were applied: LNA-4: 5′6-FAM/TCT[+T][+G][+A]AC[+T][+A]TG[+A][+A][+T]CGTC/3′BHQ-1-plus for detection of Oligo4 and LNA-5: 5′HEX/TCT[+A][+T][+A]GG[+T][+G]TC[+T][+A][+C]TACC/3′BHQ-1-plus for detection of Oligo5 ([+X] indicating locked nucleic acids (LNAs)). Primers used for amplification of Oligo 4 and Oligo 5, forward: GAGATACGTTGACCTCGTTG and reverse: ATGCAACCAAGAGCTTAAGT.

After sorting of PE labeled cells and QPCR the resultant Ct values confirmed that Detection Molecules were enriched, i.e. 1OS DNA-barcode Labels were successfully recovered, only when associated with the CMV epitope, while they were not detected when associated with the HIV epitope (FIG. 11). This was observed even when labels were inverted between the two Binding Molecules, implying that the recovery was not Label specific, but truly specific for the Binding molecule. Moreover the example demonstrated that a great amount of irrelevant Detection molecule equipped with the same fluorescent label as all Detection molecules in the incubation would not be detrimental for enrichment of cells that would fluoresce due to specific binding with a Detection molecule.

It was verified that the 1OS Labels were recovered after cellular interaction, sorting and QPCR only if they were associated with positive control Detection molecules, and not if they were associated with negative control Detection molecules, even in the presence of a high amount of irrelevant Detection molecule.

Example 3

In this example the binding molecules are pMHC representing 6 different HLA-alleles, the linker is dextran-streptavidin-PE conjugate and the label is a DNA oligonucleotide.

The sample is HPBMC, the isolating and/or detecting is by FACS, and the determining of the identity of the label is by sequencing.

This is an example where the Samples (1) were blood from one donor that were HLA-B0702:CMV pp65 TPR positive and another donor that were HLA-B0702 negative which were modified (1b) to generate Peripheral blood mononuclear cells (PBMCs). These samples were mixed in different ratios to generate new samples with different but known frequencies of T cells specific toward the HLA-B0702:CMV epitope.

The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) were peptide-MHC (pMHC) complexes displaying one out of 110 different peptide-antigens comprised within 6 different HLA-types. The MHC molecules were modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding molecules were purified (2c) by HPLC and quality controlled in terms of the formation of functional pMHC multimers for staining of control T-cell populations.

The Labels (4) were single stranded oligonucleotide applied as DNA-barcodes. The oligonucleotides were synthetized (4a) by DNA Technology A/S (Denmark) and were synthetically modified (4b) with a terminal biotin capture-tag.

The Detection Molecule (5) was synthetized (5a) by attaching Binding Molecules in the form of biotinylated pMHC and Labels in the form of biotin-modified oligonucleotides (DNA-barcodes) onto a streptavidin-modified dextran linker. The detection molecule further contained a modification (5b) in the form of a fluorochrome. A library of 110 different Detection Molecules were generated wherein individual Binding Molecules, comprised of different pMHC, were encoded for by corresponding individual Labels, comprised of different DNA-barcodes.

An amount of sample, PBMC's (1b) was incubated with an amount of mixed Detection Molecules (5) under conditions (6c) allowing binding of Detection Molecules to T cells in the sample.

The cell-bound Detection Molecules were separated from the non-cell bound Detection Molecules (7) by first a few rounds of washing the PBMC's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind Detection Molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the PBMC sample.

FACS isolated cells were subjected to PCR for specific amplification of the DNA-barcode Label associated with the Detection Molecules bound to the isolated cells. High throughput sequencing of the resultant PCR product revealed the identity of Detection Molecules that bound to T cells present in the sample.

This example thus revealed the presence of T cells in the blood expressing a T cell receptor that binds to pMHC molecules represented within the library of Detection Molecules. The number of sequencing reads mapped to a given DNA-barcode and its corresponding Binding Molecule would mirror the frequency of the T cells found by conventional MHC multimer stainings using the same Binding Molecule.

• • 1. Sample preparation. The cell samples used in this example was obtained by preparing PBMC's from blood drawn from one donor that were HLA-B0702:CMV pp65 TPR positive and from another donor that were HLA-B0702 negative, as determined by conventional pMHC-multimer and antibody stainings.
    
    • a. Acquiring sample: As in example 1
    • b. Modifying sample: PBMCs were isolated from whole blood as described in example 1.
      
      • i. Mixing of PBMCs from the two donors provided a titration of the HLA-B0702 CMV pp65 TPR responses in a B0702 negative donor sample. 5 fold dilutions of BC260 into BC262 were applied to generate seven samples with: 100, 20, 4, 0.8, 0.16, 0.032 and 0.0064% of cells derived from BC260. This corresponded to theoretical frequencies of HLA-B0702 CMV pp65 TPR specific T cells of 5%, 1%, 0.2%, 0.04%, 0.008%, 0.0016% and 0.00032%. The samples were in turn applied to evaluate the sensitivity of the Detection Molecules for detecting antigen-specific T cells in a sample. The relevance of the results obtained after applying the Detection Molecules could be evaluated by comparison of results obtained by conventional pMHC-multimer staining when applying a corresponding sample.
  • 2. Linker preparation: The linker used in this example was prepared as in example 1-2.
  • 3. Binding Molecules preparation: The Binding Molecules used in this example were class I MHC-peptide complexes. The individual specificities (allele and peptide combination) were generated as described in example 1. A library of 110 different pMHCs, comprised of 6 different HLA-types, were generated, these are listed in table 9.
    
    • a. Synthesis: As described in example 1-2
    • b. Modification: No further modifications
    • c. Purification: As described in example 1-2
  • 4. Label preparation: In this example Labels were synthetic oligonucleotides modified with biotin for coupling to the Linker. 110 different Labels from the 1OS system were applied (table 8).
    
    • a. Synthesis: As described in example 2
      
      • i. The Label system used in this example were named 1OS and comprised of single stranded oligonucleotides which were applied as a DNA barcodes.
    • b. Modification: As described in example 1-2.
    • c. Purification: As described in example 1-2.
  • 5. Detection Molecules preparation: 110 different Detection Molecules were generated, each with a different Binding Molecule encoded by a unique Label. The Binding Molecules (pMHCs) and Labels (1OS DNA-barcodes) were attached to the Linker (dextran-streptavidin-PE conjugate), to form Detection Molecules, in such a way that a given pMHC was always attached to a given DNA-barcode.
    
    • a. Detection Molecules were essentially generated in the same way as described in example 2, with the difference that 110 different Detection Molecules were generated. The given combination of Label (DNA-barcode) and Binding Molecule (pMHC) of each Detection Molecule are presented in table 9.
    • b. Modification: Since the total volume of 110 pooled Detection Molecules exceeded 100 μl this volume was reduced to reach a desired concentration of specific Binding Molecules. This was done as described in example 2
    • c. Purification: As described in example 1-2.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules were mixed in one container to allow Detection Molecules to bind to T cells.
    
    • a. Amount of sample: Duplicates of seven samples each comprised of 2×10E6 cells in the form of BC's, i.e. 2×(1×100% BC260 and 6× five-fold dilutions of BC260 into BC262) (as described in 1.b)
    • b. Amount of Detection Molecule: As described in example 1
    • c. Conditions: BC260 and BC262 were thawed individually in 10 ml, 37° C., RPMI with 10% fetal bovine serum (FBS), centrifuged 5 min, 490 g, and washed twice in 10 ml RPMI with 10% FBS. All washing of cells refer to centrifugation 5 min, 490 g, with subsequent removal of supernatant. BC's were incubated individually in 50 nM dasatinib, 30 min, 37° C. and resuspended in 10 ml per 2×10E6 cells of the respective BC. Five-fold dilutions of BC260 were produced by adding 2.5 ml (0.5×10E6) of the former cell sample into 10 ml (2×10E6 cells) of the BC262 sample. The mixed cellular samples were washed in 200 ul barcode-buffer (PBS/0.5% BSA/2 mM EDTA/100 μg/ml herring DNA) and resuspended in this buffer to approximately 20 μl per sample prior to incubation of cells with Detection Molecules.
      
      • i. The Detection molecules were added in the required amount and samples were incubated as described in example 1-2.
  • 7. Enrichment of Detection Molecules with desired characteristics: The Detection Molecules were enriched for in the same way as described in example 1-2.
  • 8. Identification of enriched Detection Molecules: Because the Detection Molecules were enriched based on specific binding of the Binding Molecule (the pMHC) to cells, the identification of the associated Labels (DNA-barcodes) amongst the sorted cells would also reveal the pMHCs that had bound to cells in the PBMC sample. In this example the DNA-barcodes associated with the enriched Detection Molecules, were amplified by PCR and identified by high-throughput sequencing.
    
    • a. Apply. The sorted cell sample which contained DNA-barcodes derived from the enriched Detection Molecules were amplified by PCR. See table 10 for composition of the PCR and table 11 for the thermal profile. The Taq PCR Master Mix Kit (Qiagen, #201443) was applied and PCR was run on the thermal cycler: GeneAmp, PCR System 9700 (Applied Biosystem). PCR products were visualized after gel electrophoresis on a Bio-Rad Gel Doc EZ Imager. DNA was sequenced using the Ion Torrent PGM platform (Life Technologies)
      
      • i. Primers were purchased from DNA Technology (Denmark) and delivered as lyophilized powder. Stock dilutions of 100 μM were made in nuclease free water and stored at −20° C. The primers included adaptors for Ion Torrent sequencing, i.e. an A-key and a P1-key on the forward and reverse primer respectively. Additionally the forward primers had unique DNA sequences besides the primer region and the A-key (the primer sequences are listed in table 12). These primers were used to assign DNA-barcodes derived from the same sample with a sample-identification sequence (Sample-ID barcode) (see FIG. 9 for a schematic presentation of this design). This enabled distribution of DNA-barcode sequence reads according to their originating sample, when DNA-barcodes from multiple samples were sequenced in the same sequencing reaction. The non-enriched library of the 110 different Detection Molecules (diluted 100.000× after being reduced in volume) were also assigned with a sample-ID barcode through PCR (referred to as the Detection Molecule input). Information about the distribution of Labels within the library of Detection Molecules before enrichment would allow normalization of the sequence output. Pooled PCR products derived from the sample input and from multiple incubations of Detection Molecule and sample were purified with the MinElute PCR purification Kit (Qiagen, #28006) according to standard procedure.
      • ii. Purified DNA was sequenced by GeneDx (U.S.A) on an Ion Torrent PGM 314 chip.
    • b. Analysis. Positive sequence reads were aligned to sequences that read from the sample-barcode-identity at the 5′-end all the way through the DNA-barcode-identity. The number of reads was normalized according to the total number of reads that mapped to the same sample-ID barcode and according to the Detection Molecule input reads.
      
      • i. Mapping sequencing reads to 1OS DNA-barcodes: A sequence database was created consisting of the possible combinations of 15 sample-identification barcodes and 110 1OS DNA-barcodes together with the primer sequences from the 1OS system. This accumulated to 1650 sequences that could be expected from a sequencing run. Each sequencing read was then used to search the database for alignments, using the nucleotide BLAST algorithm, with a match reward of 1, mismatch reward of −2 and a gap cost of 2 for both opening and extending a gap. In this way sequencing errors were penalized equally, whether a base was miscalled or inserted/deleted in the sequencing read compared to the actual sequence. Alignments were discarded by the following criteria:
        
        • 1. E-value >1e-12; insufficient length of alignment (should be greater than 60 for the 1OS barcodes).
        • 2. Start position in subject sequence larger than 2, i.e. fewer than 5 out of 6 bases in the unique part of the sample-identification barcode was included in the alignment.
      • ii. If multiple alignments could still be found for any sequencing read, only the alignment with the best percent identity was kept. Finally, the number of reads mapping to each DNA barcode in the database was counted.
      • iii. Identifying overrepresented DNA barcodes: Relative read counts were calculated by normalizing each read to the total read count mapping to the same sample-ID barcode. The relative read counts were then used to calculate the fold change per DNA-barcode compared to the control DNA-barcode Detection Molecule input (the non-enriched Detection Molecule library). Significantly overrepresented DNA-barcodes were identified using a 2-sample test for equality of proportions on the raw read counts in a sample versus the DNA-barcode input-sample, and p-values were corrected for multiple testing using the Benjamini-Hochberg FDR method.

FACS sorting of fluorescent labeled cells, specific amplification of DNA-barcode Labels and high-throughput sequencing verified that it was possible to enrich and detect 1OS barcodes from a library of multiple different Detection molecules composed of 110 different 2OS DNA-barcode Labels encoding for 110 different antigen specificities distributed on 6 different HLA-types (FIG. 12). Moreover the number of sequence reads recovered from a given 1OS barcode was sensitive to the frequency of antigen specific T cells in the sample.

This example demonstrates that it is possible to detect antigen specific T cell responses of different frequencies in a panel of 110 different 1OS labeled Detection Molecules.

Example 4

In this example the binding molecules are class I pMHC complexes comprising 6 different HLA alleles, the linker is dextran-streptavidin-PE conjugate and the label is a DNA oligonucleotide.

The sample is HPBMC, the isolating and/or detecting is by FACS, and the determining of the identity of the label is by sequencing.

This example was essentially the same as example 3 only another Label system was applied.

This is an example where the Samples (1) were blood from one donor that were HLA-B0702:CMV pp65 TPR positive and another donor that were HLA-B0702 negative which were modified (1b) to generate Peripheral blood mononuclear cells (PBMCs). These samples were mixed in different ratios to generate new samples with different but known frequencies of T cells specific toward the HLA-B0702:CMV epitope. The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) were peptide-MHC (pMHC) complexes displaying one out of 110 different peptide-antigens comprised within 6 different HLA-types. The MHC molecules were modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding molecules were purified (2c) by HPLC and quality controlled in terms of the formation of functional pMHC multimers for staining of control T-cell populations.

The Labels (4) were oligonucleotides applied as DNA-barcodes. The oligonucleotides were synthetized (4a) by DNA Technology A/S (Denmark) and were synthetically modified (4b) with a terminal biotin capture-tag. The labels were combined oligonucleotide labels arising by annealing an A oligonucleotide (modified with biotin) to a partially complimentary B oligonucleotide label followed by enzymatic DNA polymerase extension of Oligo A and Oligo B to create a fully double stranded label. The Detection Molecule (5) was synthetized (5a) by attaching Binding Molecules in the form of biotinylated pMHC and Labels in the form of biotin-modified oligonucleotides (DNA-barcodes) onto a streptavidin-modified dextran linker. The detection molecule further contained a modification (5b) in the form of a fluorochrome. A library of 110 different Detection Molecules were generated wherein individual Binding Molecules, comprised of different pMHC, were encoded for by corresponding individual Labels, comprised of different DNA-barcodes.

An amount of sample, PBMC's (1b) was incubated with an amount of mixed Detection Molecules (5) under conditions (6c) allowing binding of Detection Molecules to T cells in the sample.

The cell-bound Detection Molecules were separated from the non-cell bound Detection Molecules (7) by first a few rounds of washing the PBMC's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind Detection Molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the PBMC sample.

FACS isolated cells were subjected to PCR for specific amplification of the DNA-barcode associated with the Detection Molecules bound to the isolated cells. High throughput sequencing of the resultant PCR product revealed the identity of Detection Molecules that bound to T cells present in the sample.

This example thus revealed the presence of T cells in the blood expressing a T cell receptor that binds to pMHC molecules represented within the library of Detection Molecules. The number of sequencing reads mapped to a given DNA-barcode and its corresponding Binding Molecule would mirror the frequency of the T cells found by conventional MHC multimer stainings using the same Binding Molecule. Moreover it revealed that Labels, i.e. Detection Molecules, associated with T cells in a sample would be sufficiently enriched to reveal the presence of low frequent T cells binding such Detection Molecules.

• • 1. Sample preparation. The cell samples used in this example were obtained by preparing PBMC's from blood drawn from one donor that were HLA-B0702:CMV pp65 TPR positive and from another donor that were HLA-B0702 negative, as determined by conventional pMHC-multimer and antibody staining. They were acquired (a.) and modified (b.) in the same way as described in example 3.
  • 2. Linker preparation: The linker used in this example was prepared as in example 1-3.
  • 3. Binding Molecules preparation: The Binding Molecules used in this example were class I MHC-peptide complexes. The individual specificities (allele and peptide combination) were generated as described in example 1-3. A library of 110 different pMHCs were generated, comprised of 6 different HLA-types, these are listed in table 9.
    
    • a. Synthesis: As described in example 1-3
    • b. Modification: No further modifications
    • c. Purification: As described in example 1-3
  • 4. Label preparation: In this example Labels were synthetic oligonucleotides modified with biotin for coupling to the Linker. 110 different Labels from the 2OS system were applied (table 2).
    
    • a. Synthesis: As described in example 1.
      
      • i. The Label system used in this example was named 2OS and was developed to increase the complexity of a limited number of oligonucleotide sequences. This was enabled by applying a combinatorial strategy where two partially complementary oligonucleotides (an A oligonucleotide with a 5′ biotin tag and a B oligonucleotide) where annealed and then elongated to produce new unique oligonucleotide-sequences (AxBy) which were applied as a DNA-barcodes (Labels) (FIG. 9). By combining 6 unique oligonucleotide-sequences (A label precursor) that were all partly complementary to 20 other unique oligonucleotide sequences (B label precursor) a combinatorial library of 120 different (AxBy) Labels were produced. Only 110 of these Labels were used in this example (table 9).
    • b. Modification: As described in example 1-3.
    • c. Purification: As described in example 1-3.
  • 5. Detection Molecules preparation: 110 different Detection Molecules were generated, each with a different Binding Molecule encoded by a unique Label. The Binding Molecules (pMHCs) and Labels (2OS DNA-barcodes) were attached to the Linker (dextran-streptavidin-PE conjugate), to form Detection Molecules, in such a way that a given pMHC was always attached to a given DNA-barcode.
    
    • a. Detection Molecules were essentially generated in the same way as described in example 3. The given combination of Label (2OS DNA-barcode) and Binding Molecule (pMHC) of each Detection Molecule are presented in table 9.
    • b. Modification: Since the total volume of 110 pooled Detection Molecules exceeded 100 μl this volume was reduced to reach a desired concentration of specific Binding Molecules. This was done as described in example 2-3.
    • c. Purification: As described in example 1-3.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules were mixed in one container to allow Detection Molecules to bind to T cells.
    
    • a. Amount of sample: Samples were equivalent to those used in example 3.
    • b. Amount of Detection Molecule: As described in example 1-3
    • c. Conditions: Samples and Detection Molecules were treated under the same conditions as described in example 3.
  • 7. Enrichment of MHC molecules with desired characteristics: The Detection Molecules were enriched for in the same way as described in example 1-3.
  • 8. Identification of enriched Detection Molecules: Because the Detection Molecules were enriched based on specific interaction of the Binding Molecule (the pMHC) with cells, the identification of the associated Labels (DNA-barcodes) amongst the sorted cells would also reveal the pMHCs that had bound to cells in the PBMC sample. In this example the DNA-barcodes associated with the enriched Detection Molecules, were amplified by PCR and identified by high-throughput sequencing.
    
    • a. Apply. The sorted cell sample which contained DNA-barcodes derived from the enriched Detection Molecules were amplified by PCR. See table 10 for composition of the PCR and table 11 for the thermal profile. The Taq PCR Master Mix Kit (Qiagen, #201443) was applied and PCR was run on the thermal cycler: GeneAmp, PCR System 9700 (Applied Biosystem). PCR products were visualized after gel electrophoresis on a Bio-Rad Gel Doc EZ Imager. DNA was sequenced using the Ion Torrent PGM platform (Life Technologies)
      
      • i. Primers were purchased from DNA Technology (Denmark) and delivered as lyophilized powder. Stock dilutions of 100 μM were made in nuclease free water and stored at −20° C. The primers included adaptors for Ion Torrent sequencing, i.e. an A-key and a P1-key on the forward and reverse primer respectively. Additionally the forward primers had unique DNA sequences besides the primer region and the A-key. These primers were used to assign DNA-barcodes derived from the same sample with a sample-identification sequence (Sample-ID barcode) (the primer sequences are listed in table 13). This enabled distribution of DNA-barcode sequence reads according to their originating sample, when DNA-barcodes from multiple samples were sequenced in the same sequencing reaction. The non-enriched library of the 110 different Detection Molecules (diluted 100.000× after being reduced in volume) were also assigned with a sample-ID barcode through PCR (referred to as the Detection Molecule input)(see FIG. 9 for a schematic overview of the primer design). Information about the distribution of Labels within the library of Detection Molecules before enrichment would allow normalization of the sequence output. Pooled PCR products derived from the sample input and from multiple incubations of Detection Molecule and sample were purified with the MinElute PCR purification Kit (Qiagen, #28006) according to standard procedure.
      • ii. The purified DNA was sequenced by GeneDx (U.S.A) on an Ion Torrent PGM 314 chip.
    • b. Analysis. Positive sequence reads were aligned to sequences that read from the sample-barcode-identity at the 5′-end all the way through the DNA-barcode-identity. The number of reads was normalized according to the total number of reads that mapped to the same sample-ID barcode and according to the Detection Molecule input reads. The Analysis was essentially as in example 3 except that another database of 2OS sequences was generated and sequences were mapped according to corresponding 2OS DNA-barcodes.
      
      • i. Mapping sequencing reads to 2OS DNA-barcodes: A sequence database was created consisting of the possible combinations of 15 sample-identification barcodes and 120 2OS DNA barcodes (together with the primer and annealing sequences from the 2OS system). This accumulated to 1800 sequences that could be expected from a sequencing run. Each sequencing read was then used to search the database for alignments, using the nucleotide BLAST algorithm, with a match reward of 1, mismatch reward of −2 and a gap cost of 2 for both opening and extending a gap. In this way sequencing errors were penalized equally, whether a base was miscalled or inserted/deleted in the sequencing read compared to the actual sequence. Alignments were discarded by the following criteria:
        
        • 1. E-value >1e-12; insufficient length of alignment (should be greater than 102 for the 2OS barcodes).
        • 2. Start position in subject sequence larger than 2, i.e. fewer than 5 out of 6 bases in the unique part of the sample-identification barcode was included in the alignment.
      • ii. If multiple alignments could still be found for any sequencing read, only the alignment with the best percent identity was kept. Finally, the number of reads mapping to each DNA barcode in the database was counted.
      • iii. Identifying overrepresented DNA barcodes: Relative read counts were calculated by normalizing each read to the total read count mapping to the same sample-ID barcode. The relative read counts were then used to calculate the fold change per DNA-barcode compared to the control DNA-barcode Detection Molecule input (the non-enriched Detection Molecule library). Significantly overrepresented DNA-barcodes were identified using a 2-sample test for equality of proportions on the raw read counts in a sample versus the DNA-barcode input-sample, and p-values were corrected for multiple testing using the Benjamini-Hochberg FDR method.

FACS sorting of fluorescent labeled cells, specific amplification of DNA-barcode Labels and high-throughput sequencing verified that it was possible to enrich and detect 2OS barcodes from a library of multiple different Detection molecules composed of 110 different 2OS DNA-barcode Labels encoding for 110 different antigen specificities distributed on 6 different HLA-types (FIG. 13). Moreover the number of sequence reads recovered from a given 2OS barcode was sensitive to the frequency of antigen specific T cells in the sample, also indicating that it will be possible to detect Labels associated with responses of very low frequency (<0.002).

