Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > RO 3306

RO 3306

RO 3306 is a small-molecule inhibitor that selectively targets the cyclin-dependent kinase 1 (CDK1) enzyme, also known as cell division control protein 2 (CDC2).
This chemical compound plays a crucial role in regulating the cell cycle, particularly the G2/M phase transition.
RO 3306 has been widely used in biological research to study the functions of CDK1 and its implication in cellular processes such as mitosis, apoptosis, and cancer development.
Researchers can leverage the power of AI-driven platforms like PubCompare.ai to optimize their RO 3306 research, locate relevant protocols from literature, preprints, and patents, and identify the best experimental approaches to enhance reproducibility and accuracy.
By utilizing the comparative analysis capabilities of PubCompare.ai, scientists can make more informed decisions and accelerate their discoveries related to this important cell cycle regulator.

Most cited protocols related to «RO 3306»

1
Cell Line Maintenance and Transfection
Cited 10 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2013
Amino Acids, Essential Cell Lines Cells DNA Damage Doxorubicin Equus asinus HeLa Cells Hydroxyurea hygromycin A leptomycin B lipofectamine 2000 MDA-MB-231 Cells Nocodazole Plasmids Pulse Rate RNA, Small Interfering RO 3306 Transfection Tremor
2
Synchronizing HeLa cells for cell cycle analysis
Cited 8 times
HeLa cells were grown in Dulbecco modified Eagle medium supplemented with HEPES and 10% (v/v) fetal calf serum (Invitrogen). Thymidine block/release synchronizations were performed as previously described.48 (link) Briefly, cells were blocked in G1/S with 1 mM thymidine for 20–24 h, then released into S phase by washing 3 times with pre-warmed