This example demonstrates that it is possible to detect antigen specific T cell responses of different and of low frequencies in a panel of 110 different 2OS labeled Detection Molecules.

Example 5

In this example the binding molecules are class I pMHCs, the linker is streptavidin conjugate and the label is DNA.

The isolating and/or detecting is by FACS, and the determining of the identity of the label is by sequencing.

This is an example where the Samples (1) were blood from six different donors with different HLA-types which were modified (1b) to generate Peripheral blood mononuclear cells (PBMCs).

The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) were peptide-MHC (pMHC) complexes displaying one out of 110 different peptide-antigens comprised within 6 different HLA-types. The MHC molecules were modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding molecules were purified (2c) by HPLC and quality controlled in terms of the formation of functional pMHC multimers for staining of control T-cell populations.

The Labels (4) were single stranded oligonucleotide applied as DNA-barcodes. The oligonucleotides were synthetized (4a) by DNA Technology A/S (Denmark) and were synthetically modified (4b) with a terminal biotin capture-tag.

The Detection Molecule (5) was synthetized (5a) by attaching Binding Molecules in the form of biotinylated pMHC and Labels in the form of biotin-modified oligonucleotides (DNA-barcodes) onto a streptavidin-modified dextran linker. The detection molecule further contained a modification (5b) in the form of a fluorochrome. A library of 110 different Detection Molecules were generated wherein individual Binding Molecules, comprised of different pMHC, were encoded for by corresponding individual Labels, comprised of different DNA-barcodes.

An amount of sample, PBMC's (1b) was incubated with an amount of mixed Detection Molecules (5) under conditions (6c) allowing binding of Detection Molecules to T cells in the sample.

The cell-bound Detection Molecules were separated from the non-cell bound Detection Molecules (7) by first a few rounds of washing the PBMC's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind Detection Molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the PBMC sample.

FACS isolated cells were subjected to PCR for specific amplification of the DNA-barcode associated with the Detection Molecules bound to the isolated cells. High throughput sequencing of the resultant PCR product revealed the identity of Detection Molecules that bound to T cells present in the sample.

This example thus revealed the presence of T cells in the blood expressing a T cell receptor that binds to pMHC molecules represented within the library of Detection Molecules. The application of multiple (110) Detection Molecules in one sample enabled detection of T cells with different T cell receptor specificities in parallel.

• • 1. Sample preparation. The cell samples used in this example were obtained by preparing PBMC's from blood drawn from six different donors with a number of different peptide-antigen responsive T cells, as determined by conventional pMHC-multimer staining.
    
    • a. Acquiring sample: Blood was obtained from the Danish Blood Bank, as example 1-4
    • b. Modifying sample: PBMCs were isolated from whole blood as described in example 1-4.
  • 2. Linker preparation: The linker used in this example was prepared as in example 1-4.
  • 3. Binding Molecules preparation: The Binding Molecules used in this example were class I MHC-peptide complexes. The individual specificities (allele and peptide combination) were generated as described in example 1. A library of 110 different pMHCs, comprised of 6 different HLA-types, were generated, these are listed in table 9.
    
    • a. Synthesis: As described in example 1-4
    • b. Modification: No further modifications
    • c. Purification: As described in example 1-4
  • 4. Label preparation: In this example Labels were synthetic oligonucleotides modified with biotin for coupling to the Linker. 110 different Labels from the 1OS system were applied (table 8).
    
    • a. Synthesis: As described in example 2-3.
      
      • i. The Label system used in this example were named 1OS and comprised of single stranded oligonucleotides which were applied as a DNA barcodes.
    • b. Modification: As described in example 1-4.
    • c. Purification: As described in example 1-4.
  • 5. Detection Molecules preparation: 110 different Detection Molecules were generated, each with a different Binding Molecule encoded by a unique Label. The Binding Molecules (pMHCs) and Labels (1OS DNA-barcodes) were attached to the Linker (dextran-streptavidin-PE conjugate) to form Detection Molecules, in such a way that a given pMHC was always attached to a given DNA-barcode.
    
    • a. Detection Molecules were generated in the same way as described in example 3. The given combination of Label (DNA-barcode) and Binding Molecule (pMHC) of each Detection Molecule are presented in table 9.
    • b. Modification: Since the total volume of 110 pooled Detection Molecules exceeded 100 μl this volume was reduced to reach a desired concentration of specific Binding Molecules. This was done as described in example 2-4.
    • c. Purification: As described in example 1-4.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules were incubated in the same way as described in example 1-2.
  • 7. Enrichment of MHC molecules with desired characteristics: The Detection Molecules were enriched for in the same way as described in example 1-6.
  • 8. Identification of enriched Detection Molecules: Because the Detection Molecules were enriched based on specific interaction of the Binding Molecule (the pMHC) with cells, the identification of the associated Labels (DNA-barcodes) amongst the sorted cells would also reveal the pMHCs that had bound to cells in the PBMC sample. In this example the DNA-barcodes associated with the enriched Detection Molecules, were amplified by PCR and identified by high-throughput sequencing. The enriched Labels, of the 1OS DNA-barcode system, were identified as in example 3.

FACS sorting of fluorescent labeled cells, specific amplification of DNA-barcode Labels and high-throughput sequencing verified that it was possible to enrich and detect 1OS barcodes from a library of multiple different Detection molecules composed of 110 different 1OS DNA-barcode Labels encoding for 110 different antigen specificities distributed on 6 different HLA-types (FIG. 14). It was verified that several DNA-barcodes, encoding different antigen specificities on different HLA-types, could be enriched for and detected in parallel, indicative for the presence of multiple antigen-specific T cell responses in that sample.

This example demonstrates that it is possible to detect several antigen-specific T cell responses in parallel when applying a library of Detection molecules of increasing complexity.

Example 6

In this example 110 different binding molecules are used, the linker is dextran for all of the detection molecules and 110 different labels are used.

This example was essentially the same as example 5 only another Label system was applied.

This is an example where the Samples (1) were blood from six different donors with different HLA-types which were modified (1b) to generate Peripheral blood mononuclear cells (PBMCs).

The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) were peptide-MHC (pMHC) complexes displaying one out of 110 different peptide-antigens comprised within 6 different HLA-types. The MHC molecules were modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding molecules were purified (2c) by HPLC and quality controlled in terms of the formation of functional pMHC multimers for staining of control T cell populations.

The Labels (4) were oligonucleotides applied as DNA-barcodes. The oligonucleotides were synthetized (4a) by DNA Technology A/S (Denmark) and were synthetically modified (4b) with a terminal biotin capture-tag. The labels were combined oligonucleotide labels arising by annealing an A oligonucleotide (modified with biotin) to a partially complimentary B oligonucleotide label followed by enzymatic DNA polymerase extension of Oligo A and Oligo B to create a fully double stranded label. The Detection Molecule (5) was synthetized (5a) by attaching Binding Molecules in the form of biotinylated pMHC and Labels in the form of biotin-modified oligonucleotides (DNA-barcodes) onto a streptavidin-modified dextran linker. The detection molecule further contained a modification (5b) in the form of a fluorochrome. A library of 110 different Detection Molecules were generated wherein individual Binding Molecules, comprised of different pMHC, were encoded for by corresponding individual Labels, comprised of different DNA-barcodes.

An amount of sample, PBMC's (1b) was incubated with an amount of mixed Detection Molecules (5) under conditions (6c) allowing binding of Detection Molecules to T cells in the sample.

The cell-bound Detection Molecules were separated from the non-cell bound Detection Molecules (7) by first a few rounds of washing the PBMC's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind Detection Molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the PBMC sample.

FACS isolated cells were subjected to PCR for specific amplification of the DNA-barcode associated with the Detection Molecules bound to the isolated cells. High throughput sequencing of the resultant PCR product revealed the identity of Detection Molecules that bound to T cells present in the sample.

This example thus revealed the presence of T cells in the blood expressing a T cell receptor that binds to pMHC molecules represented within the library of Detection Molecules. The application of multiple (110) Detection Molecules in one sample enabled detection of T cells with different T cell receptor specificities in parallel.

• • 1. Sample preparation. The cell samples used in this example were obtained by preparing PBMC's from blood drawn from six different donors with a number of different peptide-antigen responsive T cells, as determined by conventional pMHC-multimer.
    
    • a. Acquiring sample: Blood was obtained from the Danish Blood Bank.
    • b. Modifying sample: PBMCs were isolated from whole blood as described in example 1-2, 5.
  • 2. Linker preparation: The linker used in this example was prepared as in example 1-5.
  • 3. Binding Molecules preparation: The Binding Molecules used in this example were class I MHC-peptide complexes. The individual specificities (allele and peptide combination) were generated as described in example 1-5. A library of 110 different pMHCs, comprised of 6 different HLA-types, were generated, these are listed in table 9.
    
    • a. Synthesis: As described in example 1-5.
    • b. Modification: No further modifications
    • c. Purification: As described in example 1-5
  • 4. Label preparation: In this example Labels were synthetic oligonucleotides modified with biotin for coupling to the Linker. 110 different Labels from the 2OS system were applied (table 2).
    
    • a. Synthesis: As described in example 1, 4.
      
      • i. The Label system used in this example was named 2OS and was developed to increase the complexity of a limited number of oligonucleotide sequences. This was enabled by applying a combinatorial strategy where two partially complementary oligonucleotides (an A oligonucleotide with a 5′ biotin tag and a B oligonucleotide) where annealed and then elongated to produce new unique oligonucleotide-sequences (AxBy) which were applied as a molecular barcodes (Labels) (FIG. 9). By combining 6 unique oligonucleotide-sequences (A label precursor) that were all partly complementary to 20 other unique oligonucleotide sequences (B label precursor) a combinatorial library of 120 different (AxBy) Labels were produced. Only 110 of these Labels were used in this example (table 9).
    • b. Modification: As described in example 1-5.
    • c. Purification: As described in example 1-5.
  • 5. Detection Molecules preparation: 110 different Detection Molecules were generated, each with a different Binding Molecule encoded by a unique Label. The Binding Molecules (pMHCs) and Labels (2OS DNA-barcodes) were attached to the Linker (dextran-streptavidin-PE conjugate) to form Detection Molecules, in such a way that a given pMHC was always attached to a given DNA-barcode.
    
    • a. Detection Molecules were generated in the same way as described in example 3, 4, 5. The given combination of Label (2OS DNA-barcode) and Binding Molecule (pMHC) of each Detection Molecule are presented in table 9.
    • b. Modification: Since the total volume of 110 pooled Detection Molecules exceeded 100 μl this volume was reduced to reach a desired concentration of specific Binding Molecules (done as described in example 2-5).
    • c. Purification: As described in example 1-5.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules were incubated in the same way as described in example 1-2, 5.
  • 7. Enrichment of MHC molecules with desired characteristics: The Detection Molecules were enriched for in the same way as described in example 1-5.
  • 8. Identification of enriched Detection Molecules: Because the Detection Molecules were enriched based on specific binding of the Binding Molecule (the pMHC) to cells, the identification of the associated Labels (DNA-barcodes) amongst the sorted cells would also reveal the pMHCs that had bound to cells in the PBMC sample. In this example the DNA-barcodes associated with the enriched Detection Molecules, were amplified by PCR and identified by high-throughput sequencing. The enriched Labels, of the 2OS DNA-barcode system, were identified as in example 4.

FACS sorting of fluorescent labeled cells, specific amplification of DNA-barcode Labels and high-throughput sequencing verified that it was possible to enrich and detect 2OS barcodes from a library of multiple different Detection molecules composed of 110 different 2OS DNA-barcode Labels encoding for 110 different antigen specificities distributed on 6 different HLA-types (FIG. 15). It was verified that several DNA-barcodes, encoding different antigen specificities of different HLA-types, could be enriched for and detected in parallel, indicative for the presence of multiple antigen-specific T cell responses in that sample.

This example demonstrates that it is possible to detect several antigen-specific T cell responses in parallel when applying a library of Detection molecules of increasing complexity.

Example 7

In this example 175 different pMHC complexes are used as binding molecules. The sample is tumor infiltrating Lymphocytes from a resected tumor lesion of a human being.

This is an example where the Samples (1) were resected tumor lesions from 11 HLA-A0201 positive patients with malignant melanoma. The samples were modified (1b) to generate Tumor Infiltrating Lymphocytes (TILs).

The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) were peptide-MHC (pMHC) complexes displaying one out of 175 different peptide-antigens. The MHC molecules were modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding molecules were purified (2c) by HPLC and quality controlled in terms of the formation of functional pMHC multimers for staining of control T-cell populations.

The Labels (4) were oligonucleotides applied as DNA-barcodes. The oligonucleotides were synthetized (4a) by DNA Technology A/S (Denmark) and were synthetically modified (4b) with a terminal biotin capture-tag. The labels were combined oligonucleotide labels arising by annealing an A oligonucleotide (modified with biotin) to a partially complimentary B oligonucleotide label followed by enzymatic DNA polymerase extension of Oligo A and Oligo B to create a fully double stranded label. The Detection Molecule (5) was synthetized (5a) by attaching Binding Molecules in the form of biotinylated pMHC and Labels in the form of biotin-modified oligonucleotides (DNA-barcodes) onto a streptavidin-modified dextran linker. The detection molecule further contained a modification (5b) in the form of a fluorochrome. A library of 175 different Detection Molecules were generated wherein individual Binding Molecules, comprised of different pMHC, were encoded for by corresponding individual Labels, comprised of different DNA-barcodes.

An amount of sample, TILs (1b), was incubated with an amount of mixed Detection Molecules (5) under conditions (6c) allowing binding of Detection Molecules to T cells in the sample.

The cell-bound Detection Molecules were separated from the non-cell bound Detection Molecules (7) by first a few rounds of washing the TIL's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind Detection Molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the TIL sample.

FACS isolated cells were subjected to PCR for specific amplification of the DNA-barcode Label associated with the Detection Molecules bound to the isolated cells. High throughput sequencing of the resultant PCR product revealed the identity of Detection Molecules that bound to T cells present in the sample.

This example thus revealed the presence of T cells among the TIL's expressing a T cell receptor that binds to pMHC molecules represented within the library of Detection Molecules. The number of sequencing reads mapped to a given DNA-barcode and its corresponding Binding Molecule would mirror the frequency of the T cells found by conventional MHC multimer stainings using the same Binding Molecules. The application of multiple (175) Detection Molecules in one sample enabled detection of T cells with different T cell receptor specificities in parallel. This is feasible also when the sample, as in present example is TILs that on average basis has a lower avidity of their TCR to their pMHC antigen. Consequently they are more challenging to detect than virus-responsive T cells using traditional fluorescence labelled MHC mulitimers.

• • 1. Sample preparation. The 11 cell samples used in this example were obtained from resected tumor lesions obtained from patients with malignant melanoma.
    
    • a. Acquiring sample. TILs were derived from tumor fragments from melanoma patients. Tumor lesion were resected following surgical removal of the given tumor lesion.
    • b. Modifying sample. Tumor fragments (1-3 mm3) were cultured individually in complete medium (RPMI with 10% human serum, 100 U/ml penicillin, 100 μg/ml streptomycin, 1.25 μg/ml fungizone [Bristol-Myers Squibb] and 6000 U/ml IL-2) at 37° C. and 5% CO2, allowing TILs to migrate to the medium. TILs were expanded to reach >50×106 total cells originated from approximately 24 fragments, which had expanded to confluent growth in 2-ml wells and eliminated adherent tumor cells (average of approximately 2×106 cells per well from each tumor fragment). TIL cultures were expanded on a clinical scale using a standard rapid expansion protocol (REP). Briefly, TILs were stimulated with 30 ng/ml anti-CD3 antibody (OKT-3; Ortho Biotech) and 6000 U/ml IL-2 in the presence of irradiated (40 Gy) allogenic feeder cells (PBMCs from a healthy donor) at a feeder:TIL ratio of 200:1. Initially, TILs were rapidly expanded in a 1:1 mix of complete medium and REP medium (AIM-V [Invitrogen] with 10% human serum, 1.25 μg/ml fungizone and 6000 U/ml IL-2), but after seven days complete medium and serum were removed stepwise from the culture by adding REP medium without serum to maintain cell densities around 1-2×106 cells/ml. TIL cultures were cryopreserved at −150° C. in human serum containing 10% DMSO. All patients were HLA-A0201 positive.
  • 2. Linker preparation: The linker used in this example was prepared as in example 1-6.
  • 3. Binding Molecules preparation: The Binding Molecules used in this example were class I MHC-peptide complexes (peptide-HLA-A0201). The individual specificities (allele and peptide combination) were generated as described in example 1-6. A library of 175 different pMHCs were generated, these are listed in table 2.
    
    • a. Synthesis: As described in example 1-6
    • b. Modification: No further modifications
    • c. Purification: As described in example 1-6
  • 4. Label preparation: In this example Labels were synthetic oligonucleotides modified with biotin for coupling to the Linker. 175 different Labels from the 2OS system were applied (table 14).
    
    • a. Synthesis: As described in example 1.
      
      • i. The Label system used in this example was named 2OS and was developed to increase the complexity of a limited number of oligonucleotide sequences. This was enabled by applying a combinatorial strategy where two partially complementary oligonucleotides (an A oligonucleotide with a 5′ biotin tag and a B oligonucleotide) where annealed and then elongated to produce new unique oligonucleotide-sequences (AxBy) which were applied as a DNA-barcodes (Labels) (FIG. 9). By combining 22 unique oligonucleotide-sequences (A label precursor) that are all partly complementary to 55 other unique oligonucleotide sequences (B label precursor) a combinatorial library of 1,210 different (AxBy) Labels were produced. Only 175 of these Labels were used in this example (table 14). Refer to table 2 for an overview of the different 2OS A and B nucleotide sequences.
    • b. Modification: As described in example 1-6.
    • c. Purification: As described in example 1-6.
  • 5. Detection Molecules preparation: 175 different Detection Molecules were generated, each with a different Binding Molecule encoded by a unique Label. The Binding Molecules (pMHCs) and Labels (2OS DNA-barcodes) were attached to the Linker (dextran-streptavidin-PE conjugate), to form Detection Molecules, in such a way that a given pMHC was always attached to a given DNA-barcode.
    
    • a. Detection Molecules were essentially generated in the same way as described in example 1-6. The given combination of Label (2OS DNA-barcode) and Binding Molecule (pMHC) of each Detection Molecule are presented in table 14.
    • b. Modification: Since the total volume of 175 pooled Detection Molecules exceeded 100 μl this volume was reduced to reach a desired concentration of specific Binding Molecules. This was done as described in example 2-6.
    • c. Purification: As described in example 1-6.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules were mixed in one container to allow Detection Molecules to bind to T cells.
    
    • a. Amount of sample: Between 0.2×10E6-2.3×10E6 cells in the form of TILs, were used.
    • b. Amount of Detection Molecule: As described in example 1-6
    • c. Conditions: Samples and Detection Molecules were treated as described in example 1-2 and 5-6.
  • 7. Enrichment of MHC molecules with desired characteristics: The Detection Molecules were enriched for in the same way as described in example 1-6.
  • 8. Identification of enriched Detection Molecules: Because the Detection Molecules were enriched based on specific interaction of the Binding Molecule (the pMHC) with cells, the identification of the associated Labels (DNA-barcodes) amongst the sorted cells would also reveal the pMHCs that had bound to cells in the TIL sample. In this example the DNA-barcodes associated with the enriched Detection Molecules, were amplified by PCR and identified by high-throughput sequencing.
    
    • a. Apply. The sorted cell samples which contained DNA-barcodes derived from the enriched Detection Molecules were amplified by PCR. See table 10 for composition of the PCR and table 11 for the thermal profile. The Taq PCR Master Mix Kit (Qiagen, #201443) was applied and PCR was run on the thermal cycler: GeneAmp, PCR System 9700 (Applied Biosystem). PCR products were visualized after gel electrophoresis on a Bio-Rad Gel Doc EZ Imager. DNA was sequenced using the Ion Torrent PGM platform (Life Technologies)
      
      • i. Primers were purchased from DNA Technology (Denmark) and delivered as lyophilized powder. Stock dilutions of 100 μM were made in nuclease free water and stored at −20° C. The primers included adaptors for Ion Torrent sequencing, i.e. an A-key and a P1-key on the forward and reverse primer respectively. Additionally the forward primers had unique DNA sequences besides the primer region and the A-key. These primers were used to assign DNA-barcodes derived from the same sample with a sample-identification sequence (Sample-ID barcode) (refer to table 13 for primer sequences). This enabled distribution of DNA-barcode sequence reads according to their originating sample, when DNA-barcodes from multiple samples were sequenced in the same sequencing reaction (see FIG. 9 for a schematic presentation of the primer design). If >10.000 cells were sorted in the enrichment step, only a volume corresponding to 10.000 cells were applied as template in the PCR. To further examine the potential impact on the number of cells selected with associated Detection molecules, we included Enriched Detection Molecules derived from one sample (sample 8) multiple times, so that triplicate PCRs were run with equivalent to 10.000 sorted cells and 100 sorted cells respectively. Moreover a single PCR was run with 1000 cells from the same sample. The non-enriched library of the 175 different Detection Molecules (diluted 10.000x after being reduced in volume) were also assigned with a sample-ID barcode through PCR (referred to as the Detection Molecule-input). Triplicate PCRs were run with the Detection Molecule-input. Information about the distribution of Labels within the library of Detection Molecules before enrichment would allow normalization of the sequence output. Pooled PCR products derived from the Detection Molecule-input and from multiple incubations of Detection Molecule and sample were separated according to size, by gel-electrophoresis, and the excised gel-fragment containing DNA-fragments of ˜200 bp were purified with the QIAquick PCR Purification Kit (Qiagen, #28104) according to standard procedure.
      • ii. The purified DNA was sequenced by Amplexa (Denmark) on an Ion Torrent PGM 314 chip.
    • b. Analysis. Positive sequence reads were aligned to sequences that read from the sample-barcode-identity at the 5′-end all the way through the DNA-barcode-identity. The number of reads was normalized according to the total number of reads that mapped to the same sample-ID barcode and according to the Detection Molecule input reads. The Analysis was essentially as in example 4 and 6 except that the database of 2OS sequences was expanded to include the new 175 Labels and sequences were mapped according to corresponding 2OS DNA-barcodes.
      
      • i. Mapping sequencing reads to 2OS DNA-barcodes: A sequence database was created consisting of the possible combinations of 20 sample-identification barcodes and 192 2OS DNA barcodes (together with the primer and annealing sequences from the 2OS system). This accumulated to 3840 sequences that could be expected from a sequencing run. Each sequencing read was then used to search the database for alignments, using the nucleotide BLAST algorithm, with a match reward of 1, mismatch reward of −2 and a gap cost of 2 for both opening and extending a gap. In this way sequencing errors were penalized equally, whether a base was miscalled or inserted/deleted in the sequencing read compared to the actual sequence. Alignments were discarded by the following criteria:
        
        • 1. E-value >1e-12; insufficient length of alignment (should be greater than 102 for the 2OS barcodes).
        • 2. Start position in subject sequence larger than 2, i.e. fewer than 5 out of 6 bases in the unique part of the sample-identification barcode was included in the alignment.
      • ii. If multiple alignments could still be found for any sequencing read, only the alignment with the best percent identity was kept. Finally, the number of reads mapping to each DNA barcode in the database was counted.
      • iii. Identifying overrepresented DNA barcodes: Two amendments of the analysis performed in example 4 and 6 (as well as 3 and 5 in respect to the 1OS label system) were introduced:
        
        • a. The N6 sequence (FIG. 9) were applied to reduce the clonality of the amplification product to avoid potential biases derived from amplification of enriched 2OS sequence Labels.
        •  i. Any repetitive reads that would share a N6 and map to a given sample-ID all through the 2OS barcode region were virtually removed ensuring that this sequence was only accounted for once.
        • b. The sequencing data was reanalyzed after virtual removal of the most high-frequent sequences. This ensured that potential biases derived from high-percentage enrichment of a given Detection Molecule, resulting in large read counts from the associated 2OS sequence Label, would not mask the presence of lower percentages yet enriched Detection Molecules.
      • Collectively this strategy is termed clonality reduction. Relative read counts were calculated by normalizing each read to the total read count mapping to the same sample-ID barcode. The relative read counts were then used to calculate the fold change per DNA-barcode compared to the control DNA-barcode Detection Molecule input (the non-enriched Detection Molecule library). Significantly overrepresented DNA-barcodes were identified using a 2-sample test for equality of proportions on the raw read counts in a sample versus the DNA-barcode input-sample, and p-values were corrected for multiple testing using the Benjamini-Hochberg FDR method. The algorithm applied for this analysis is available at: www.cbs.dtu.dk/services/Barracoda/

FACS sorting of fluorescent labeled cells, specific amplification of DNA-barcode Labels and high-throughput sequencing verified that it was possible to enrich and detect 2OS barcodes from a library of multiple different Detection molecules composed of 175 different 2OS DNA-barcode Labels encoding for 175 different cancer-specificities (FIG. 16). It implied that several DNA-barcodes, encoding different antigen specificities, could be enriched for and detected in parallel, also when the samples, as in the present example, were TILs that on average has a lower avidity of their TCR to their pMHC antigen. The results indicated that the presence of multiple cancer-specific T cell responses could be detected in parallel in a sample.

This example implies that it is possible to detect several cancer-specific T cell responses in parallel when applying a library of Detection molecules of increasing complexity.

Example 8

In this example 1025 different binding molecules are used in the form of pMHC complexes (each with DNA labels).

The sample is a mixture of two different blood samples, the isolating and/or detecting is done by flow cytometry and the determining of the identity of the label is done by sequencing the DNA label.

This example is essentially the same as example 4 but will apply a larger Detection Molecule library (1025) and will include a greater number of different HLA-types (11) to analyze the same samples.

This is an example where the Samples (1) are blood from one donor that is HLA-B0702:CMV pp65 TPR positive and another donor that is HLA-B0702 negative which are modified (1b) to generate Peripheral blood mononuclear cells (PBMCs). These samples are mixed in different ratios to generate new samples with different but known frequencies of T cells specific toward the HLA-B0702:CMV epitope.

The Linker (2) is a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) are peptide-MHC (pMHC) complexes displaying one out of 1025 different peptide-antigens. The MHC molecules are modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding molecules are purified (2c) by HPLC and quality controlled in terms of the formation of functional pMHC multimers for staining of control T-cell populations.

The Labels (4) are oligonucleotides applied as DNA-barcodes. The oligonucleotides are synthetized (4a) by DNA Technology A/S (Denmark) and are synthetically modified (4b) with a terminal biotin capture-tag. The labels are combined oligonucleotide labels arising by annealing an A oligonucleotide (modified with biotin) to a partially complimentary B oligonucleotide label followed by enzymatic DNA polymerase extension of Oligo A and Oligo B to create a fully double stranded label.

The Detection Molecule (5) is synthetized (5a) by attaching Binding Molecules in the form of biotinylated pMHC and Labels in the form of biotin-modified oligonucleotides (DNA-barcodes) onto a streptavidin-modified dextran linker. The detection molecule further contains a modification (5b) in the form of a fluorochrome. A library of 1025 different Detection Molecules are generated wherein individual Binding Molecules, comprised of different pMHC, are encoded for by corresponding individual Labels, comprised of different DNA-barcodes.

An amount of sample, PBMC's (1b) is incubated with an amount of mixed Detection Molecules (5) under conditions (6c) allowing binding of Detection Molecules to T cells in the sample.

The cell-bound Detection Molecules are separated from the non-cell bound Detection Molecules (7) by first a few rounds of washing the PBMC's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind Detection Molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the PBMC sample.

FACS isolated cells are subjected to PCR for specific amplification of the DNA-barcode associated with the Detection Molecules bound to the isolated cells. High throughput sequencing of the resultant PCR product will reveal the identity of Detection Molecules that binds to T cells present in the sample.

This example will reveal the presence of T cells in the blood expressing a T cell receptor that binds to pMHC molecules represented within the library of 1025 Detection Molecules. The number of sequencing reads that will map to a given DNA-barcode and its corresponding Binding Molecule will mirror the frequency of the T cells found by conventional MHC multimer stainings using the same Binding Molecules. The increased complexity of the Detection Molecule library, in terms of the number of different Binding Molecules and Labels, will reflect positively upon the sensitivity for detecting a given Label, i.e. a Detection Molecule, associated with low frequencies of T cells binding such Detection Molecules.

• • 1. Sample preparation. The cell samples used in this example are obtained by preparing PBMC's from blood drawn from one donor that is HLA-B0702:CMV pp65 TPR positive and from another donor that is HLA-B0702 negative, as determined by conventional pMHC-multimer and antibody staining. They are acquired (a.) and modified (b.) in the same way as described in example 3-4.
  • 2. Linker preparation: The linker used in this example is prepared as in example 1-7.
  • 3. Binding Molecules preparation: The Binding Molecules used in this example are class I MHC-peptide complexes. The individual specificities (allele and peptide combination) are generated as described in example 1-7. A library of 1025 different pMHCs are generated including 11 different HLA-types.
    
    • a. Synthesis: As described in example 1-7
    • b. Modification: No further modifications
    • c. Purification: As described in example 1-7
  • 4. Label preparation: In this example Labels are synthetic oligonucleotides modified with biotin for coupling to the Linker. 1025 different Labels from the 2OS system were applied (table 2).
    
    • a. Synthesis: As described in example 1.
      
      • i. The Label system used in this example is named 2OS and was developed to increase the complexity of a limited number of oligonucleotide sequences. This is enabled by applying a combinatorial strategy where two partially complementary oligonucleotides (an A oligonucleotide with a 5′ biotin tag and a B oligonucleotide) are annealed and then elongated to produce new unique oligonucleotide-sequences (AxBy) which are applied as a DNA-barcodes (Labels) (FIG. 2). By combining 22 unique oligonucleotide-sequences (A label precursor) that are all partly complementary to 55 other unique oligonucleotide sequences (B label precursor) a combinatorial library of 1210 different (AxBy) Labels are produced. Only 1025 of these Labels are used in this example.
    • b. Modification: As described in example 1-7.
    • c. Purification: As described in example 1-7.
  • 5. Detection Molecules preparation: 1025 different Detection Molecules are generated, each with a different Binding Molecule encoded by a unique Label. The Binding Molecules (pMHCs) and Labels (2OS DNA-barcodes) are attached to the Linker (dextran-streptavidin-PE conjugate), to form Detection Molecules, in such a way that a given pMHC is always attached to a given DNA-barcode.
    
    • a. Detection Molecules are essentially generated in the same way as described in example 1-7. The given combination of Label (2OS DNA-barcode) and Binding Molecule (pMHC) of each Detection Molecule are registered.
    • b. Modification: Since the total volume of 1025 pooled Detection Molecules exceeds 100 μl this volume is reduced to reach a desired concentration of specific Binding Molecules. This is done as described in example 2-7.
    • c. Purification: As described in example 1-7.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules are mixed in one container to allow Detection Molecules to bind to T cells.
    
    • a. Amount of sample: Samples are equivalent to those used in example 3-4.
    • b. Amount of Detection Molecule: As described in example 1-7
    • c. Conditions: Samples and Detection Molecules are treated under the same conditions as described in example 3-4.
  • 7. Enrichment of MHC molecules with desired characteristics: The Detection Molecules are enriched for in the same way as described in example 1-7.
  • 8. Identification of enriched Detection Molecules: Because the Detection Molecules are enriched based on specific interaction of the Binding Molecule (the pMHC) with cells, the identification of the associated Labels (DNA-barcodes) amongst the sorted cells will also reveal the pMHCs that bind to cells in the PBMC sample. In this example the DNA-barcodes associated with the enriched Detection Molecules, are amplified by PCR and identified by high-throughput sequencing.
    
    • a. Apply. The sorted cell samples which contain DNA-barcodes derived from the enriched Detection Molecules are amplified by PCR. See table 10 for composition of the PCR and table 11 for the thermal profile. The Taq PCR Master Mix Kit (Qiagen, #201443) is applied and PCR is run on the thermal cycler: GeneAmp, PCR System 9700 (Applied Biosystem). PCR products are visualized after gel electrophoresis on a Bio-Rad Gel Doc EZ Imager. DNA is sequenced using the Ion Torrent PGM platform (Life Technologies)
      
      • i. Primers are purchased from DNA Technology (Denmark) and delivered as lyophilized powder. Stock dilutions of 100 μM are made in nuclease free water and stored at −20° C. The primers include adaptors for Ion Torrent sequencing, i.e. an A-key and a P1-key on the forward and reverse primer respectively. Additionally the forward primers have unique DNA sequences besides the primer region and the A-key. These primers are used to assign DNA-barcodes derived from the same sample with a sample-identification sequence (Sample-ID barcode) (refer to table 13 for primer sequences). This enables distribution of DNA-barcode sequence reads according to their originating sample, when DNA-barcodes from multiple samples are sequenced in the same sequencing reaction (see FIG. 9 for a schematic presentation of the primer design). The non-enriched library of the 1025 different Detection Molecules (diluted 100.000× after being reduced in volume) are also assigned with a sample-ID barcode through PCR (referred to as the Detection Molecule input). Triplicate PCRs are run with the Detection Molecule-input. Information about the distribution of Labels within the library of Detection Molecules before enrichment will allow normalization of the sequence output. Pooled PCR products derived from the sample input and from multiple incubations of Detection Molecule and sample are separated according to size, by gel-electrophoresis, and the excised gel-fragment containing DNA-fragments of ˜200 bp are purified with the QIAquick PCR Purification Kit (Qiagen, #28104) according to standard procedure.
      • ii. The purified DNA was sequenced on an Ion Torrent PGM 314 chip.
    • b. Analysis. Positive sequence reads are aligned to sequences that read from the sample-barcode-identity at the 5′-end all the way through the DNA-barcode-identity. The number of reads is normalized according to the total number of reads that maps to the same sample-ID barcode and according to the Detection Molecule input reads. The Analysis is essentially as in example 7 except that the database of 2OS sequences now includes 1025 Labels and sequences are mapped according to corresponding 2OS DNA-barcodes.
      
      • i. Mapping sequencing reads to 2OS DNA-barcodes: A sequence database is created consisting of the possible combinations of 10 sample-identification barcodes and 1025 2OS DNA barcodes (together with the primer and annealing sequences from the 2OS system). This accumulates to 10250 sequences that can be expected from a sequencing run. Each sequencing read is then used to search the database for alignments, using the nucleotide BLAST algorithm, with a match reward of 1, mismatch reward of −2 and a gap cost of 2 for both opening and extending a gap. In this way sequencing errors are penalized equally, whether a base was miscalled or inserted/deleted in the sequencing read compared to the actual sequence. Alignments are discarded by the following criteria:
        
        • 1. E-value >1e-12; insufficient length of alignment (should be greater than 102 for the 2OS barcodes).
        • 2. Start position in subject sequence larger than 2, i.e. fewer than 5 out of 6 bases in the unique part of the sample-identification barcode was included in the alignment.
      • If multiple alignments can still be found for any sequencing read, only the alignment with the best percent identity is kept. Finally, the number of reads mapping to each DNA barcode in the database is counted.
      • ii. Identifying overrepresented DNA barcodes: Is essentially performed as described in example 7 with the strategy of applying clonality reduction.
        
        • Relative read counts are calculated by normalizing each read to the total read count mapping to the same sample-ID barcode. The relative read counts are then used to calculate the fold change per DNA-barcode compared to the control DNA-barcode Detection Molecule input (the non-enriched Detection Molecule library). Significantly overrepresented DNA-barcodes are identified using a 2-sample test for equality of proportions on the raw read counts in a sample versus the DNA-barcode input-sample, and p-values are corrected for multiple testing using the Benjamini-Hochberg FDR method. The algorithm applied for this analysis is available at: www.cbs.dtu.dk/services/Barracoda/

The expected outcome of this example is knowledge on the sensitivity for detecting antigen-specific T cell responses of decreasing frequency (<0.002% of CD8 T cells) in a number of similar samples. The sensitivity will expectantly increase with increasing numbers of Detection molecules incubated with a given sample, because any sequencing reads that are caused by background will be distributed on a greater number of Labels, in this example 1025.

Example 9

In this example 1025 different pMHC complexes, comprising 11 different HLA-alleles, are used as binding molecules. The sample is a mixture of blood from 10 different donors.

This example is essentially the same as example 6 but a greater number of samples (10) will be analyzed with a larger Detection Molecule library (1025), which will include a greater number of different HLA-types (11).

This is an example where the Samples (1) are blood from 10 different donors with different HLA-types which are modified (1b) to generate Peripheral blood mononuclear cells (PBMCs).

The Linker (2) is a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) are peptide-MHC (pMHC) complexes displaying one out of 1025 different peptide-antigens. The MHC molecules are modified (3b) by biotinylation to provide a biotin capture-tag for the Linker. The binding molecules are purified (2c) by HPLC and quality controlled in terms of the formation of functional pMHC multimers for staining of control T-cell populations.

The Labels (4) are oligonucleotides applied as DNA-barcodes. The oligonucleotides are synthetized (4a) by DNA Technology A/S (Denmark) and are synthetically modified (4b) with a terminal biotin capture-tag. The labels are combined oligonucleotide labels arising by annealing an A oligonucleotide (modified with biotin) to a partially complimentary B oligonucleotide label followed by enzymatic DNA polymerase extension of Oligo A and Oligo B to create a fully double stranded label.

The Detection Molecule (5) is synthetized (5a) by attaching Binding Molecules in the form of biotinylated pMHC and Labels in the form of biotin-modified oligonucleotides (DNA-barcodes) onto a streptavidin-modified dextran linker. The detection molecule further contains a modification (5b) in the form of a fluorochrome. A library of 1025 different Detection Molecules are generated wherein individual Binding Molecules, comprised of different pMHC, are encoded for by corresponding individual Labels, comprised of different DNA-barcodes.

An amount of sample, PBMC's (1b) is incubated with an amount of mixed Detection Molecules (5) under conditions (6c) allowing binding of Detection Molecules to T cells in the sample.

The cell-bound Detection Molecules are separated from the non-cell bound Detection Molecules (7) by first a few rounds of washing the PBMC's through centrifugation sedimentation of cells and resuspension in wash buffer followed by Fluorescence Activated Cell Sorting (FACS) of fluorochrome labeled cells. T cells that can efficiently bind Detection Molecules will fluoresce because of the fluorochrome comprised within the detection molecules; T cells that cannot bind detection molecules will not fluoresce. FACS-sorting leads to enrichment of fluorescent cells, and hence, enrichment of the detection molecules along with the associated labels that bind T cells of the PBMC sample.

FACS isolated cells are subjected to PCR for specific amplification of the DNA-barcode associated with the Detection Molecules bound to the isolated cells. High throughput sequencing of the resultant PCR product will reveal the identity of Detection Molecules that binds to T cells present in the sample.

This example will reveal the presence of T cells in the blood expressing a T cell receptor that binds to pMHC molecules represented within the library of 1025 Detection Molecules. The number of sequencing reads that will map to a given DNA-barcode and its corresponding Binding Molecule will mirror the frequency of the T cells found by conventional MHC multimer stainings using the same Binding Molecules. The increased complexity of the Detection Molecule library, in terms of the number of different Binding Molecules and Labels, will enable detection of T cells of 1025 different T cell receptor specificities in parallel and will reflect positively upon the sensitivity for detecting a given Label, i.e. a Detection Molecule, associated with low frequencies of T cells binding such Detection Molecules.

• • 1. Sample preparation. The cell samples used in this example are obtained by preparing PBMC's from blood drawn from 10 different donors with a number of different peptide-antigen responsive T cells, as determined by conventional pMHC-multimer.
    
    • a. Acquiring sample: Blood is obtained from the Danish Blood Bank.
    • b. Modifying sample: PBMCs are isolated from whole blood as described in example 1-2, 5-6.
  • 2. Linker preparation: The linker used in this example is prepared as in example 1-7 and example 8.
  • 3. Binding Molecules preparation: The Binding Molecules used in this example are class I MHC-peptide complexes. The individual specificities (allele and peptide combination) are generated as described in example 1-7 and example 8. A library of 1025 different pMHCs are generated including 10 different HLA-types.
    
    • a. Synthesis: As described in example 1-7 and example 8.
    • b. Modification: No further modifications
    • c. Purification: As described in example 1-7 and example 8.
  • 4. Label preparation: In this example Labels are synthetic oligonucleotides modified with biotin for coupling to the Linker. 1025 different Labels from the 2OS system were applied (table 2).
    
    • a. Synthesis: As described in example 1.
      
      • i. The Label system used in this example is named 2OS and was developed to increase the complexity of a limited number of oligonucleotide sequences. This is enabled by applying a combinatorial strategy where two partially complementary oligonucleotides (an A oligonucleotide with a 5′ biotin tag and a B oligonucleotide) are annealed and then elongated to produce new unique oligonucleotide-sequences (AxBy) which are applied as a DNA-barcodes (Labels) (FIG. 9). By combining 22 unique oligonucleotide-sequences (A label precursor) that are all partly complementary to 55 other unique oligonucleotide sequences (B label precursor) a combinatorial library of 1210 different (AxBy) Labels are produced. Only 1025 of these Labels are used in this example.
    • b. Modification: As described in example 1-7 and example 8.
    • c. Purification: As described in example 1-7 and example 8.
  • 5. Detection Molecules preparation: 1025 different Detection Molecules are generated, each with a different Binding Molecule encoded by a unique Label. The Binding Molecules (pMHCs) and Labels (2OS DNA-barcodes) are attached to the Linker (dextran-streptavidin-PE conjugate), to form Detection Molecules, in such a way that a given pMHC is always attached to a given DNA-barcode.
    
    • a. Detection Molecules are essentially generated in the same way as described in example 1-7 and example 8. The given combination of Label (2OS DNA-barcode) and Binding Molecule (pMHC) of each Detection Molecule are registered.
    • b. Modification: Since the total volume of 1025 pooled Detection Molecules exceeds 100 μl this volume is reduced to reach a desired concentration of specific Binding Molecules. This is done as described in example 2-7 and example 8.
    • c. Purification: As described in example 1-7 and example 8.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules are incubated in the same way as described in example 1-2, 5-7. The cell sample and the Detection Molecules are mixed in one container to allow Detection Molecules to bind to T cells.
  • 7. Enrichment of MHC molecules with desired characteristics: The Detection Molecules are enriched for in the same way as described in example 1-7 and example 8.
  • 8. Identification of enriched Detection Molecules: Because the Detection Molecules are enriched based on specific interaction of the Binding Molecule (the pMHC) with cells, the identification of the associated Labels (DNA-barcodes) amongst the sorted cells will also reveal the pMHCs that bind to cells in the PBMC sample. In this example the DNA-barcodes associated with the enriched Detection Molecules, are amplified by PCR and identified by high-throughput sequencing. The enriched Labels, of the 2OS DNA-barcode system, are identified as in example 8.

The expected outcome of this example is knowledge of the potential complexity for detecting multiple antigen-specific T cell responses in parallel in a single sample. Since the sensitivity is expected to increase with increasing numbers of Detection molecules incubated with a given sample (as described in example 8) it is expected that multiple more T cell responses will also be detected in parallel when using a Detection molecule library of the said complexity. The example will thus prove that it is possible to detect multiple antigen-specific T cell responses in parallel when applying a Detection molecule library comprised of 1025 different 2OS Labels encoding 1025 different Binding molecules distributed on 11 HLA-types.

Example 10

In this example it is shown how multiple, single-cell analyses can be rapidly performed using the present invention. The isolating and/or detecting is done by FACS, leading to the identification of a T cell and its TCR, as well as the pMHC complex that recognizes the T cell by binding to the TCR.

This example will describe how the detection of Binding Molecules can be linked to the T cell receptor (TCR) sequence following single cell sorting of T-cells associated with Detection Molecules.

This is an example where the Sample (1) will be a mixture of T cells comprising TCRs of interest. This could e.g. be tumor infiltrating lymphocytes from a cancer patient. The Linker (2) is a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) is peptide-MHC (pMHC) complexes displaying a of library peptides that are potentially recognized by the T cells in the Sample. This could be a library of melanoma-associated peptides, as used in example 7, or it could be a library of personally-defined potential epitope sequences based on the characteristics of the given patient's tumor. This could e.g. be mutation-derived T cell epitopes and/or epitopes selected based on the expression pattern in the individual tumor. The Binding Molecules will be modified (3b) by biotinylation and quality controlled as described in example 1-6.

The Labels (4) are oligonucleotides as in example 7-9.

The detection molecule (5) will be synthetized (5a) and modified (5b) as in example 7-9.

An amount of Sample, Tumor infiltrating lymphocytes (1b) will be mixed with detection molecules (5) under conditions (6c) that allow binding of detection molecules to T cells in the sample.

Cells will be FACS sorted based on the attachment of Detection Molecules, transferred to a FLUIDIGM C1 unit (or similar device) for single-cell amplification of nucleotide labels and T cell receptor genes.

This example thus reveals the possibility to identify, on a single-cell level, both the antigen-specificity and the T cell receptor sequence. This being done in a mixture of multiple different Binding Molecules (potentially, but not exclusively, >1000). This technology provides a mean for high-throughput identification of TCRs combined with a description of the antigen specificity of the TCR.

• • 1. Sample preparation. The cell sample to be used in this example is a collection of T cells with a recognition profile of interest for determining the sequences of the TCRs associated with this recognition. The sample could e.g. be tumor infiltration lymphocytes from a cancer patient. As described in example 7.
    
    • c. Acquiring sample: As in example 7.
    • d. Modifying sample: As in example 7.
  • 2. Linker preparation: The linker used in this example is prepared as in example 1-10. The fluorochrome co-attachment is important for the selection process in the example.
  • 3. Binding molecule preparation: The binding molecules used in this example will be a collection of peptide-MHC molecules, designed to match the T cell reactivity in the sample. This could be a library of melanoma-associated peptides, as used in example 7, or it could be a library of personally-defined potential epitope sequences based on the characteristics of the given patient's tumor. This could e.g. be mutation-derived T cell epitopes and/or epitopes selected based on the expression pattern if the individual tumor.
    
    • a. Synthesis: as in example 7-9.
    • b. Modification: No further modifications
    • c. Purification: as in example 7-9.
  • 4. Label preparation: as in example 7-9.
  • 5. Detection Molecules preparation: multiple (<1000) different Detection Molecules are generated, each with a different Binding Molecule encoded by a unique Label. The Binding Molecules (pMHCs) and Labels (2OS DNA-barcodes) are attached to the Linker (dextran-streptavidin-PE conjugate), to form Detection Molecules, in such a way that a given pMHC is always attached to a given DNA-barcode.
    
    • a. Detection Molecules are essentially generated in the same way as described in example 1-8.
    • b. Modification: Since the total volume of >1000 pooled Detection Molecules exceeds 100 μl this volume is reduced to reach a desired concentration of specific Binding Molecules. This is done as described in example 2-8.
    • c. Purification: As described in example 1-8.
  • 6. Incubation of sample and Detection Molecules: The cell sample and the Detection Molecules are incubated in the same way as described in example 1-2, 5-7. The cell sample and the Detection Molecules are mixed in one container to allow Detection Molecules to bind to T cells
  • 7. Enrichment of MHC molecules with desired characteristics: The Detection Molecules are enriched for in the same way as described in example 1-7. Cells associated with Detection Molecules are sorted by FACS, through means of the PE-fluorescence signal. The population of cells holding Detection Molecules are following injected to the FLUIDIGM C1 unit allowing for single cell distribution in a micro-well system. Other similar devices or platforms for single cell amplification can also be used.
  • 8. Identification of enriched Detection Molecules: For each cell in the FLUIDIGM C1 unit we will amplify a) the label (=DNA oligonucleotide barcode) and b) the TCR V-alpha and -beta chains. In each well specific primers holding cell identification keys, will be used to amplify DNA oligonucleotide Label. Likewise specific primers holding cell identification keys will be used to amplify the TCR-associate genes, the TCR V-alpha and Beta chains. The complete sequence of the TCR chains will allow the assembly of a fully functional TCR sequence. In parallel knowledge about the Binding Molecules associated with the given T cell, will provide insight o the antigen recognition of the given TCR. Thus we can obtain paired samples of TCR sequences and antigen specificities, using the strategy explained in this example.

The expected outcome of this example is knowledge of the TCR receptor coupled to the knowledge of the recognition of Binding Molecules of this given TCR. Single-cell sorting will enable the generation of a correctly paired and fully functional TCR. The association of the labels will explain the recognition motif of this T cell receptor and provide valuable information in this regard. The technique described here will allow the parallel assessment of multiple different T cells while enabling the capture of specific T cells receptor sequences and have paired knowledge about the Binding molecules associated to this. The overall principle of example 10 is schematized in FIG. 6C.

Example 11

In this example all cells carry the same TCR (T cell receptor). A large number of different pMHC complexes (binding molecules) are employed, in order to examine the recognition breadth and affinity of a given T cell receptor (TCR).

This example describes how the detection of Binding Molecules can be used to determine the recognition breadth and affinity of a given T cell receptor (TCR).

This is an example where the Sample (1) is a T cell clone or a culture of T cell receptor transduced T cells. Importantly for this example all cells will hold the same T cell receptor.

The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) will be peptide-MHC (pMHC) complexes displaying a library of peptides that are potentially recognized by the T cell receptor in question. This could ideally be a set of alanine-scanning substituted peptides modified based on the known recognition sequence of the T cell receptor in question. The Binding Molecules will be modified (3b) by biotinylation and quality controlled as described in example 1-6.

The Labels (4) are oligonucleotides as in example 7-9.

The detection molecule (5) will be synthetized (5a) and modified (5b) as in example 7-9. Multiple different detection molecules will be generated wherein the individual detection molecules containing different pMHC were encoded by corresponding individual oligonucleotide labels, as in example 7-9.

An amount of Sample, T cell clone (1b) will be mixed with detection molecules (5) under conditions (6c) that allow binding of detection molecules to the T cells in the sample.

Cells will be washed to remove excess Detection Molecules, and following the identity of the Binding Molecules will be revealed through sequencing of the Label.

This example thus reveals the possibility to identify the specificity and breadth of specificity of a given T cell receptor. This knowledge is essential for the development of T cell receptor gene therapy strategies, and adoptive transfer of T cell population carrying specific T cell receptors.

• • 1. Sample preparation. The cell sample to be used in this example is a T cell clone (carrying a single, defined T cell receptor) or a culture of T cells transduced with a given T cell receptor.
    
    • e. Acquiring sample: Any PBMC sample can be used as a source to transduce the T cells with a characterized T cell receptor (TCR), expressed in a retroviral vector.
    • f. Modifying sample: PBMCs modified to express a given TCR following retroviral transduction using a vector expressing the selected TCR.
  • 2. Linker preparation: The linker used in this example is prepared as in example 1-10. The fluorochrome has no particular use in this example. Consequently, the fluorochrome attachment is not needed.
  • 3. Binding molecule preparation: The binding molecules used in this example will be a collection of peptide-MHC molecules, designed to assess the breadth to recognition of the given TCR. The peptide library could be alanine substitution libraries of the known peptide-epitope recognized by the given TCR. Alanine substitution is used to assess the essential amino acids in given positions important for TCR recognition.
    
    • a. Synthesis: as in example 7-9.
    • b. Modification: No further modifications
    • c. Purification: as in example 7-9.
  • 4. Label preparation: as in example 7-9.
  • 5. Detection molecules preparation: as in example 7-9.
  • 6. Incubation of sample and detection molecules: The cell sample and the Detection Molecules were mixed in one container, to allow the Detection Molecules to bind the T cells that they recognize.
    
    • a. Amount of sample: 100.000 cells expressing a given TCR
    • b. Amount of detection molecule: as in example 7-9.
    • c. Conditions: The 100.000 cells will be mixed with different quantities of Detection Molecules. This being the standard amount of detection molecules as given in example 7-9, but with parallel detection analysis using e.g. 5× excess for Detection molecules, as well as 5×, 25×, 125× fold less Detection Molecules. Such titration is done to assess the avidity of the selected TCR towards the Binding Molecule library used.
  • 7. Enrichment of detection molecules with desired characteristics: In this example, excess Detection molecules are separated from Sample through centrifugation. All cells are expected to bind Detection molecules to some extent, and consequently all cells are used for characterization of Binding Molecules.
  • 8. Identification of enriched Detection Molecules: The identification of Detection Molecules and analyses of sequencing results is conducted as described in example 7.

The expected outcome of this example is knowledge related to the Detection molecules associated with a given T cell receptor. Through this technology we can gain knowledge on the breadth and the avidity of a given TCR towards a large library of similar, overlapping and/or alanine substituted peptide-epitope sequences. The technique can be used to understand both avidity and ‘fine-specificity’ of a given TCR. This will be of crucial importance for development of TCR receptor-associated therapies, such as TCR gene therapy in cancer treatment. The overall principle of example 11 is schematized in FIG. 6D.

Example 12

In this example it is described how the present invention can be used to identify the specificity of the stimuli that lead to a functional response of certain cells. In the example, the external stimulus is the addition of tumor cells, and the functional response measured is the release of INF-γ.

This example will describe how the detection of Binding Molecules can be associated to a functional response to a given stimuli provided to the Sample in vitro.

This is an example where the Sample (1) will be tumor infiltrating lymphocytes (TIL) from cancer patients which are modified to determine the reactivity toward tumor cells (1b). The Sample is mixed with tumor cells to allow cytokine release from responding T cells in the Sample. The cytokines are trapped intracellular following Golgi-transport blockade and cellular fixation.

The Linker (2) was a dextran conjugate with streptavidin and fluorochrome (Dextramer backbone from Immudex).

The Binding Molecules (3) will be peptide-MHC (pMHC) complexes displaying a library of melanoma-associated peptides (as described in Andersen et al. Dissection of T cell antigen specificity in human melanoma. Cancer Research 2012 Apr. 1; 72(7):1642-50), and used in example 7. The Binding Molecules will be modified (3b) by biotinylation and quality controlled as described in example 1-6.

The Labels (4) were oligonucleotides as in example 7-9.

The detection molecule (5) will be synthetized (5a) and modified (5b) as in example 7-9. 175 different detection molecules were generated wherein the individual detection molecules containing different pMHC were encoded by corresponding individual oligonucleotide labels, as in example 7.

An amount of Sample, TILs (1b) will mixed with detection molecules (5) under conditions (6c) that allow binding of detection molecules to T cells in the sample. Cells will be selected by FACS based on their cytokine release upon stimulation with the tumor cells. After cellular selection, cells encompassing different cytokine profiles will be analyzed for their binding to the Detection Molecules, consequently describing the T cell receptor specificity of the responding T cells, i.e. T cells recognizing tumor cells.

This example thus reveal the possibility to identify potential differences in T cell specificity among cells responding differently to a given stimuli, here provided be the mixture of T-cells with tumor cells.

• • 1. Sample preparation. The cell sample to be used in this example is tumor infiltrating lymphocytes (TILs) obtained from melanoma patients (as example 7).
    
    • a. Acquiring sample: as in example 7.
    • b. Modifying sample: TILs will be purified and expanded as in example 7. Following, TILs will be mixed with tumor cell to assess cytokine release upon T-cell mediated tumor cell recognition, using the following protocol for intracellular cytokine staining: Tumor cells will be thawed, washed twice in culture media (RPMI), and cultured in RPMI+10% FCS (R10) until they had expanded to a sufficient amount of cells. TILs will be thawed in 10 ml RPMI+2.5 ul DNase and 50 ul MgCl2, washed twice in RPMI and rested overnight or at least 4 hr in X-vivo+5% HS+100 U/ml IL-2. Following rest, the cells will be washed, counted and resuspended in X-vivo+5% HS obtaining a concentration of 3*10⁶ cells/ml. 100 ul of the cell suspension will then be added to at least two wells in a 96 well plate—more replicates will be made if enough cells are available. Thus 3*10⁵ cells will added to each well. Tumor cells will be trypsinated, washed in R10, counted and resuspended in RPMI+10% HS to a concentration of 2*106 cells/ml. 50 ul of cell suspension containing 1*10⁵ cells will be added to the TILs. To every well, 50 ul of Golgi medium, containing 45 ul RPMI+10% HS, 5 ul BV421 conjugated CD107a antibody (BD pharmingen) and 0.2 ul Golgi Plug (BD Bioscience 555029) was added. The cells were then incubated 4-5 hours in 37° C. All samples were cultured in a ratio of 3:1 TIL:tumor cells, with a total of 4*10⁵ cells per well. After end incubation, the cells were spun and all replicates were collected into one well. Cell will be washed in PBS+2% FCS (FACS buffer) and resuspended in 50 uL barcode-buffer (PBS/0.5% BSA/2 mM EDTA/100 μg/ml herring DNA).
  • 2. Linker preparation: The linker used in this example is prepared as in example 1-8. The fluorochrome has no particular use in this example. Consequently, the fluorochrome attachment is not needed.
  • 3. Binding molecule preparation: The binding molecules used in this example will be 175 different class I MHC-peptide complexes, as in example 7.
    
    • a. Synthesis: as in example 7.
    • b. Modification: No further modifications
    • c. Purification: as in example 7.
  • 4. Label preparation: as in example 7.
  • 5. Detection molecules preparation: as in example 7.
  • 6. Incubation of sample and detection molecules: The cell sample and the Detection Molecules were mixed in one container, to allow the Detection Molecules to bind the T cells that they recognize.
    
    • a. Amount of sample: 50 uL cell suspension as described in 1b.
    • b. Amount of detection molecule: as in example 7.
    • c. Conditions: The Detection molecules were added in the required amount. If necessary barcode-buffer was added to reach a total volume of 100 ul and cells were incubated 15 min, 37° C. Following incubation, cells were and stained with the following surface antibodies: anti-CD3 antibody, anti-CD8 antibody, anti-CD4 antibody and near-IR-viability dye (Invitrogen L10119). The cells were then incubated for 30 min at 4° C., after which they were washed twice in barcode-buffer and incubated in 200 ul fixation buffer (1:4 concentrate, eBioscience 00-5123-43, to diluent eBioscience 00-5223-56) overnight at 4° C. The following day, cells were washed twice in permeabilization buffer (1:10 buffer to water, eBioscience 00-8333-56), resuspended in 50 ul permeabilization buffer and stained with intracellular antibodies: FITC-conjugated anti-TNF antibody (BD pharmingen 562082), APC-conjugated anti-IFN antibody (BD 341117). After incubating for 30 min at 4° C. with the antibodies, the cells were washed twice in permeabilization buffer, resuspended in 50 ul barcode-buffer.
  • 7. Enrichment of detection molecules with desired characteristics: In this Example, the Sample is selected based on the cytokine secretion mediated following incubation with tumor cells. Cytokines are visualized through intracellular cytokine staining (ICS). The Sample is following stained with the Detection Molecules. Cytokine producing cells will be selected by Fluorescence-Activated-Cell-Sorting (FACS), and the Detection Molecules carried along with a given cytokine profile of a given cell population will be assessed through sequencing of the co-attached oligonucleotide barcodes
    
    • a. Apply: Cells were sorted on a BD FACSAria, equipped with three lasers (488 nm blue, 633 nm red and 405 violet). The flow cytometry data analyses will be performed using the BD FACSDiva software version 6.1.2. The following gating strategy will be applied. Lymphocytes were identified in a FSC/SSC plot. Additional gating on single cells (FSC-A/FSC-H), live cells (near-IR-viability dye negative), and CD8, CD3 positive cells, and CD4 negative.
      
      • From this defined cell population two separate subsets will be sorted based ion the cytokine secretion in relation to tumor-cell stimulation. T cells positive for any of the detected cytokines ‘ICS positive’ is sorted in one tube, and T cells negative for any of the detected cytokines ‘ICS negative’ is sorted in another tube.
    • b. Wash: not applicable.
    • c. Separate: Optionally cells were acquired up to one week after fixation in 1% paraformaldehyde. The ‘ICS positive’ and ‘ICS negative’ cells were sorted by FACS, as described in 7a, into tubes that had been pre-saturated for 2 h-O.N. in 2% BSA and contained 200 μl barcode-buffer to increase the stability of the oligonucleotides that followed with the sorted cells. The sorted cells were centrifuged 5 min, 5000 g, to allow removal of all excess buffer. Cells were stored at −80° C.
  • 8. Identification of enriched Detection Molecules: The identification of Detection Molecules and analyses of sequencing results is conducted as described in example 7. The ‘ICS positive’ and ‘ICS negative’ cells are treated as two independents samples. Following these two samples are compared for the association with Binding Molecules.

The expected outcome of this examples is knowledge related to the Detection molecules associated with tumor cell recognition (=‘ICS positive’) as oppose to no recognition (=‘ICS negative’). In other terms, we will gain knowledge on the T cell recognition elements associated with tumor cell recognition, among a large pool of different Detection Molecules, here peptide-MHC molecules. Knowledge of T cell mediated recognition of tumor cells has major impact on the design and development of immunotherapeutic strategies for cancer. The overall principle of example 12 is schematized in FIG. 6A.

Cell could likewise be selected based on e.g. phenotypic characteristics, to assess what T specificities are associated with selected phenotypic characteristics as schematized in FIG. 6B.

Tables for Examples 1-12:

Example 20

This is an example where the Sample is a whole blood sample. Instead of being a mix of two PBMC donor materials as described in e.g. example 3 it is a mix of two whole blood samples. Except for the sample preparation the example is performed as example 3

Thus, the Linker is a dextrane conjugate with streptavidin and fluorocrome (PE Dextramer backbone from Immudex ApS).

The Binding Molecules are peptide-MHC (pMHC) complexes. In this example a panel of 110 labeled pMHC-multimers, constituting a library of Detection Molecules, are tested. Apart from 26 virus epitopes that are commonly found in healthy donors (derived from EBV, CMV, FLU and HPV), is included a number of polyomavirus capsid protein (VP1)-derived epitopes that has previously led to detection of T cells in healthy donors.

110 different Labels are generated as example 3. Detection Molecules are synthetized as in example 3.

Sample, whole blood, was incubated with an amount of a library of detection molecules as described in example 3.

The cell-bound detection molecules are separated from the non-cell bound detection molecules as described in example 3.

FACS isolated cells were subjected to PCR amplification of the oligonucleotide label associated with the detection molecules bound to cells. Subsequent extensive sequencing of PCR products revealed the identity of Detection Molecules that bound to the T cells present in the sample.

• • 1. Sample preparation. The cell samples used in this experiment are obtained by mixing whole blood from two different donors to obtain a cell sample where a number of T-cell specificities are known prior to the experiment. Thus, the sensitivity of the method as well as the relevance of the results obtained in the experiment can be evaluated at the end of the experiment, by comparison with data obtained previously, using other methods but cell samples prepared from the same donors.
    
    • a. Acquiring sample: Blood is obtained from the Danish Blood Bank.
    • b. Modifying sample:
      
      • i. Blood is drawn into BD Vacutainer® Plus Plastic K2EDTA Tubes according to manufacturer's protocol.
      • ii. Anti-coagulated blood samples are diluted 1:1 in RPMI (RPMI 1640, GlutaMAX, 25 mM Hepes; gibco-Life technologies).
      • iii. The samples used in the experiment are obtained by mixing blood from a donor (e.g. BC260) with 5% of the T cells specific for HLA-B7/CMV pp65 TPR into blood from a donor (e.g. BC262) without HLA-B7/CMV pp65 TPR specific T cells in fivefold dilutions, creating seven samples (with 5%, 1%, 0.2%, 0.04%, 0.008%, 0.0016% and 0.00032% HLA-B7/CMV pp65 TPR-specific T cells). The CMV pp65 TPR negative sample preparation instead has a population of HLA-A11/EBV-EBNA4 specific T cells.
      • iv. The remaining of the example is as for example 3.
  • 2. Linker preparation: The linker used in this example is dextrane conjugate with streptavidin and fluorocrome (PE Dextramer backbone from Immudex) as described in 1.
  • 3. Binding molecules preparation: The 110 different Binding Molecules are prepared as in example 3.
  • 4. Label preparation: The 110 different DNA oligo Labels are prepared as in example 3.
  • 5. Detection molecules preparation: 110 different Detection Molecules are prepared as in example 3.
  • 6. Incubation of sample and detection molecules:
    
    • a. Amount of sample: 0.2 mL anti-coagulated blood diluted 1:1 in RPMI.
    • b. Amount of detection molecule: As for e.g. example 3.
    • c. Conditions: Sample is incubated with dasatinib (50 nM final concentration), 30 min, 37° C. Subsequently, sample and Detection Molecule is mixed and incubated as e.g. example 3.
  • 7. Enrichment of detection molecules with desired characteristics: Detection Molecules are isolated with their associated cells by FACS as described in example 3.
  • 8. Identification of enriched detection molecule: By identifying the Label (in this Example, the oligonucleotide label), the pMHCs that bound separated cells can be identified. Therefore, the oligonucleotide labels that were comprised within the Detection Molecule that were recovered with the cells, were sequenced. This allowed the identification of pMHCs that bound cells of the cell sample. Labels associated with FACS isolated cells are sequenced as described in example 3.

Example 21

This is an example where the Sample is mononuclear cells derived from bone marrow (BM MNCs). Instead of being a mix of two PBMC donor materials as described in example 3 it is a mix of two whole blood samples. Except for the sample preparation the example is performed as example 3.

Thus, the Linker is a dextrane conjugate with streptavidin and fluorocrome (PE Dextramer backbone from Immudex).

The Binding Molecules are peptide-MHC (pMHC) complexes. In this example a panel of 110 labeled pMHC-multimers, constituting a library of Detection Molecules, are tested. Apart from 26 virus epitopes that are commonly found in healthy donors (derived from EBV, CMV, FLU and HPV), is included a number of polyomavirus capsid protein (VP1)-derived epitopes that has previously led to detection of T cells in healthy donors.

110 different Labels are generated as in example 3. Detection Molecules are synthetized as in example 3.

Sample, whole blood, was incubated with an amount of a library of detection molecules as described in example 3.

The cell-bound detection molecules are separated from the non-cell bound detection molecules as described in example 3.

FACS isolated cells were subjected to PCR amplification of the oligonucleotide label associated with the detection molecules bound to cells. Subsequent extensive sequencing of PCR products revealed the identity of Detection Molecules that bound to the T cells present in the sample.

• • 1. Sample preparation. The cell samples used in this experiment was obtained by mixing bone marrow from two different donors to obtain a cell sample where a number of T-cell specificities were known prior to the experiment. Thus, the sensitivity of the method as well as the relevance of the results obtained in the experiment could be evaluated at the end of the experiment, by comparison with data obtained previously, using other methods but cell samples prepared from the same donors.
    
    • a. Acquiring sample: Collect bone marrow from the upper iliac crest or the sternum by using an aspiration needle.
    • b. Modifying sample:
      
      • i. Dilute aspirated human bone marrow at a ratio of 7:1 with buffer (phosphate buffered saline (PBS), pH 7.2, and 2 mM EDTA), e.g., dilute 30 mL of bone marrow with 5 mL of buffer to a final volume of 35 mL.
      • ii. Pass cells through a 100 μm filter to remove bone fragments and cell clumps.
      • iii. Carefully layer 35 mL of diluted cell suspension over 15 mL of Ficoll-Paque in a 50 mL conical tube. Centrifuge at 445×g for 35 minutes at 20° C. in a swinging bucket rotor without brake. Aspirate the upper layer leaving the mononuclear cell layer undisturbed at the interphase. Carefully transfer the BM MNCs at the interphase to a new 50 mL conical tube. Wash cells by adding up to 40 mL of buffer, mix gently and centrifuge at 300×g for 10 minutes at 20° C. Carefully remove supernatant completely. For removal of platelets, resuspend the cell pellet in 50 mL of buffer and centrifuge at 200×g for 10-15 minutes at 20° C. Carefully remove the supernatant completely. Resuspend cell pellet in 5 mL buffer for downstream applications.
      • iv. The samples used in the experiment is obtained by mixing BM MNCs from a donor (e.g. BC260) with 5% of the T cells specific for HLA-B7/CMV pp65 TPR into BM MNCs from a donor (e.g. BC262) without HLA-B7/CMV pp65 TPR specific T cells in fivefold dilutions, creating seven samples (with 5%, 1%, 0.2%, 0.04%, 0.008%, 0.0016% and 0.00032% HLA-B7/CMV pp65 TPR-specific T cells). The CMV pp65 TPR negative BM MNC preparation instead has a population of HLA-A11/EBV-EBNA4 specific T cells.
      • v. The remaining of the example is as for example 3.
  • 2. Linker preparation: The linker used in this example is dextrane conjugate with streptavidin and fluorocrome (PE Dextramer backbone from Immudex) as described in 1.
  • 3. Binding molecules preparation: The 110 different Binding Molecules are prepared as in example 3.
  • 4. Label preparation: The 110 different DNA oligo Labels are prepared as in example 3.
  • 5. Detection molecules preparation: 110 different Detection Molecules are prepared as in example 3.
  • 6. Incubation of sample and detection molecules:
    
    • a. Amount of sample: 0.2 mL anti-coagulated blood diluted 1:1 in RPMI.
    • b. Amount of detection molecule: As for example 3.
    • c. Conditions: Sample is incubated with dasatinib (50 nM final concentration), 30 min, 37° C. Subsequently, sample and Detection Molecule is mixed and incubated as e.g. example 3.
  • 7. Enrichment of detection molecules with desired characteristics: Detection Molecules are isolated with their associated cells by FACS as described in example 3.
  • 8. Identification of enriched detection molecule: By identifying the Label (in this Example, the oligonucleotide label), the pMHCs that bound separated cells can be identified. Therefore, the oligonucleotide labels that were comprised within the Detection Molecule that were recovered with the cells, were sequenced. This allowed the identification of pMHCs that bound cells of the cell sample. Labels associated with FACS isolated cells are sequenced as described in example 3.

Example 60

This is an example where the binding molecules (BM) are MHC-like antigen-presenting molecules such as e.g. CD1a, CD1b, CD1c and CD1d.

The Linker used in this example is dextran conjugate with streptavidin and fluorocrome (PE Dextramer backbone from Immudex), the label used is a DNA oligonucleotide and the Sample is PBMC's.

Isolation and identification of detection molecules capable of binding to cells of the cell sample is done by FACS of cells with PE labeled dextran conjugate, and the identity and amount of associated labels are determined by DNA sequencing.

• • 1. Sample preparation.
  • The sample used in this example can be any type of cell sample, for example one PBMC sample from a human being, as described in Example 1.
  • 2. Linker preparation:
  • The linker used in this experiment is a dextran molecule, prepared as described in Example 1.
  • 3. Binding molecules preparation
    
    • a. Synthesis: CD1a, CD1b, CD1c and CD1d is produced as described by Khurana A, et. al, J Vis Exp. 2007; (10): 556. and as performed by a person skilled in the art.
    • b. Modification: CD1a, CD1b, CD1c and CD1d is loaded with 15 potential lipid antigens (GMM, glucose monomycolate; Sulfolipid, diacylated sulfoglycolipid; PIM's, phosphatidylinositol mannosides; Man-LAM, mannosylated lipoarabinomannan; MPM, mannosyl-b1-phosphomycoketide; MPP, mannosyl-b1-phosphoheptaprenol; DDM, dideoxymycobactin; GSL-1, a-glucoronsylceramide; GaIDAG, a-galactosyldiacylglycerol; LPG, lipophosphoglycan; PI, phosphatidylinositol; PG, phosphatidylglycerol; PE, phosphatidylethanolamine; iGb3, isoglobotrihexosylceramide; Alpha-GC, a-galactosylceramide). Lipids are dissolved to 2 mg/mL in DMSO, heated to 50° C. for 2 min and diluted further 1:10 in PBS+0.1% Tween20. Lipids are mixed individually with the four different CD1 molecules giving rise to 4×15=60 combinations. Briefly 10 uL 1 ug/uL CD1 protein is mixed with 2 uL 0.2 mg mL lipid in PBS+0.1% Tween20+10% DMSO. Load lipids into CD1 4 h at 30° C.
    • c. Purification: The CD1a-lipid, CD1b-lipid, CD1c-lipid and CD1d-lipid complexes are not purified further.
  • 4. Label preparation: Labels as described in example 3 are used.
    
    • a. Synthesis: The first 60 Labels in table 8 are used.
    • b. Modification: no further
    • c. Purification: no further
  • 5. Detection molecules preparation
    
    • a. Synthesis: The detection molecules are prepared as in example 3 except that the 60 different CD1 and lipid combinations are mixed with 60 individual DNA oligonucleotide labels (labels 1-60 from table 8).
    • b. Modification: no further modifications
    • c. Purification: no further
  • 6. Incubation of sample and detection molecules
    
    • The sample and detection molecules of step 1 and 5, respectively, are mixed and incubated as described in Example 3.
  • 7. Enrichment of detection molecules with desired characteristic: Cells positive for PE fluorochrome on the Linker is isolated by FACS as described in example 3.
  • 8. Identification of enriched detection molecule: The detection molecules recovered in step 7 are identified by sequencing, as described in Example 3.

Example 61

This is an example where the binding molecules (BM) are MHC class II proteins. The Linker used in this example is dextran conjugate with streptavidin and fluorocrome (PE Dextramer backbone from Immudex), the label used is a DNA oligonucleotide and the Sample is PBMC's.

Isolation and identification of detection molecules capable of binding to cells of the cell sample is done by FACS of cells with PE labeled dextran conjugate, and the identity and amount of associated labels are determined by DNA sequencing.

• • 1. Sample preparation: The sample used in this example can be any type of cell sample, for example one PBMC sample from a human being, as described in Example 1.
  • 2. Linker preparation: The linker used in this experiment is a dextran molecule, prepared as described in Example 1.
  • 3. Binding molecules preparation
    
    • a. Synthesis: MHC class II protein in the form of biotinylated monomers are obtained from The NIH Tetramer Core Facility, at Emory University, US. The following eight MHC Class II monomers are used (DPB1*04:01 C. tetani TT 948-968 FNNFTVSFWLRVPKVSASHLE, DPB1*04:01 human MAGE3 243-258 KKLLTQHFVQENYLEY, DPB1*04:01 human oxytocinase 272-284 KKYFAATQFEPLA, DPB1*04:01 human CLIP 87-101 PVSKMRMATPLLMQA, DPB1*04:01 human CTAG1 157-170 SLLMWITQCFLPVF, DPB1*04:01 HIV env 31-45 TEKLVVVTVYYGVPVW, DQB1*03:02 human CLIP 87-101 PVSKMRMATPLLMQA, DQB1*03:02 human FcR2 104-119 QDLELSWNLNGLQADL
    • b. Modification: Monomers are obtained ready folded and biotinylated from The NIH Tetramer Core Facility.
    • c. Purification: No further modification
  • 4. Label preparation
    
    • a. Synthesis: The first 8 labels from Table 8 are used
    • b. Modification: No further
    • c. Purification: No further
  • 5. Detection molecules preparation
    
    • a. Synthesis: The detection molecules are prepared as in example 3 except that the 8 different MHC class II molecules are combined with 8 different DNA oligonucleotide labels as described in example 3.
    • b. Modification: No further
    • c. Purification: No further
  • 6. Incubation of sample and detection molecules: The sample and detection molecules of step 1 and 5, respectively, are mixed and incubated as described in Example 3.
  • 7. Enrichment of detection molecules with desired characteristics: Cells positive for PE fluorochrome on the Linker is isolated by FACS as described in example 5.
  • 8. Identification of enriched detection molecule: The detection molecules recovered in step 7 are identified by sequencing, as described in Example 3.

Example 80

In this example, the labels used are DNA oligonucleotides of different length. The identity of the individual label is based on its mass, by either mass spectrometry or differential migration in a gel electrophoresis analysis.

• • 1. Sample preparation.

Blood comprising different kinds of blood cells is drawn from a person, and used directly in the incubation, step E below. Alternatively, any type of sample described in the examples above can be used.

• • 3. Binding molecules preparation

The binding molecules used in this study are 10 different antibodies, recognizing 10 different cell differentiation markers (CDs) respectively, namely CD3, CD4, CD8, CD16, CD56, . . . **. Each of these are commercially available.

• • 4. Label preparation

10 DNA oligonucleotides of length 50 nt, 100 nt, 150 nt, 200 nt, 250 nt, 300 nt, 350 nt, 400 nt, 450 nt, and 500 nt, respectively, with a terminal N-succinimidyl ester moiety are prepared by standard means.

• • 5. Detection molecules preparation

Each of the 10 antibodies mentioned under (B) are incubated in appropriate buffer (e.g. PBS pH 8) together with one of the 10 oligonucleotides mentioned in step (C) above, allowing the N-succinimidyl ester to react with free amines on the surface of the antibody, to form a covalent link between the antibody and the oligonucleotide. In this way, 10 detection molecules are generated, each of which comprise one specific antibody (e.g. anti-CD3 antibody) and one specific oligonucleotide (e.g. 50 nt DNA oligo).

• • 6. Incubation of sample and detection molecules

The sample of step (A) is incubated with the 10 detection molecules under appropriate conditions (e.g. appropriate buffer, e.g. Tris pH 7.5 is added, or the oligonucleotides from step (D) in e.g. PBS pH 8 is simply mixed with sample without further addition of buffer. Incubation can be at 0, 4, 10, 20, 30, or 40 degrees celcius.

• • 7. Isolating bound and unbound detection molecules

The incubation mixture of step (E) is centrifuged, to recover all cells of the sample. Supernatant is removed, the cells resuspended and buffer added. Centrifugation is repeated 1-3 times, and the cells finally resuspended. The suspension of cells will contain detection molecules that are capable of binding to one or more cells. Thus, the detection molecules of the suspension are representative of the distribution of receptors on the cell surface of the cells of the original sample.

• • 8. Determining the identity and amount of the recovered detection molecules.

1 μL of the mixture of cells and bound detection molecules are transferred to a 100 μL PCR reaction comprising forward and reverse primers that can anneal to each of the 10 oligonucleotide labels described in step (C) above, and comprising all other components for an efficient PCR reaction. The PCR reaction is performed under standard conditions, and aliquots are taken out after 25, 30 and 35 cycles are performed.

The PCR product is applied to a gel capable of resolving the individual oligonucleotide fragments (e.g. a 2.5% agarose gel), and electrophoresis is performed. Once the fastest moving product (corresponding to the 50 nt oligonucleotide) has migrated about ¾ of the gel length, electrophoresis is terminated. The position of a band in the gel reflects its size and therefore identifies the corresponding oligonucleotide label; the uppermost band represents the largest fragment (500 nt), and the lowermost band represents the smallest fragment (50 nt). The intensity of each of the 10 bands, corresponding to each of the 10 different oligonucleotide fragments, is indicative of the relative amount recovered of each oligonucleotide label and therefore, of each detection molecule.

Example 81

This example is as example 80, except that the labels used here are PNA fragments rather than DNA oligonucleotides, and the identity of the labels of the recovered detection molecules are determined by mass spectrometry analysis rather than gel electrophoresis.

Sample and binding molecules are as described in example 80.

Labels are prepared as follows. 10 different PNAs are prepared, of different size (e.g. comprising 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23 bases). During synthesis, N-succinimidyl ester is introduced at one of the PNA fragment. Further, also during its synthesis, a disulfide bond (S—S) is introduced between the ester and the rest of the PNA fragment. Thus, in the label a disulfide bond links the N-succinimidyl ester with the remainder of the PNA fragment.

Detection molecules are prepared as in example 80, except that the PNA labels are used instead of the DNA oligonucleotide labels of example 80. Each of the resulting 10 detection molecules therefore consists of a specific binding molecule (a specific antibody, e.g. CD3) and a specific PNA label (e.g. PNA comprising 5 bases). Isolation of detection molecules capable of binding to cells of the sample is done by centrifugation as described in example 80, and the final cell suspension thus contains cells plus detection molecules capable of binding to cells of the sample.

Finally, the identity and amount of the recovered detection molecules is determined in the following way: First, the PNA labels are cleaved off from the detection molecules (and therefore, released from the cells that the detection molecule is bound to) by addition of DTT, which cleaves the disulfide bond. The cells are spun down by centrifugation, and the supernatant (comprising the released PNA labels but not the cells) is then subjected to a mass spectrometry analysis.

The mass spectrometry analysis will reveal the relative amount of each of the 10 PNA labels (corresponding to the relative amount of each of the 10 detection molecules recovered by centrifugation of the cells).

Example 82

This example is as example 81, except that the labels used here are peptide fragments rather than PNA fragments

Labels are prepared as follows. 10 different peptides are prepared, of different size (e.g. comprising 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23 amino acids). During synthesis, N-succinimidyl ester is introduced at one of the peptide fragment. Further, also during its synthesis, a disulfide bond (S—S) is introduced between the ester and the rest of the peptide fragment. Thus, in the label a disulfide bond links the N-succinimidyl ester with the remainder of the peptide fragment.

Detection molecules are prepared as in example 81, except that the peptide labels are used instead of the PNA labels of example 81. Each of the resulting 10 detection molecules therefore consist of a specific binding molecule (a specific antibody, e.g. CD3) and a specific peptide label (e.g. peptide comprising 5 amino acids).

The mass spectrometry analysis will reveal the relative amount of each of the 10 peptide labels (corresponding to the relative amount of each of the 10 detection molecules recovered by centrifugation of the cells).

Example 120

This is an example where the samples are three buffy coats (BC's), the Linker is PE and streptavidin conjugated dextran, and the Binding Molecules are biotinylated peptide-MHC (pMHC) complexes. The Labels are synthetic oligonucleotides modified with a terminal biotin capture-tag. The labels are combined oligonucleotide label arising by annealing an A oligonucleotide (modified with biotin) to a partially complimentary B oligonucleotide label followed by enzymatic DNA polymerase extension of Oligo A and Oligo B to create a fully double stranded label.

The Detection Molecules are created by combining biotinylated pMHC and labels in the form of biotin-modified oligonucleotide onto a streptavidin-modified dextran linker. The detection molecule further contained a fluorochrome (PE). 30 different Detection Molecules are generated wherein the individual detection molecules containing different pMHC are encoded by corresponding individual oligonucleotide labels. Two versions (Set 1 and Set 2, see table x) of each of the 30 different Detection Molecules are created in the way that all Detection molecules are generated in two forms with different labels. Three samples, PBMC's, were incubated with an amount of mixed Detection Molecules.

In this example CD8+ T cell-bound Detection Molecules are separated from the non-cell bound Detection Molecules by capture of CD8+ T cells using anti CD8-coated magnetic Dynabeads. Magnetic bead-isolated CD8-positive T cells are subjected to PCR amplification of associated Label and the PCR product is analyzed as a read of the oligonucleotide label associated with the detection molecules bound to the isolated cells thus revealing the identity of detection molecules bound to the T cells present in the sample.

• • 1. Sample preparation.
    
    • a. Acquiring sample: The cell sample used in this experiment is obtained by preparing PBMC's from blood drawn from three donors (D131, D149 and D158) that, by conventional MHC-multimer staining, are characterized for their specific T cells towards a number of virus antigens.
    • b. Modifying sample: The PBMC's are prepared as described in example 1.
  • 2. Linker preparation: The Linker is PE and streptavidin conjugated dextran (Dextramer from Immudex) which is prepared as in example 1.
  • 3. Binding molecules preparation: Binding Molecules are biotinylated pMHC complexes with peptide/HLA combination as described in table below

• • 4. Label preparation: Label is generated as described in example 4 except that in this example only 2×60 labels are used (See table above)
  • 5. Detection molecules preparation
    
    • a. Synthesis
      
      • i. According to table below transfer the required volume Dextran conjugate to an Eppendorf tube. Centrifuge (10.000 g, 10 min, 4° C.).
      • ii. Transfer the supernatant containing dextrane conjugate without precipitates to 2*30 wells on two plates.
      • iii. In a 96 well format add the 2×30 Label oligos in 2:1 molar concentration to PE-Dextramer conjugate.
      • iv. Mix well and incubate 30 min, 4° C.
      • v. Thaw pMHC binding molecules on ice, dilute to 100 μg/mL in PBS and centrifuge (2000 g, 5 minutes, 18° C.).
      • vi. Transfer the pMHC monomers to wells of the 96 well plate according to the above table to allow the combination of pMHC with labeled linker.
      • vii. Mix well and incubate 30 minutes at r.t. and PBS subsequently.

• • • a. Modification: No further
    • b. Purification: No further
  • 6. Incubation of sample and detection molecules
    
    • a. Amount of sample: 2 million PBMC's per sample
    • b. Amount of detection molecule: According to table below. Each donor sample is incubated with 4 different amounts of Detection Molecule
    • c. Conditions:
      
      • i. PBMC's are thawed in 10 ml RPM1-10% FCS and washed twice in 2 mL RPMI-10% FCS. Cells are then washed in 2 mL PBS w. 0.5% BSA, 100 μg/ml Herring DNA, 2 mM EDTA. (All washing of cells in this experiment refers to centrifuge for 5 min at 800 g to collect cells followed by discarding of wash buffer)
      • ii. Resuspend cells in 500 μl PBS w. 0.5% BSA, 100 μg/ml Herring DNA, 2 mM EDTA to a concentration 20 million/ml.
      • iii. Add 25 μl 1 μM Dasatinib and incubate 30 min at 37° C. (Final Dasatinib conc. 50 nM).
      • iv. Centrifuge Detection Molecules (2000 g, 5 minutes, 18° C.)
      • v. Add 166.5 μl 10 μM biotin to an Eppendorf tube.
      • vi. Pool 25 μl of each Detection Molecule from each of the two sets into the Eppendorf tube (Detection Molecule library) Vtot=1666, 5 μl which is enough for 3 donors in 4 concentrations.
      • vii. Centrifuge the library of Detection Molecules (10000 g, 10 min) and transfer 1550 μl to a new tube avoiding aggregates.
      • viii. Transfer from new tube to 5 ml tubes according to setup/volumes below.
      • ix. To all twelve tubes add 100 μl cells (2 million cells) of the respective donors, to a VTot in each sample of 300 μl. Incubate 15 minutes at 37° C.
      • x. Wash cells twice in 2 ml PBS w. 0.5% BSA, 100 μg/ml Herring DNA, 2 mM EDTA (Centrifuge 5 min at 800 g)

• • 7. Enrichment of detection molecules with desired characteristics
    
    • a. Apply: In this example Detection Molecules are isolated by capturing CD8+ cells using anti CD8 antibody coated magnetic beads (DYNABEADS CD8, #11147D, Life Technologies). Detection molecules associated with captured CD8+ cells are isolated. Dynabeads used according to manufacturer's protocol.
      
      • i. Briefly; Dynabeads are vortex >30 sec and transfer 50 μl/sample=600 μl to a 5 ml tube and add 1 ml PBS+0.1% BSA+2 mM EDTA. Re-suspended dynabeads are placed in magnet 1 min, supernatant is discarded and dynabeads are re-suspended in 600 μl PBS+0.1% BSA+2 mM EDTA.
      • ii. To all samples add 50 μl washed beads+950 μl Isolation buffer=>Vtot=1 ml. Incubate 20 min 4 C on a tilting plate.
    • b. Wash:
      
      • i. Place tubes in magnet (Dynal, Life Technologies) for 2 min and carefully remove supernatant
      • ii. Wash twice: Add 2 ml PBS+0.1% BSA+2 mM EDTA, vortex, place in magnet 2 min, remove supernatant.
      • iii. Re-suspend beads in 500 μl PBS w. 0.5% BSA, 100 μg/ml Herring DNA, 2 mM EDTA, transfer to Eppendorf tubes.
      • iv. Centrifuge tubes 5 min at 5000 g, remove supernatant final volume app. 20 μl→Store at −80 C or store on ice at 4 C O.N for PCR
    • c. Separate: Is done during washing.
  • 8. Identification of enriched detection molecule: Separated Detection Molecules are analyzed by PCR amplification of the attached labels followed by sequencing of the PCR products to reveal the identity of isolated detection molecules and thus the identity of those antigens for which specific T cells were present in the sample. The PCR amplification and sequencing of PCR product is done as for example 3 using the same sets of primers and the same sequencing service and sequencing de-convolution service.

Example 121

This is an example where the samples are PBMC's prepared as three buffy coats (BC's), the Linker is PE and streptavidin conjugated dextran, and the Binding Molecules are biotinylated peptide-MHC (pMHC) complexes. The Labels are synthetic oligonucleotides modified with a terminal biotin capture-tag.

In this example CD8+ T cell-bound Detection Molecules are separated from non-cell bound Detection Molecules by capture of CD8+ T cells by magnetic labeling of CD8+ cells with CD8 MicroBeads (CD8 MicroBeads, human, #130-045-201, Miltenyi, Germany). Magnetic bead-isolated CD8-positive T cells are subjected to PCR amplification of associated Label (as described in example 3) and the PCR product is analyzed as a read of the oligonucleotide label associated with the detection molecules bound to the isolated cells thus revealing the identity of detection molecules bound to the T cells present in the sample (as example 3).

• • 1. Sample preparation. The samples are PBMC's from three donor materials prepared as described in example 3.
  • 2. Linker preparation: The Linker is PE and streptavidin conjugated dextran (Dextramer from Immudex) which is prepared as in example 1.
  • 3. Binding molecules preparation: Binding Molecules are biotinylated pMHC complexes with peptide/HLA combination as described in example 3.
  • 4. Label preparation: Labels are biotin modified DNA oligonucleotides as described in example 3.
  • 5. Detection molecules preparation: Detection Molecules are prepared by combining 110 aliquots of Linker with individual Labels followed by adding pMHC Binding Molecules as described in Example 3.
  • 6. Incubation of sample and detection molecules: PBMC's are mixed with the 110 member library of Detection Molecules as described in example 3.
  • 7. Enrichment of detection molecules with desired characteristics:
    
    • a. Apply: In this example Detection Molecules are isolated by capturing CD8+ cells using anti CD8 antibody coated magnetic beads (CD8 MicroBeads, human, #130-045-201, Miltenyi, Germany). Detection molecules associated with captured CD8+ cells are isolated. CD8 MicroBeads are used according to manufacturer's protocol. Briefly;
      
      • i. Centrifuge cell suspensions at 300×g for 10 minutes. Aspirate supernatant completely.
      • ii. Resuspend cell pellets in 80 μL of buffer (phosphate-buffered saline (PBS), pH 7.2, 0.5% bovine serum albumin (BSA), and 2 mM EDTA).
      • iii. Add 20 μL of CD8 MicroBeads. Mix well and incubate for 15 minutes in the refrigerator (2-8)
      • iv. Wash cells by adding 1-2 mL of buffer and centrifuge at 300×g for 10 minutes. Aspirate supernatant completely. Resuspend cells in 500 μL of buffer.
      • v. Place an MS column (Miltenyi, Germany) in the magnetic field of a OctoMACS column stand Separator. Prepare column by rinsing with 500 μL of buffer:
      • vi. Apply cell suspension onto the column. Collect unlabeled cells that pass through and wash column with 500 μL of buffer. Collect total effluent; this is the unlabeled cell fraction. Perform washing steps by adding buffer three times. Only add new buffer when the column reservoir is empty.
      • vii. Remove column from the separator and place it on a suitable collection tube.
      • viii. Pipette 1 mL of buffer onto the column.
      • ix. Immediately flush out the magnetically labeled cells by firmly pushing the plunger into the column.
      • x. Centrifuge tubes 5 min at 500 g, remove supernatant. The final volume of app. 20 μl containing collected CD8+ cells and their associated Detection Molecules are store at −80 C for later analysis.
  • 8. Identification of enriched detection molecule: Separated cells and their associated Detection Molecules are analyzed by PCR amplification of the attached labels followed by sequencing of the PCR products to reveal the identity of isolated Detection Molecules and thus the identity of those antigens for which specific T cells were present in the sample. The identification is done as for example 3.

Example 122

This is an example where the samples are PBMC's prepared as three buffy coats (BC's), the Linker is PE and streptavidin conjugated dextran, and the Binding Molecules are biotinylated peptide-MHC (pMHC) complexes. The Labels are synthetic oligonucleotides modified with a terminal biotin capture-tag.

In this example, though, all cells and their bound Detection Molecules are first separated, by centrifugation, from the supernatant containing Detection Molecules not bound to cells. Secondly, remaining Detection Molecules are captured by their PE modification on the Linker using anti PE MicroBeads (anti PE MicroBeads, #130-048-801, Miltenyi, Germany). Magnetic bead-isolated cells are subjected to PCR amplification of Detection-Molecule associated Labels (as described in example 3) and the PCR product is analyzed as a read of the oligonucleotide label associated with the detection molecules bound to the isolated cells thus revealing the identity of detection molecules bound to the T cells present in the sample as in example 3.

• • 1. Sample preparation. The samples are PBMC's from three donor materials prepared as described in example 3.
  • 2. Linker preparation: The Linker is PE and streptavidin conjugated dextran (Dextramer from Immudex) which is prepared as in example 1.
  • 3. Binding molecules preparation: Binding Molecules are biotinylated pMHC complexes with peptide/HLA combination as described in example 3.
  • 4. Label preparation: Labels are biotin modified DNA oligonucleotides as described in example 3.
  • 5. Detection molecules preparation: Detection Molecules are prepared by combining 110 aliquots of Linker with individual Labels followed by adding pMHC Binding Molecules as described in Example 3.
  • 6. Incubation of sample and detection molecules: PBMC's are mixed with the 110 member library of Detection Molecules as described in example 3.
  • 7. Enrichment of detection molecules with desired characteristics
    
    • a. Apply: In this example Detection Molecules are isolated by centrifugation separation of cells and their bound Detection Molecules from the supernatant containing Detection Molecules not bound to cells followed by magnetic capture of cells with bound PE-labeled Detection Molecules thereby separating from cells without bound PE-labeled Detection Molecules using anti PE MicroBeads (anti PE MicroBeads, #130-048-801, Miltenyi, Germany). MicroBeads are used according to manufacturer's protocol. Briefly;
      
      • i. Centrifuge cell suspensions at 300×g for 10 minutes. Aspirate supernatant completely.
      • ii. Wash cells twice by adding 2 mL of buffer (phosphate-buffered saline (PBS), pH 7.2, 0.5% bovine serum albumin (BSA), and 2 mM EDTA) and centrifuge at 300×g for 10 minutes. Aspirate supernatant completely.
      • iii. Resuspend cell pellets in 80 μL of buffer.
      • iv. Add 20 μL of anti PE MicroBeads. Mix well and incubate for 15 minutes in the refrigerator (2-8)
      • v. Wash cells by adding 1-2 mL of buffer and centrifuge at 300×g for 10 minutes. Aspirate supernatant completely. Resuspend cells in 500 μL of buffer.
      • vi. Place an MS column (Miltenyi, Germany) in the magnetic field of a OctoMACS column stand Separator. Prepare column by rinsing with 500 μL of buffer:
      • vii. Apply cell suspension onto the column. Collect unlabeled cells that pass through and wash column with 500 μL of buffer. Collect total effluent; this is the unlabeled cell fraction. Perform washing steps by adding buffer three times. Only add new buffer when the column reservoir is empty.
      • viii. Remove column from the separator and place it on a suitable collection tube.
      • ix. Pipette 1 mL of buffer onto the column.
      • x. Immediately flush out the magnetically labeled cells by firmly pushing the plunger into the column.
      • xi. Centrifuge tubes 5 min at 500 g, remove supernatant. The final volume of app. 20 μl containing collected CD8+ cells and their associated Detection Molecules are store at −80 C for later analysis.
  • 8. Identification of enriched detection molecule: Separated cells and their associated Detection Molecules are analyzed by PCR amplification of the attached labels followed by sequencing of the PCR products to reveal the identity of isolated Detection Molecules and thus the identity of those antigens for which specific T cells were present in the sample. The identification is done as for e.g. example 6.

Example 123

This is an example where the samples are PBMC's prepared as three buffy coats (BC's), the Linker is PE and streptavidin conjugated dextran, and the Binding Molecules are biotinylated peptide-MHC (pMHC) complexes. The Labels are synthetic oligonucleotides modified with a terminal biotin capture-tag.

In this example, cells and their bound Detection Molecules are separated, by centrifugation, from the supernatant containing Detection Molecules not bound to cells. The DNA oligonucleotide Labels on Detection Molecules associated with captured cells are subjected to PCR amplification (as example 3) and the PCR product is analyzed as a read of the oligonucleotide label associated with the detection molecules bound to the isolated cells thus revealing the identity of detection molecules bound to the T cells present in the sample (as example 3).

• • 1. Sample preparation. The samples are PBMC's from three donor materials prepared as described in example 3.
  • 2. Linker preparation: The Linker is PE and streptavidin conjugated dextran (Dextramer from Immudex) which is prepared as in example 1.
  • 3. Binding molecules preparation: Binding Molecules are biotinylated pMHC complexes with peptide/HLA combination as described in example 3.
  • 4. Label preparation: Labels are biotin modified DNA oligonucleotides as described in example 3.
  • 5. Detection molecules preparation: Detection Molecules are prepared by combining 110 aliquots of Linker with individual Labels followed by adding pMHC Binding Molecules as described in Example 3.
  • 6. Incubation of sample and detection molecules: PBMC's are mixed with the 110 member library of Detection Molecules as described in example 3.
  • 7. Enrichment of detection molecules with desired characteristics
    
    • b. Apply: Detection Molecules are isolated by centrifugation-separation of cells and their bound Detection Molecules from the supernatant containing Detection Molecules not bound to cells. Briefly;
      
      • i. Centrifuge cell suspensions at 300×g for 10 minutes. Aspirate supernatant completely.
      • ii. Wash cells twice by adding 2 mL of buffer (phosphate-buffered saline (PBS), pH 7.2, 0.5% bovine serum albumin (BSA), and 2 mM EDTA) and centrifuge at 300×g for 10 minutes.
      • iii. Aspirate supernatant completely. The final volume of app. 20 μl containing collected cells and their associated Detection Molecules are store at −80C for later analysis.
  • 8. Identification of enriched Detection Molecule: Separated cells and their associated Detection Molecules are analyzed by PCR amplification of the attached labels followed by sequencing of the PCR products to reveal the identity of isolated Detection Molecules and thus the identity of those antigens for which specific T cells were present in the sample. The identification is done as for example 3.

Example 124

This is an example where the samples are PBMC's prepared as three buffy coats (BC's), the Linker is PE and streptavidin conjugated dextran, and the Binding Molecules are biotinylated peptide-MHC (pMHC) complexes. The Labels are synthetic oligonucleotides modified with a terminal biotin capture-tag.

In this example, INFγ producing cells and their bound Detection Molecules are separated from Detection Molecules not bound to INFγ producing cells by magnetic labeling and capture of INFγ producing cells using the MicroBead based INFγ Secretion Assay (INFγ Secretion Assay, #130-054-201, Miltenyi, Germany). Magnetic bead-isolated INFg producing cells are subjected to PCR amplification of associated DNA oligonucleotide Label (as described in example 3) and the PCR product is analyzed as a read of the oligonucleotide label associated with the detection molecules bound to the isolated cells thus revealing the identity of detection molecules bound to the INFγ producing cells present in the sample (as example 3).

• • 1. Sample preparation. The samples are PBMC's from three donor materials prepared as described in example 3.
  • 2. Linker preparation: The Linker is PE and streptavidin conjugated dextran (Dextramer from Immudex) which is prepared as in example 1.
  • 3. Binding molecules preparation: Binding Molecules are biotinylated pMHC complexes with peptide/HLA combination as described in example 3.
  • 4. Label preparation: Labels are biotin modified DNA oligonucleotides as described in example 3.
  • 5. Detection molecules preparation: Detection Molecules are prepared by combining 110 aliquots of Linker with individual Labels followed by adding pMHC Binding Molecules as described in Example 3.
  • 6. Incubation of sample and detection molecules: PBMC's are mixed with the 110 member library of Detection Molecules as described in example 3.
  • 7. Enrichment of detection molecules with desired characteristics
    
    • i. Apply: In this example Detection Molecules are isolated by capturing INF γ producing cells using anti INF γ catch antibody in combination with anti INF γ detection antibody. All reagents and procedures as described by Miltenyi (INF γ Secretion Assay, #130-054-201, Miltenyi, Germany). Finally INFγ producing cells are captured using anti PE Microbeads.
    • ii. Centrifuge tubes 5 min at 500 g, remove supernatant. The final volume of app. 20 μl containing collected INFγ producing cells and their associated Detection Molecules are store at −80 C for later analysis.
  • 8. Identification of enriched detection molecule: Separated cells and their associated Detection Molecules are analyzed by PCR amplification of the attached labels followed by sequencing of the PCR products to reveal the identity of isolated Detection Molecules and thus the identity of those antigens for which specific T cells were present in the sample. The identification is done as for example 3.

Items Set #1

• 1. A method comprising the following steps:
  
  • a. Combining at least one cell with at least one detection molecule, where the detection molecule comprises a binding molecule (BM), a linker (Li), and a label (La);
  • b. Allowing the detection molecules to recognize and bind cells through their binding molecule entity;
  • c. Detecting or isolating pairs of cell-detection molecule complexes formed in step (b);
  • d. Identifying detection molecules capable of binding to a cell in step (b).
• 2. The method of item 1 where the binding molecule (BM) is a peptide-MHC complex, an antibody or an oligonucleotide.
• 3. The method of item 1 or 2 where the label (La) is an antibody, a nucleic acid, a particle comprising an electronic or electromagnetic signal, or a particle comprising a radio signal.
• 4. The method of any of items 1-3 where the linker (Li) is a streptavidin, polysaccharide, dextran, peptide, or carbon-based polymer.
• 5. The method of any of items 1-4 where step c is carried out by immobilization of the cell-detection molecule pairs
• 6. The method of item 5 where said immobilization is by precipitating cells by centrifugation, immunoprecipitation of the cells optionally involving centrifugation, or any other means that precipitates the cells, leading to co-precipitation of detection molecules bound to cells.
• 7. The method of item 6 where said immobilization is by binding one or more cells to a bead, particle or surface, or any other means that immobilizes said one or more cells, leading to co-immobilization of the detection molecules bound to said one or more cells.
• 8. The method of any of items 5-7 where said immobilization involves the use of an antibody or other molecule, capable of specifically binding a subset of cells
• 9. The method of item 8 where said antibody or other molecule specifically recognizes the T cell receptor (TCR) or the CD4 or CD8 proteins of T cells.
• 10. The method of any of the preceding items where a label uniquely identifies individual detection molecules or identifies specific subsets of detection molecules
• 11. The method of any of the preceding items where the Label is an oligonucleotide.
• 12. The method of any of the preceding items where the binding molecule is a pMHC complex, an antibody or an oligonucleotide aptamer.
• 13. The method of any of the preceding items where the linker is a dextran molecule, polysaccharide, oligonucleotide, streptavidin, peptide, carbon-based molecule, carbohydrate or an organic molecule.
• 14. A multimeric major histocompatibility complex (MHC) comprising
  
  • a. two or more MHC's linked by a backbone molecule; and
  • b. at least one nucleic acid molecule linked to said backbone, wherein said nucleic acid molecule comprises a central stretch of nucleic acids (barcode region) designed to be amplified by e.g. PCR.
• 15. The multimeric major histocompatibility complex according to item 14, wherein the backbone molecule is selected from the group consisting of polysaccharides, such as glucans such as dextran, a streptavidin or a streptavidin multimer.
• 16. The multimeric major histocompatibility complex according to item 14 or 15, wherein the MHC's are coupled to the backbone through a streptavidin-biotin binding, streptavidin-avidin.
• 17. The multimeric major histocompatibility complex according to any of the preceding items, wherein the MHC's are linked to the backbone via the MHC heavy chain.
• 18. The multimeric major histocompatibility complex (MHC) according to any of the preceding items, wherein the MHC is artificially assembled.
• 19. The multimeric major histocompatibility complex (MHC) according to any of the preceding items, composed of at least four MHC's, such as at least eight, such as at least ten, 2-30, 2-20, such as 2-10 or such as 4-10 MHC's.
• 20. The multimeric major histocompatibility complex (MHC) according to any of the preceding items, wherein the at least one nucleic acid molecule is composed of at least a 5′ first primer region, a central region (barcode region), and a 3′ second primer region.
• 21. The multimeric major histocompatibility complex (MHC) according to any of the preceding items, wherein the at least one nucleic acid molecule has a length in the range 20-100 nucleotides, such as 30-100, such as 30-80, such as 30-50 nucleotides.
• 22. The multimeric major histocompatibility complex (MHC) according to any of the preceding items, wherein the at least one nucleic acid molecule is linked to said backbone via a streptavidin-biotin binding and/or streptavidin-avidin binding.
• 23. The multimeric major histocompatibility complex (MHC) according to any of the preceding items, wherein the at least one nucleic acid molecule comprises or consists of DNA, RNA, and/or artificial nucleotides such as PLA or LNA.
• 24. The multimeric major histocompatibility complex (MHC) according to any of the preceding items, wherein the MHC is selected from the group consisting of class I MHC, a class II MHC, a CD1, or a MHC-like molecule.
• 25. The multimeric major histocompatibility complex (MHC) according to any of the preceding items, wherein the backbone further comprises one or more linked fluorescent labels.
• 26. A composition comprising a subset of multimeric major histocompatibility complexes (MHC's) according to any of items 14-25, wherein each set of MHC's has a different peptide decisive for T cell recognition and a unique “barcode” region in the DNA molecule.
• 27. The composition according to item 26, wherein the primer regions in the DNA molecule are identical for each set of MHC's.
• 28. A) The composition according to item 26 or 27, comprising at least 10 different sets of MHC's such as at least 100, such as at least 500, at least 1000, at least 5000, such as in the range 10-50000, such as 10-1000 or such as 50-500 sets of MHC's.
• 28. B) A kit of parts comprising
  
  • a. a composition according to any of items 26 to 28; and
  • b. one or more sets of primers for amplifying the nucleic acid molecules.
• 29. A method for detecting antigen responsive cells in a sample comprising:
• i) providing one or more multimeric major histocompatibility complexes (MHC's) according to any of items 1-12 or a composition according to any of items 14-16; ii) contacting said multimeric MHC's with said sample; and detecting binding of the multimeric MHC's to said antigen responsive cells, thereby detecting cells responsive to an antigen present in a set of MHC's, wherein said binding is detected by amplifying the barcode region of said nucleic acid molecule linked to the one or more MHC's.
• 30. The method according to item 29, wherein unbound MHC's are removed before amplification, e.g. by washing and/or spinning.
• 31. The method according to item 29 or 30, wherein the sample is a blood sample, such as an peripheral blood sample, a blood derived sample, a tissue biopsy or another body fluid, such as spinal fluid, or saliva.
• 32. The method according to any of items 29-31, wherein said sample has been obtained from a mammal, such as a human, mouse, pigs, and/or horses.
• 33. The method according to any of item 30-32, wherein the method further comprises cell sorting by e.g. flow cytometry such as FACS.
• 34. The method according to any of items 29-33, wherein said binding detection includes comparing measured values to a reference level, e.g. a negative control and/or total level of response.
• 35. The method according to any of item 29-34, wherein said amplification is PCR such as QPCR.
• 36. The method according to any of items 29-35, wherein the detection of barcode regions includes sequencing of said region such as deep sequencing or next generation sequencing.
• 37. Use of a multimeric major histocompatibility complex (MHC) according to any of items 14-25 or a composition according to any of items 26-29 for the detecting of antigen responsive cells in a sample.
• 38. Use of a multimeric major histocompatibility complex (MHC) according to any of items 14-25 or a composition according to any of items 26-29 in the diagnosis of diseases or conditions, preferably cancer and/or infectious diseases.
• 39. Use of a multimeric major histocompatibility complex (MHC) according to any of items 14-25 or a composition according to any of items 26-29 in the development of immune-therapeutics.
• 40. Use of a multimeric major histocompatibility complex (MHC) according to any of items 14-25 or a composition according to any of items 26-29 in the development of vaccines.
• 41. Use of a multimeric major histocompatibility complex (MHC) according to any of items 14-25 or a composition according to any of items 26-29 for the identification of epitopes.
  References
  
• 1. Altman J D, Moss P A, Goulder P J, Barouch D H, McHeyzer-Williams M G, Bell J I, et al. Phenotypic analysis of antigen-specific T lymphocytes. Science. 1996; 274:94-6.
• 2. Davis M M, Bjorkman P J. T-cell antigen receptor genes and T-cell recognition. Nature. 1988; 334:395-402.
• 3. Robins H S, Campregher P V, Srivastava S K, Wacher A, Turtle C J, Kahsai O, et al. Comprehensive assessment of T-cell receptor beta-chain diversity in alphabeta T cells. Blood. 2009; 114:4099-107.
• 4. Hadrup S R, Bakker A H, Shu C J, Andersen R S, van V J, Hombrink P, et al. Parallel detection of antigen-specific T-cell responses by multidimensional encoding of MHC multimers. Nature Methods. 2009; 6:520-6.
• 5. Andersen R S, Kvistborg P, March T F, Pedersen N W, Lyngaa R, Bakker A H, et al. Parallel detection of antigen-specific T-cell responses by combinatorial encoding of MHC multimers. NatProtoc. 2012
• 6. Newell E W, Sigal N, Nair N, Kidd B a, Greenberg H B, Davis M M. Combinatorial tetramer staining and mass cytometry analysis facilitate T-cell epitope mapping and characterization. Nat Biotechnol. 2013; 1-9.
• 7. Soen Y, Chen D S, Kraft D L, Davis M M, Brown P O. Detection and characterization of cellular immune responses using peptide-MHC microarrays. PLoSBiol. 2003; 1:429-38.
• 8. Stone J D, Demkowicz Jr. W E, Stern L J. HLA-restricted epitope identification and detection of functional T cell responses by using MHC-peptide and costimulatory microarrays. Proc Natl Acad Sci USA. 2005; 102:3744-9.
• 9. Newell E W, Davis M M. Beyond model antigens: high-dimensional methods for the analysis of antigen-specific T cells. Nat Biotechnol. 2014; 32.
• 10. Dössinger G, Bunse M, Bet J, Albrecht J, Paszkiewicz P J, Weiβbrich B, et al. MHC multimer-guided and cell culture-independent isolation of functional T cell receptors from single cells facilitates TCR identification for immunotherapy. PLoS One. 2013; 8:e61384.
• 11. Cha E, Klinger M, Hou Y, Cummings C, Ribas A, Faham M, et al. Improved Survival with T Cell Clonotype Stability After Anti-CTLA-4 Treatment in Cancer Patients. Sci Transl Med. 2014; 6:238ra70.
• 12. Robert L, Tsoi J, Wang X, Emerson R O, Homet B, Chodon T, et al. CTLA4 blockade broadens the peripheral T cell receptor repertoire. Clin Cancer Res. 2014
• 13. Morgan R A, Dudley M E, Wunderlich J R, Hughes M S, Yang J C, Sherry R M, et al. Cancer Regression in Patients After Transfer of Genetically Engineered Lymphocytes. Science. 2006.
• 14. Pannetier C, Even J, Kourilsky P. T-cell repertoire diversity and clonal expansions in normal and clinical samples. ImmunolToday. 1995; 16:176-81.
• 15. Cameron B J, Gerry A B, Dukes J, Harper J V, Kannan V, Bianchi F C, et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Sci Transl Med. 2013; 5:197ra103.
• 16. Linette G P, Stadtmauer E a, Maus M V, Rapoport A P, Levine B L, Emery L, et al. Cardiovascular toxicity and titin cross-reactivity of affinity-enhanced T cells in myeloma and melanoma. Blood. 2013; 122:863-71.

Items Set #2

• 1. A detection molecule comprising
  
  • a. at least one binding molecule (BM),
  • b. at least one linker (Li), and
  • c. at least one label (La).
• 2. A cell-detection molecule complex comprising
  
  • a. At least one detection molecule comprising a binding molecule (BM), a linker (Li) and a label (La), and
  • b. at least one cell.
• 3. A composition comprising two or more different detection molecules, or two or more sets of different detection molecules, each detection molecule comprising at least one binding molecule (BM), at least one linker (Li) and at least one label (La),
  
  • wherein each of the two or more detection molecules, or two or more sets of detection molecules, comprises a label which is unique to and specific for the binding molecule of each of said two or more different detection molecules.
• 4. The composition according to item 3, said composition comprising 2 to 1,000,000 different detection molecules, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 different detection molecules or sets of different detection molecules; for example 1-3, 3-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-175, 175-200, 200-250, 250-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-3000, 3000-4000, 4000-5000, 5000-7500, 7500-10,000, 10,000-20,000, 20,000-50,000, 50,000-100,000, 100,000-200,000, 200,000-500,000, 500,000-1,000,000 different detection molecules, or sets of different detection molecules.
• 5. The detection molecule according to any of the preceding items, wherein said binding molecule is capable of specifically associating with, recognizing and/or binding to a structure belonging to or associated with an entity in a sample, such as a target structure.
• 6. The detection molecule according to any of the preceding items, wherein said binding molecule associates with, recognizes and/or binds to a marker molecule specific for a given cell or cell type.
• 7. The detection molecule according to any of the preceding items, wherein said binding molecule is capable of specifically associating with, recognizing and/or binding to a specific cell type, such as selected from the group consisting of immune cells, lymphocytes, monocytes, dendritic cells, T-cells, B-cells, NK cells, CD4+ T cells, CD8+ T cells, αβ T cells, invariant γδ T cells, antigen-specific T-cells, cells comprising TCRs, cells comprising BCRs, a specific cancer cell
• 8. The detection molecule according to any of the preceding items, wherein said binding molecule is capable of specifically associating with, recognizing and/or binding to a target specifically associated with an organ selected from the group consisting of lymph nodes, kidney, liver, skin, brain, heart, muscles, bone marrow, skin, skeleton, lungs, the respiratory tract, spleen, thymus, pancreas, exocrine glands, bladder, endocrine glands, reproduction organs including the phallopian tubes, eye, ear, vascular system, the gastroinstestinal tract including small intestines, colon, rectum, canalis analis and prostate gland.
• 9. The detection molecule according to any of the preceding items, wherein said binding molecule is peptide-based or protein-based.
• 10. The detection molecule according to any of the preceding items, wherein said binding molecule is an anti-target molecule capable of specifically associating with, recognizing and/or binding to a predetermined target structure.
• 11. The detection molecule according to any of the preceding items, wherein said binding molecule is an anti-target-molecule.
• 12. The detection molecule according to any of the preceding items, wherein said binding molecule is selected from the group consisting of an antibody, an antibody mimetic, an antibody-like molecule, a peptide, an oligonucleotide, a peptide aptamer, a nucleic acid aptamer, a DNA aptamer, an RNA aptamer, an XNA aptamer, a ligand, a natural ligand, a variant or fragment of a natural ligands, a synthetic ligand and a small organic molecule.
• 13. The detection molecule according to any of the preceding items, wherein said antibody mimetic is selected from the group consisting of affibody molecules, affilinns, affimers, affitins, alphabodies, anticalins, avimers, DARPins, fynomers, Kunitz domain peptides and monobodies.
• 14. The detection molecule according to any of the preceding items, wherein said binding molecule is an antibody selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a bi-specific antibody, an antibody-like molecule, a Fc-molecule, a KIR-molecule, a ScFv and a Fab.
• 15. The detection molecule according to any of the preceding items, wherein said binding molecule is a peptide of 1-100 amino acid residues without tertiary structure.
• 16. The detection molecule according to any of the preceding items, wherein said binding molecule is a MHC molecule or MHC complex.
• 17. The detection molecule according to any of the preceding items, wherein said binding molecule is a MHC class I complex.
• 18. The detection molecule according to any of the preceding items, wherein said binding molecule is a MHC class II complex.
• 19. The detection molecule according to any of the preceding items, wherein said binding molecule is a MHC-like molecule.
• 20. The detection molecule according to any of the preceding items, wherein said binding molecule is CD1, wherein said CD1 is selected from the group consisting of CD1 CD1a, CD1b, CD1c, CD1d and CD1e.
• 21. The detection molecule according to any of the preceding items, wherein said binding molecule is a MHC Class I-like proteins; including MIC A, MIC B, CD1d, HLA E, HLA F, HLA G, HLA H, ULBP-1, ULBP-2, and ULBP-3.
• 22. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a cell-surface target.
• 23. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is an intracellular target.
• 24. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a receptor, such as a cell-surface receptor, an intracellular receptor, a soluble receptor or an extracellular receptor.
• 25. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a T-cell receptor.
• 26. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a B-cell receptor.
• 27. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is CD4 of T cells.
• 28. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is CD8 of T cells.
• 29. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is CD20 of B cells.
• 30. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is selected from the group consisting of cancer cell markers, developmental markers, cell cycle markers, proliferation markers, activation markers, hormones, hormone receptors, intracellular markers, cluster of differentiation (CD), cell surface markers, cytokines and cytokine receptors.
• 31. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is selected from the group consisting of CD2, CD3, CD4, CD5, CD8, CD9, CD27, CD28, CD30, CD69, CD134 (OX40), CD137 (4-1BB), CD147, CDw150 (SLAM), CD152 (CTLA-4), CD153 (CD30L), CD40L (CD154), NKG2D, ICOS, HVEM, HLA Class II, PD-1, Fas (CD95), FasL, CD40, CD48, CD58, CD70, CD72, B7.1 (CD80), B7.2 (CD86), B7RP-1, B7-H3, PD-L1, PD-L2, CD134L, CD137L, ICOSL, LIGHT CD16, NKp30, NKp44, NKp46, NKp80, 2B4, KIR, LIR, CD94/NKG2A, CD94/NKG2C, LFA-1, CD11a/18, CD54 (ICAM-1), CD106 (VCAM), CD49a,b,c,d,e,f/CD29 (VLA-4), CD11a, CD14, CD15, CD19, CD25, CD30, CD37, CD49a, CD49e, CD56, CD27, CD28, CD45, CD45RA, CD45RO, CD45RB, CCR7, CCRS, CD62L, CD75, CD94, CD99, CD107b, CD109, CD152, CD153, CD154, CD160, CD161, CD178, CDw197, CDw217, Cd229, CD245, CD247 and Foxp3.
• 32. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a cytokine selected from the group consisting of TNFα, TNFβ, TNF, IFNα, IFNβ, IFNγ, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-10-20, IL-20-30, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IL-36, IL-37, IL-38, IL-39, IL-40, NFκB, chemokines including CC chemokines (CCL1 to CCL-28), CXC chemokines (CXCL1 to CXCL17) C chemokines (XCL-1 and -2) and CX3X chemokines (CX3CL1).
• 33. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a cancer cell marker selected from the group consisting of HER2, CA125, Tyrosinase, Melanoma-associated antigen (MAGE), abnormal products of Ras or p53, Carcinoembryonic antigen, Muc-1, Epithelial tumor antigen, Carbonic Anhydrase, VEGFR, EGFR, TRAIL and RAN KL.
• 34. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a stem cell marker selected from the group consisting of Stro-1, CD146, CD105, CD44, c-kit, Oct4, Sox-2, Klf4, EphB, Nestin and TWIST-1.
• 35. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a developmental marker selected from the group consisting of Nanog, Oct4, Sox2, TEKT-1, NANOS, c-kit, Sox9, Notch, Msx1, Msx2 and Col1.
• 36. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a proliferation marker selected from the group consisting of CyclinA, CyclinB, PCNA, PC10, p53, Mdm2, Cyclin D, Cyclin E, Rb, ARF and HDM2.
• 37. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is an activation marker selected from the group consisting of CD28, Tbet, Eomes, Blimp, Bcl-6, CD27, MHC-II, TNF, IFN, Fizz1, ARG1 and CCL22R.
• 38. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is an hormone selected from the group consisting of estrogen, PTH, ADH, T3, ANP, Epinephrine, Norepinephrine, Cortisol, Corticosterone, Aldosterone, Progestin, EPO, Leptin, Insulin, Glucagon, T4, ACTH, FSH, oxytocin and Calcitriol.
• 39. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is an hormone receptor selected from the group consisting of EstrogenR (ER), GLP-1R, Thyroid receptor, Leptin receptor, Epinephrine receptor, Insulin receptor and Glucagon receptor.
• 40. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is a cluster of differentiation (CD) molecule selected from the group consisting of CD1-10, CD10-20, CD20-30, CD30-40, CD40-50, CD50-100, CD100-200, CD200-300 and CD300-364.
• 41. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is an intracellular marker selected from the group consisting of Cyclins, Cytokines and organelle markers (for example Apg12, Syntaxin, PAF-46, Histones, Early endosome antigen, clathrin, tubulins, PAF49, FTCD).
• 42. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is selected from the group consisting of CD1, CD1a, CD1b, CD1c, CD1d, and MR1.
• 43. The detection molecule according to any of the preceding items, wherein the target of the binding molecule is selected from the group consisting of targets included in Table 4 of the examples.
• 44. The detection molecule according to any of the preceding items, wherein said binding molecule is a surface-molecule receptor to a cytokine receptor selected from the group consisting of interleukins and TNF-like molecules.
• 45. The detection molecule according to any of the preceding items, wherein said label is any molecule, atom or signal the identity of which can be determined.
• 46. The detection molecule according to any of the preceding items, wherein said label is unique to and/or specifies the binding molecule or a group of binding molecules.
• 47. The detection molecule according to any of the preceding items, wherein said detection molecule comprises one label.
• 48. The detection molecule according to any of the preceding items, wherein said detection molecule comprises more than one label.
• 49. The detection molecule according to any of the preceding items, wherein said detection molecule comprises two or more labels, such as 3 labels, 4 labels, 5 labels, 6 labels, 7 labels, 8 labels, 9 labels, 10 labels, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-25, 25-30, 30-40, 40-50, 50-75, 75-100 labels.
• 50. The detection molecule according to any of the preceding items, wherein said detection molecule comprises two or more labels and each of said labels are identical to each other.
• 51. The detection molecule according to any of the preceding items, wherein said detection molecule comprises two or more labels and at least two of said labels are different.
• 52. The detection molecule according to any of the preceding items, wherein said label is attached to the linker of the detection molecule.
• 53. The detection molecule according to any of the preceding items, wherein said label is attached to the binding molecule of the detection molecule.
• 54. The detection molecule according to any of the preceding items, wherein said label comprises a connector molecule (attachment molecule) for attachment to the detection molecule.
• 55. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label.
• 56. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label selected from the group consisting of a DNA label, an RNA label, and an artificial nucleic acid label.
• 57. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label comprising one or more nucleotides individually derived from one or more of DNA, RNA, and an artificial nucleic acid.
• 58. The detection molecule according to any of the preceding items, wherein said artificial nucleic acid is selected from the group consisting of XNA, LNA, PNA, GNA, TNA, HNA, CeNA, and morpholino-nucleic acids.
• 59. The detection molecule according to any of the preceding items, wherein said label is a DNA label.
• 60. The detection molecule according to any of the preceding items, wherein said nucleic acid label comprises 1 to 1,000,000 nucleic acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleic acids; for example 1-3, 3-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-175, 175-200, 200-250, 250-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, 2000-3000, 3000-4000, 4000-5000, 5000-7500, 7500-10,000, 10,000-100,000, 100,000-1,000,000 nucleic acids.
• 61. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label comprising one or more of
  
  • a. barcode region,
  • b. 5′ first primer region (forward)
  • c. 3′ second primer region (reverse),
  • d. random nucleotide region,
  • e. connector molecule
  • f. stability-increasing components
  • g. short nucleotide linkers in between any of the above-mentioned components
  • h. adaptors for sequencing
  • i. annealing region
• 62. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label comprising at least a barcode region.
• 63. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label comprising at least a barcode region, wherein said barcode region comprises a sequence of consecutive nucleic acids.
• 64. The detection molecule according to any of the preceding items, wherein the barcode region of said nucleic acid comprises 1-3, 3-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-175, 175-200, 200-250, 250-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000 nucleic acids.
• 65. The detection molecule according to any of the preceding items, wherein said barcode region comprises or consists of 5-10, 10-15, 15-20, 20-25, 25-30, 30-40, 40-45, 45-50 nucleic acids.
• 66. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label comprising at least a 3′ primer region, a barcode region, and a 5′ primer region.
• 67. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label comprising at least a 3′ primer region, a barcode region, and a 5′ primer region, wherein said barcode region is designed to be amplified by e.g. PCR and identified by e.g. sequencing.
• 68. The detection molecule according to any of the preceding items, wherein the primer regions of said nucleic acid label are identical for subsets of detection molecules comprising different labels.
• 69. The detection molecule according to any of the preceding items, wherein said label is a nucleic acid label comprising a connector molecule which is able to interact with a component on the linker and/or binding molecule of the detection molecule.
• 70. The detection molecule according to any of the preceding items, wherein said nucleic acid label comprises a connector molecule which is biotin.
• 71. The detection molecule according to any of the preceding items, wherein said nucleic acid label comprises a random nucleotide region comprising 3-20 nucleotides, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nt.
• 72. The detection molecule according to any of the preceding items, wherein said nucleic acid label comprises one or more stability-increasing components, such as HEG or TEG.
• 73. The detection molecule according to any of the preceding items, wherein a sample identifying sequence is attached to the nucleic acid label such as by attachment to one of the primers capable of binding to the primer regions of the nucleic acid label.
• 74. The detection molecule according to any of the preceding items, wherein said label is a peptide label.
• 75. The detection molecule according to any of the preceding items, wherein said peptide label comprises a stretch of consecutive amino acid residues (coding region).
• 76. The detection molecule according to any of the preceding items, wherein said peptide label comprises a stretch of consecutive amino acid residues (coding region) and a protease cleavage site.
• 77. The detection molecule according to any of the preceding items, wherein said peptide label comprises a stretch of consecutive amino acid residues (coding region) and a protease cleavage site.
• 78. The detection molecule according to any of the preceding items, wherein said protease cleavage site in said peptide label is located proximal to the linker that connects the label to the binding molecule.
• 79. The detection molecule according to any of the preceding items, wherein said peptide label comprising a protease cleavage site allows for cleavage of the stretch of consecutive amino acid residues (coding region) and release thereof from the detection molecule.
• 80. The detection molecule according to any of the preceding items, wherein said label is a peptide label comprising 2 or more consecutive amino acids, such as 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, 22-23, 23-24, 24-25, 25-26, 26-27, 27-28, 28-29, 29-30, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 36-37, 37-38, 38-39, 39-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, 90-95, 95-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170,170-180, 180-190, 190-200, 200-225, 225-250, 250-275, 275-300, 300-350, 350-400, 400-450, 450-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1500, 1500-2000, or more than 2000, consecutive amino acids.
• 81. The detection molecule according to any of the preceding items, wherein said peptide label comprises proteinogenic and/or non-proteinogenic amino acids.
• 82. The detection molecule according to any of the preceding items, wherein said label is a fluorescent label (fluorophore label).
• 83. The detection molecule according to any of the preceding items, wherein said label is a fluorescent label selected from the group consisting of fluorescein isothiocyanate (FITC), fluorescein (Flu) derivates, rhodamine, tetramethylrhodamine, phycoerythrin, R-phycoerythrin (RPE), allophycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde, fluorescamine; 2-(4′-maleimidylanilino)naphthalene-6-sulfonic acid; 5-((((2-iodoacetyl)amino)ethyl)amino) naphthalene-1-sulfonic acid; Pyrene-1-butanoic acid; AlexaFluor 350 (7-amino-6-sulfonic acid-4-methyl coumarin-3-acetic acid); AMCA (7-amino-4-methyl coumarin-3-acetic acid); 7-hydroxy-4-methyl coumarin-3-acetic acid; Marina Blue (6,8-difluoro-7-hydroxy-4-methyl coumarin-3-acetic acid); 7-dimethylamino-coumarin-4-acetic acid; Fluorescamin-N-butyl amine adduct; 7-hydroxy-coumarine-3-carboxylic acid; CascadeBlue (pyrene-trisulphonic acid acetyl azide); Cascade Yellow; Pacific Blue (6,8 difluoro-7-hydroxy coumarin-3-carboxylic acid); 7-diethylamino-coumarin-3-carboxylic acid; N-(((4-azidobenzoyl)amino)ethyl)-4-amino-3,6-disulfo-1,8-naphthalimide; Alexa Fluor 430; 3-perylenedodecanoic acid; 8-hydroxypyrene-1,3,6-trisulfonic acid; 12-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)dodecanoic acid; N,N′-dimethyl-N-(iodoacetyl)-N′-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)ethylenediamine; Oregon Green 488 (difluoro carboxy fluorescein); 5-iodoacetamidofluorescein; propidium iodide-DNA adduct; Carboxy fluorescein; 5- or 6-carboxyfluorescein; 6-(fluorescein)-5-(and 6)-carboxamido hexanoic acid; Texas Red, Princeton Red, Green fluorescent protein (GFP) and analogues thereof; PerCP; AlexaFluor® (AF), AF405, AF488,AF500, AF514, AF532, AF546, AF555, AF568, AF594, AF610, AF633, AF635, AF647, AF680, AF700, AF710, AF750, AF800; Quantum Dot based dyes, Qdot®525, Qdot®565, Qdot®585, Qdot®605, Qdot®655, Qdot®705, Qdot®800; DyLight™ Dyes (Pierce) (DL); DL549, DL649, DL680, DL800; Cy-Dyes, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7; Fluorescent Proteins, RPE, PerCp, APC, Green fluorescent proteins; GFP and GFP derivated mutant proteins; BFP, CFP, YFP, DsRed, T1, Dimer2, mRFP1,MBanana, mOrange, dTomato, tdTomato, mTangerine, mStrawberry, mCherry; Tandem dyes, RPE-Cy5, RPE-Cy5.5, RPE-Cy7, RPE-AlexaFluor® tandem conjugates; RPE-Alexa610, RPE-TxRed, APC-Aleca600, APC-Alexa610, APC-Alexa750, APC-Cy5 and APC-Cy5.5.
• 84. The detection molecule according to any of the preceding items, wherein said label is a phosphorescence label.
• 85. The detection molecule according to any of the preceding items, wherein said label is a bioluminescence label or chemoluminescence label.
• 86. The detection molecule according to any of the preceding items, wherein said chemoluminescence label is selected from luminol, isoluminol, acridinium esters, acridinium salt, theromatic acridinium ester, 1,2-dioxetanes, oxalate ester, imidazole and pyridopyridazines.
• 87. The detection molecule according to any of the preceding items, wherein said bioluminescence label is selected from the group luciferin, luciferase and aequorin.
• 88. The detection molecule according to any of the preceding items, wherein said label is an enzymatic label.
• 89. The detection molecule according to any of the preceding items, wherein said label is an enzymatic label, wherein the enzyme catalyze a reaction between chemicals in the near environment of the labeling molecules, which results in one or more of producing a light signal (chemi-luminescence) and precipitation of chromophor dyes.
• 90. The detection molecule according to any of the preceding items, wherein said label is an enzymatic label selected from peroxidases, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
• 91. The detection molecule according to any of the preceding items, wherein said label is an enzymatic label selected from horse radish peroxidase (HRP), alkaline phosphatase (AP), beta-galactosidase (GAL), glucose-6-phosphate dehydrogenase, beta-N-acetylglucosaminidase, β-glucuronidase, invertase, Xanthine Oxidase, firefly luciferase and glucose oxidase (GO).
• 92. The detection molecule according to any of the preceding items, wherein said label is capable of reflection of light, such as gold, plastic, glass, polystyrene and pollen.
• 93. The detection molecule according to any of the preceding items, wherein said label is capable of capable of absorption of light, such as a chromophore or a dye.
• 94. The detection molecule according to any of the preceding items, wherein said label is capable of emission of light after excitation, such as a fluorochrome.
• 95. The detection molecule according to any of the preceding items, wherein said label is a nanoparticle label.
• 96. The detection molecule according to any of the preceding items, wherein said label is an element.
• 97. The detection molecule according to any of the preceding items, wherein said label is selected from the group consisting of heavy metal labels, isotope labels, radiolabels, radionuclide, stable isotopes, chains of isotopes and single atoms.
• 98. The detection molecule according to any of the preceding items, wherein said label is a single atom selected from the group consisting of zinc (Zn), iron (Fe), magnesium (Mg), any of the lanthanides (Ln) including La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb and Lu; scandium (Sc) and yttrium (Y).
• 99. The detection molecule according to any of the preceding items, wherein said radioactivity labels comprises incorporated isotopes of iodide, cobalt, selenium, tritium and/or phosphor.
• 100. The detection molecule according to any of the preceding items, wherein said label is a DNA fluorescing stain, such as Propidium iodide, Hoechst stain, DAPI, DraQ5 or Acridine orange.
• 101. The detection molecule according to any of the preceding items, wherein said label comprises a nucleic acid label and at least a second label.
• 102. The detection molecule according to any of the preceding items, wherein said label comprises a nucleic acid label and at least a second label according to any of the preceding items.
• 103. The detection molecule according to any of the preceding items, wherein said label comprises a nucleic acid label and a fluorophore label.
• 104. The detection molecule according to any of the preceding items, wherein said label comprises one type of label.
• 105. The detection molecule according to any of the preceding items, wherein said label comprises more than one type of label, such as comprising 2 types of labels, for example comprising 3 types of labels, such as comprising 4 types of labels, for example comprising 5 types of labels.
• 106. The detection molecule according to any of the preceding items, wherein said linker is a molecular entity and/or bond that connects the binding molecule and the label.
• 107. The detection molecule according to any of the preceding items, wherein one or more of the binding molecules are covalently associated with the one or more linkers.
• 108. The detection molecule according to any of the preceding items, wherein one or more of the binding molecules are non-covalently associated with the one or more linkers.
• 109. The detection molecule according to any of the preceding items, wherein one or more labels are covalently associated with the one or more linkers.
• 110. The detection molecule according to any of the preceding items, wherein one or more of labels are non-covalently associated with the one or more linkers.
• 111. The detection molecule according to any of the preceding items, wherein the one or more labels and/or one or more binding molecules are associated with a molecule in the one or more linkers, such as a connector molecule, a sugar residue, a protein, an antibody, a DNA, an aptamer, reactive groups, nucleophilic group, electrophilic groups, radicals, or conjugated double bonds.
• 112. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises one or more multimerization domains.
• 113. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises one or more scaffolds.
• 114. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises one or more connectors.
• 115. The detection molecule according to any of the preceding items, wherein the one or more multimerization domains comprises at least one scaffold and at least one connector.
• 116. The detection molecule according to any of the preceding items, wherein the binding molecule and/or the label is attached to the linker via a streptavidin-biotin linkage.
• 117. The detection molecule according to any of the preceding items, wherein the one or more linkers comprise one or more optionally substituted organic molecules.
• 118. The detection molecule according to any of the preceding items, wherein the optionally substituted organic molecule comprises one or more functionalized cyclic structures.
• 119. The detection molecule according to any of the preceding items, wherein the one or more functionalized cyclic structures comprises one or more benzene rings.
• 120. The detection molecule according to any of the preceding items, wherein the optionally substituted organic molecule comprises a scaffold molecule comprising at least three reactive groups, or at least three sites suitable for non-covalent attachment.
• 121. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises one or more biological cells and/or cell-like structures, such as antigen presenting cells or dendritic cells.
• 122. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises one or more membranes.
• 123. The detection molecule according to any of the preceding items, wherein the one or more membranes comprises liposomes or micelles.
• 124. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises one or more polymers such as one or more synthetic polymers.
• 125. The detection molecule according to any of the preceding items, wherein reactive groups involved in forming an association between the multimerization domain and the binding molecule are located on glutamate or aspartate residues, or on a vinyl sulfone activated dextran.
• 126. The detection molecule according to any of the preceding items, wherein the one or more linker polymers are selected from the group consisting of polysaccharides.
• 127. The detection molecule according to any of the preceding items, wherein the linker comprises one or more dextran moieties.
• 128. The detection molecule according to any of the preceding items, wherein the one or more dextran moieties are covalently attached to one or more binding molecules.
• 129. The detection molecule according to any of the preceding items, wherein the one or more dextran moieties are non-covalently attached to one or more binding molecules.
• 130. The detection molecule according to any of the preceding items, wherein the one or more dextran moieties are covalently attached to one or more labels.
• 131. The detection molecule according to any of the preceding items, wherein the one or more dextran moieties are non-covalently attached to one or more labels.
• 132. The detection molecule according to any of the preceding items, wherein reactive groups of the multimerization domains include hydroxyls of polysaccharides such as dextrans
• 133. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties are modified.
• 134. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties are activated.
• 135. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties are activated by reaction of the dextran hydroxyls with divinyl sulfon.
• 136. The detection molecule according to any of the preceding items, wherein dextran is activated by a multistep reaction that results in the decoration of the dextran with maleimide groups.
• 137. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties comprises one or more amino-dextrans.
• 138. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties comprises one or more amino-dextrans modified with divinyl sulfone.
• 139. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties comprises one or more dextrans with a molecular weight of from 1,000 to 50,000, such as from 1,000 to 5,000, for example 5,000 to 10,000, such as from 10,000 to 15,000, for example 15,000 to 20,000, such as from 20,000 to 25,000, for example 25,000 to 30,000, such as from 30,000 to 35,000, for example 35,000 to 40,000, such as from 40,000 to 45,000, for example 45,000 to 50,000.
• 140. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties comprises one or more dextrans with a molecular weight of from 50,000 to 150,000, such as from 50,000 to 60,000, for example 60,000 to 70,000, such as from 70,000 to 80,000, for example 80,000 to 90,000, such as from 90,000 to 100,000, for example 100,000 to 110,000, such as from 110,000 to 120,000, for example 120,000 to 130,000, such as from 130,000 to 140,000, for example 140,000 to 150,000.
• 141. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties comprises one or more dextrans with a molecular weight of from 150,000-270,000 such as from 150,000 to 160,000, for example 160,000 to 170,000, such as from 170,000 to 180,000, for example 180,000 to 190,000, such as from 190,000 to 200,000, for example 200,000 to 210,000, such as from 210,000 to 220,000, for example 220,000 to 230,000, such as from 230,000 to 240,000, for example 240,000 to 250,000, such as from 250,000 to 260,000, for example 260,000 to 270,000, such as from 270,000 to 280,000, for example 280,000 to 290,000, such as from 290,000 to 300,000, for example 300,000 to 310,000 such as from 310,000 to 320,000, for example 320,000 to 330,000 such as from 330,000 to 340,000, for example 340,000 to 350,000 such as from 350,000 to 360,000, for example 360,000 to 370,000 such as from 370,000 to 380,000, for example 380,000 to 390,000, such as from 390,000 to 400,000.
• 142. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties are linear.
• 143. The detection molecule according to any of the preceding items, wherein the one or more linker dextran moieties are branched.
• 144. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises a carboxy methyl dextran and/or a dextran polyaldehyde and/or a carboxymethyl dextran lactone and/or a cyclodextrin.
• 145. The detection molecule according to any of the preceding items, wherein the one or more linker synthetic polymers are selected from the group consisting of PNA, polyimide and PEG.
• 146. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises one or more entities selected from the group consisting of an IgG domain, a coiled-coil polypeptide structure, a DNA duplex, a nucleic acid duplex, PNA-PNA, PNA-DNA, DNA-RNA.
• 147. The detection molecule according to any of the preceding items, wherein the one or more linkers, such as one or more multimerization domains, comprises one or more avidins, such as one or more streptavidins.
• 148. The detection molecule according to any of the preceding items, wherein the one or more streptavidins comprises one or more tetrameric streptavidin variants.
• 149. The detection molecule according to any of the preceding items, wherein the one or more streptavidins comprises one or more monomeric streptavidin variants.
• 150. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises an antibody.
• 151. The detection molecule according to any of the preceding items, wherein the linker antibody is selected from the group consisting of polyclonal antibody, monoclonal antibody, IgA, IgG, IgM, IgD, IgE, IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgM1, IgM2, humanized antibody, humanized monoclonal antibody, chimeric antibody, mouse antibody, rat antibody, rabbit antibody, human antibody, camel antibody, sheep antibody, engineered human antibody, epitope-focused antibody, agonist antibody, antagonist antibody, neutralizing antibody, naturally-occurring antibody, isolated antibody, monovalent antibody, bispecific antibody, trispecific antibody, multispecific antibody, heteroconjugate antibody, immunoconjugates, immunoliposomes, labeled antibody, antibody fragment, domain antibody, nanobody, minibody, maxibody, diabody, fusion antibody.
• 152. The detection molecule according to any of the preceding items, wherein the detection molecule comprises one or more organic molecules selected from the group consisting of small organic scaffold molecules, small organic molecules, steroids, peptides, aromatic organic molecules, monocyclic structures, functionalized or substituted benzene rings, dicyclic structures, polycyclic structures, aliphatic molecules, monocyclic molecules, dicyclic molecules, polycyclic molecules.
• 153. The detection molecule according to any of the preceding items, wherein the detection molecule comprises one or more monomeric molecules able to polymerize; one or more biological polymers such as one or more proteins; one or more small molecule scaffolds; one or more supramolecular structure(s) such as one or more nanoclusters; and/or one or more protein complexes.
• 154. The detection molecule according to any of the preceding items, wherein the linker of the detection molecule comprises one or more beads.
• 155. The detection molecule according to any of the preceding items, wherein the linker is a bead coated with streptavidin, such as streptavidin monomers or tetramers, and the one or more binding molecules are biotinylated.
• 156. The detection molecule according to any of the preceding items, wherein the linker is a bead coated with polysaccharide, such as a polysaccharide comprising dextran moieties.
• 157. The detection molecule according to any of the preceding items, wherein the one or more beads are selected from the groups consisting of beads that carry electrophilic groups e.g. divinyl sulfone activated polysaccharide, polystyrene beads that have been functionalized with tosyl-activated esters, magnetic polystyrene beads functionalized with tosyl-activated esters, and beads where binding molecules have been covalently immobilized to these by reaction of nucleophiles comprised within the binding molecules with the electrophiles of the beads.
• 158. The detection molecule according to any of the preceding items, wherein the one or more beads is selected from the groups consisting of sepharose beads, sephacryl beads, polystyrene beads, agarose beads, polysaccharide beads, polycarbamate beads and any other kind of beads that can be suspended in an aqueous buffer.
• 159. The detection molecule according to any of the preceding items, wherein the linker comprises one or more compounds selected from the group consisting of agarose, sepharose, resin beads, glass beads, pore-glass beads, glass particles coated with a hydrophobic polymer, chitosan-coated beads, SH beads, latex beads, spherical latex beads, allele-type beads, SPA bead, PEG-based resins, PEG-coated bead, PEG-encapsulated bead, polystyrene beads, magnetic polystyrene beads, glutathione agarose beads, magnetic bead, paramagnetic beads, protein A and/or protein G sepharose beads, activated carboxylic acid bead, macroscopic beads, microscopic beads, insoluble resin beads, silica-based resins, cellulosic resins, cross-linked agarose beads, polystyrene beads, cross-linked polyacrylamide resins, beads with iron cores, metal beads, dynabeads, Polymethylmethacrylate beads activated with NHS, streptavidin-agarose beads, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, nitrocellulose, polyacrylamides, gabbros, magnetite, polymers, oligomers, non-repeating moieties, polyethylene glycol (PEG), monomethoxy-PEG, mono-(C₁-C₁₀)alkoxy-PEG, aryloxy-PEG, poly-(N-vinyl pyrrolidone)PEG, tresyl monomethoxy PEG, PEG propionaldehyde, bis-succinimidyl carbonate PEG, polystyrene bead crosslinked with divinylbenzene, propylene glycol homopolymers, a polypropylene oxide/ethylene oxide co-polymer, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, dextran, aminodextran, carbohydrate-based polymers, cross-linked dextran beads, polysaccharide beads, polycarbamate beads, divinyl sulfone activated polysaccharide, polystyrene beads that have been functionalized with tosyl-activated esters, magnetic polystyrene beads functionalized with tosyl-activated esters, streptavidin beads, streptavidin-monomer coated beads, streptavdin-tetramer coated beads, Streptavidin Coated Compel Magnetic beads, avidin coated beads, dextramer coated beads, divinyl sulfone-activated dextran, Carboxylate-modified bead, amine-modified beads, antibody coated beads, cellulose beads, grafted co-poly beads, poly-acrylamide beads, dimethylacrylamide beads optionally crosslinked with N—N′-bis-acryloylethylenediamine, hollow fiber membranes, fluorescent beads, collagen-agarose beads, gelatin beads, collagen-gelatin beads, collagen-fibronectin-gelatin beads, collagen beads, chitosan beads, collagen-chitosan beads, protein-based beads, hydrogel beads, hemicellulose, alkyl cellulose, hydroxyalkyl cellulose, carboxymethylcellulose, sulfoethylcellulose, starch, xylan, amylopectine, chondroitin, hyarulonate, heparin, guar, xanthan, mannan, galactomannan, chitin and chitosan.
• 160. The detection molecule according to any of the preceding items, wherein the multimerization domain comprises one or more beads further comprises a linker moiety.
• 161. The detection molecule according to any of the preceding items, wherein the multimerization domain comprises one or more beads comprising a linker moiety which is a flexible linker, a rigid linker, a water-soluble linker or a cleavable linker.
• 162. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises a dimerization domain.
• 163. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises a trimerization domain.
• 164. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises a tetramerization domain.
• 165. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises a pentamerization domain.
• 166. The detection molecule according to any of the preceding items, wherein the pentamerization domain comprises a coiled-coil polypeptide structure.
• 167. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises a hexamerization domain, such as a hexamerization domain comprises three IgG domains.
• 168. The detection molecule according to any of the preceding items, wherein the one or more linkers comprises a polyamide and/or a polyethylene glycol and/or a polysaccharide and/or a sepharose.
• 169. The detection molecule according to any of the preceding items, wherein the one or more linkers have a molecular weight of less than 1,000 Da.
• 170. The detection molecule according to any of the preceding items, wherein the one or more linkers have a molecular weight of from 1,000 Da to preferably less than 10,000 Da.
• 171. The detection molecule according to any of the preceding items, wherein the one or more linkers have a molecular weight of from 10,000 Da to preferably less than 100,000 Da.
• 172. The detection molecule according to any of the preceding items, wherein the one or more linkers have a molecular weight of from 100,000 Da to preferably less than 1,000,000 Da.
• 173. The detection molecule according to any of the preceding items, wherein the one or more linkers have a molecular weight of more than 1,000,000 Da.
• 174. The detection molecule according to any of the preceding items further comprising one or more scaffolds, carriers, connectors and/or linkers selected from the group consisting of streptavidin (SA) and avidin and derivatives thereof, biotin, immunoglobulins, antibodies (monoclonal, polyclonal, and recombinant), antibody fragments and derivatives thereof, leucine zipper domain of AP-1 (jun and fos), hexa-his (metal chelate moiety), hexa-hat GST (glutathione S-tranferase) glutathione affinity, Calmodulin-binding peptide (CBP), Strep-tag, Cellulose Binding Domain, Maltose Binding Protein, S-Peptide Tag, Chitin Binding Tag, Immuno-reactive Epitopes, Epitope Tags, E2Tag, HA Epitope Tag, Myc Epitope, FLAG Epitope, AU1 and AU5 Epitopes, Glu-Glu Epitope, KT3 Epitope, IRS Epitope, Btag Epitope, Protein Kinase-C Epitope, VSV Epitope, lectins that mediate binding to a diversity of compounds, including carbohydrates, lipids and proteins, e.g. Con A (Canavalia ensiformis) or WGA (wheat germ agglutinin) and tetranectin or Protein A or G (antibody affinity).
• 175. The detection molecule according to any of the preceding items, wherein the binding molecule and/or the label comprises a connector molecule, such as biotin, and the linker comprises a connector such as streptavidin or another avidin connector.
• 176. The detection molecule according to any of the preceding items, wherein the binding molecule is linked to at least one of the one or more multimerization domains by a non-covalent linker moiety, such as natural dimerization or protein-protein interactions.
• 177. The detection molecule according to any of the preceding items, wherein the binding molecule is linked to at least one of the one or more multimerization domains by a protein-protein interaction selected from the group consisting of Fos/Jun interactions, Acid/Base coiled coil structure based interactions, antibody/antigen interactions, polynucleotide-polynucleotide interactions, synthetic molecule-synthetic molecule interactions and protein-small molecule interactions.
• 178. The detection molecule according to any of the preceding items, wherein the binding molecule is linked to at least one of the one or more multimerization domains by natural dimerization selected from the group consisting of antigen-antibody pairs, DNA-DNA interactions, natural interactions, biotin and streptavidin.
• 179. The detection molecule according to any of the preceding items, wherein the detection molecule further comprises an enzyme capable of catalysing the transfer of a cell surface moiety (e.g. a peptide fragment or ‘peptide tag’) from a cell surface protein to the binding molecule of the detection molecule, when said surface moiety binds to the binding molecule.
• 180. The detection molecule according to any of the preceding items, comprising
  
  • a. a monomeric or a multimeric major histocompatibility complex (MHC) molecule, such as a monomeric or multimeric peptide MHC complex,
  • b. a linker comprising a multimerization domain and optionally one or more connectors, and
  • c. a nucleic acid label.
• 181. The detection molecule according to any of the preceding items, comprising
  
  • a. a monomeric or a multimeric major histocompatibility complex (MHC) molecule, such as a monomeric or multimeric peptide MHC complex,
  • b. a linker comprising a multimerization domain and optionally one or more connectors, and
  • c. a peptide label.
• 182. The detection molecule according to any of the preceding items, comprising
  
  • a. CD1, wherein said CD1 is selected from the group consisting of CD1 CD1a, CD1b, CD1c, CD1d and CD1e,
  • b. a linker comprising a multimerization domain and optionally one or more connectors, and
  • c. a nucleic acid label.
• 183. The detection molecule according to any of the preceding items, comprising
  
  • a. an anti-target molecule capable of associating with, recognizing and/or binding to a predetermined marker molecule (or target) on a cell type, wherein said marker molecule is specific for a certain cell type
  • b. a linker (Li) comprising a multimerization domain and optionally one or more connectors, and
  • c. a nucleic acid label.
• 184. The detection molecule according to any of the preceding items, wherein said linker comprising a multimerization domain and optionally one or more connectors is a dextran optionally comprising streptavidin or avidin, and said binding molecule and/or label optionally comprises biotin.
• 185. A kit of parts comprising
  
  • a. One or more detection molecules according to any of the preceding items, and
  • b. one or more additional components.
• 186. The kit of parts according to any of the preceding items, wherein said one or more additional components comprise reagents for detecting and/or amplifying the label of the detection molecule.
• 187. The kit of parts according to any of the preceding items, wherein said one or more additional components comprise reagents for detecting and/or amplifying the nucleic acid label of the detection molecule.
• 188. The kit of parts according to any of the preceding items, wherein said reagents for detecting the nucleic acid label of the detection molecule comprises one or more primer sets capable of amplifying the nucleic acid label.
• 189. A detection method comprising the steps of
  
  • a. Combining a sample with at least one detection molecule; wherein the detection molecule comprises a binding molecule (BM), a linker (Li), and a label (La) according to any of the preceding items; and wherein said sample comprises at least one cell and/or entity,
  • b. Incubating the at least one detection molecule and the sample;
  • c. Isolating and/or detecting the at least one detection molecule of step b), and
  • d. Optionally determining the identity of the at least one detection molecule of step c).
• 190. The detection method according to any of the preceding items, wherein in step b) the one or more detection molecules are allowed to associate with, recognize, and/or bind to said at least one cell and/or entity through their binding molecule.
• 191. The detection method according to any of the preceding items, wherein in step c) and d) said detection molecule is comprised in a cell-detection molecule complex or an entity-detection molecule complex.
• 192. The detection method according to any of the preceding items, wherein in step c) and d) said detection molecule is not comprised in a cell-detection molecule complex or an entity-detection molecule complex.
• 193. The detection method according to any of the preceding items, wherein in step c) and d) said detection molecule is no longer comprised in a cell-detection molecule complex or an entity-detection molecule complex, wherein said detection molecule has previously interacted with a cell-detection molecule complex or an entity-detection molecule complex.
• 194. The detection method according to any of the preceding items, wherein said cell-detection molecule complexes comprises a cell, such as an immune cell, associated with or bound to a detection molecule having a binding molecule specific for the immune cell.
• 195. The detection method according to any of the preceding items, wherein step c) comprises isolating and detecting the at least one detection molecule.
• 196. The detection method according to any of the preceding items, wherein step c) comprises first isolating and then detecting the at least one detection molecule.
• 197. The detection method according to any of the preceding items, wherein step c) comprises detecting the at least one detection molecule.
• 198. The detection method according to any of the preceding items, wherein step c) comprises isolating the at least one detection molecule.
• 199. The detection method according to any of the preceding items, wherein step c) comprises first detecting and then isolating the at least one detection molecule.
• 200. The detection method according to any of the preceding items, wherein in step c) isolating comprises flow cytometry and/or FACS sorting
• 201. The detection method according to any of the preceding items, wherein in step c) isolating comprises one or more steps of washing, centrifugation and/or precipitation.
• 202. The detection method according to any of the preceding items, wherein in step c) isolating comprises one or more steps of filtration.
• 203. The detection method according to any of the preceding items, wherein in step c) isolating comprises one or more steps of application on an affinity column.
• 204. The detection method according to any of the preceding items, wherein in step c) isolating comprises sorting of cell populations based on the functional response to a stimuli (responsive or non-responsive population), such as cytokine secretion, phosphorylation, calcium release.
• 205. The detection method according to any of the preceding items, wherein in step c) isolating comprises sorting of cell populations based on phenotype, such as by linking a certain set of phenotypic characteristics to the antigen-responsiveness.
• 206. The detection method according to any of the preceding items, wherein in step c) isolating comprises immobilization of the detection molecule and/or cell-detection molecule complexes.
• 207. The detection method according to any of the preceding items, wherein said immobilization of the cell-detection molecule complexes comprises precipitating cells, such as by centrifugation, by immunoprecipitation, or any other means that precipitates the cells.
• 208. The detection method according to any of the preceding items, wherein said immobilization of the cell-detection molecule complexes comprises binding the cell-detection molecule complexes to a bead, a particle, another surface, an antibody or an MHC complex.
• 209. The detection method according to any of the preceding items, wherein said immobilization of the detection molecule and/or cell-detection molecule complexes comprises hybridization onto an array.
• 210. The detection method according to any of the preceding items, wherein said immobilization of the detection molecule and/or cell-detection molecule complexes by hybridization onto an array comprises a nucleic acid/nucleic acid-interaction between the nucleic acid label of the detection molecule and an antisense nucleic acid sequence in the array.
• 211. The detection method according to any of the preceding items, wherein said immobilization of the detection molecule and/or cell-detection molecule complexes by hybridization onto an array comprises a DNA/DNA-interaction between the DNA label of the detection molecule and an antisense DNA in the array.
• 212. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises one or more steps of adding primary antibodies that bind to the immobilized detection molecule and/or cell-detection molecule complexes and detecting said primary antibodies directly wherein the primary antibody is labelled, or indirectly by adding labelled secondary antibodies.
• 213. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises one or more steps of detecting the immobilized detection molecule and/or cell-detection molecule complexes by monitoring read-out from a second label such as a fluorophore.
• 214. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises one or more steps of determining the identity of said label.
• 215. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises interaction between ‘coating DNA’ on the cell surface and the DNA label of the detection molecule.
• 216. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises protease cleavage of the peptide label of the detection molecule.
• 217. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises transfer of a cell surface moiety to the detection molecule (e.g. a ‘peptide tag’).
• 218. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises detection of the label based on the physical characteristics of the label, including mass, sequence, charge, volume, size, dimensions, fluorescence, absorption, emission, NMR spectra and others.
• 219. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises amplification of the label.
• 220. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises sequencing of the label (e.g. DNA sequencing, peptide sequencing).
• 221. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises amplification of the barcode sequence of a nucleic acid label by PCR and/or sequencing of the barcode sequence.
• 222. The detection method according to any of the preceding items, wherein said sequencing comprises deep sequencing or next generation sequencing.
• 223. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises mass spectrometry.
• 224. The detection method according to any of the preceding items, wherein said detecting in step c) and/or determining the identity in step d) comprises one or more of gel electrophoresis, gel filtration, PAGE, column fractionation, PCR and QPCR.
• 225. The detection method according to any of the preceding items, said method further comprising one or more steps of providing a sample, preferably a sample comprising at least one entity and/or at least one cell.
• 226. The detection method according to any of the preceding items, said method further comprising one or more steps of pre-treatment of the sample, and/or pre-treatment of cells of the sample.
• 227. The detection method according to any of the preceding items, said method further comprising one or more steps of separating unbound detection molecules from cell- or entity-detection molecule complexes.
• 228. The detection method according to any of the preceding items, said method further comprising one or more steps of removing unbound detection molecules by washing and/or centrifuging.
• 229. The detection method according to any of the preceding items, said method further comprising one or more steps of single-cell sorting and sequencing.
• 230. The detection method according to any of the preceding items, said method further comprising one or more steps of single-cell T cell sorting of and single-cell TCR sequencing.
• 231. The detection method according to any of the preceding items, wherein said sample comprises one or more cells.
• 232. The detection method according to any of the preceding items, wherein said sample comprises at least one cell and/or entity to which the binding molecule of the detection molecule is able to associate with, recognize and/or bind.
• 233. The detection method according to any of the preceding items, wherein said sample is selected from the group consisting of a solid sample, a fluid sample, a semifluid sample, a liquid sample, a solubilised sample and a sample comprising dissociated cells of a solid sample.
• 234. The detection method according to any of the preceding items, wherein said sample is selected from the group consisting of a biofilm, a biopsy, a surgical sample, a tissue sample, a microarray-fixed sample, a section such as a fresh section, a frozen section and a FFPE section.
• 235. The detection method according to any of the previous items, wherein said sample is selected from the group consisting of blood, whole blood, plasma, serum, Peripheral blood mononuclear cells (PBMC), human PBMN (HPBMC), buffy coat, synovial fluid, bone marrow, cerebrospinal fluid, saliva, lymph fluid, seminal fluid, urine, stool, exudate, transdermal exudates, pharyngeal exudates, nasal secretions, sputum, sweat, bronchoalveolar lavage, tracheal aspirations, fluid from joints, vitreous fluid, vaginal or urethral secretions or semen.
• 236. The detection method according to any of the previous items, wherein said sample comprises cell populations isolated from a fluid, a semifluid sample or a solid sample.
• 237. The detection method according to any of the previous items, wherein said cell is selected from the group consisting of immune cells, lymphocytes, monocytes, dendritic cells, T-cells, B-cells and NK cells
• 238. The detection method according to any of the previous items, wherein said cell is a T-cell, such as a T cell selected from the group consisting of CD4+ T cells, CD8+ T cells, αβ T cells and invariant γδ T cells.
• 239. The detection method according to any of the previous items, wherein said cell is an antigen-specific T-cell or antigen-responsive T cell.
• 240. The detection method according to any of the previous items, wherein said cell comprises T-cell receptors.
• 241. The detection method according to any of the previous items, wherein said cell is a cancer cell.
• 242. The detection method according to any of the previous items, wherein said sample is derived from an organ selected from the group consisting of lymph nodes, kidney, liver, skin, brain, heart, muscles, bone marrow, skin, skeleton, lungs, the respiratory tract, spleen, thymus, pancreas, exocrine glands, bladder, endocrine glands, reproduction organs including the phallopian tubes, eye, ear, vascular system, the gastroinstestinal tract including small intestines, colon, rectum, canalis analis and prostate gland.
• 243. The detection method according to any of the previous items, wherein the surface of sample cells is coated with proteases capable of cleaving a peptide label, for example by adding antibody-protease conjugates where the antibody recognizes a particular cell surface structure.
• 244. The detection method according to any of the previous items, wherein the surface of sample cells is coated with DNA oligonucletides (“coating DNA”), for example by adding antibody-DNA conjugates where the antibody recognizes a particular cell surface structure.
• 245. A method for detecting antigen-specific T cells in a sample, said method comprising providing a detection molecule and a detection method according to any of the preceding items.
• 246. A method for detecting specific cells in a sample, said method comprising providing a detection molecule and a detection method according to any of the preceding items.
• 247. A method for diagnosing a disease, said method comprising providing a detection molecule and a detection method according to any of the preceding items.
• 248. A method for diagnosing a disease according to the previous items, wherein said disease is selected from the group consisting of cancer, Cancerous diseases, infectious diseases, Infectious diseases caused by virus, Infectious diseases caused by bacteria, Infectious diseases caused by fungus, Parasitic diseases, Allergic diseases, Transplantation-related diseases and Autoimmune and inflammatory diseases.
• 249. A method for detecting the presence and/or abundance of a certain cell or cell type in a sample, said method comprising providing a detection molecule and a detection method according to any of the preceding items, wherein said detection molecule comprises a binding molecule capable of associating specifically with the cell or cell type in said sample
• 250. A method for investigating the binding characteristics of a certain cell or cell type in a sample, said method comprising providing a detection molecule and a detection method according to any of the preceding items, wherein said detection molecule comprises a binding molecule capable of associating specifically with a known target.
• 251. A method for the identification of epitopes comprising providing a detection molecule and a detection method according to any of the preceding items
• 252. A method for vaccine development comprising providing a detection molecule and a detection method according to any of the preceding items.
• 253. A method for measuring immune reactivity after vaccination comprising providing a detection molecule and a detection method according to any of the preceding items.
• 254. A method for development of immune-therapeutics comprising providing a detection molecule and a detection method according to any of the preceding items.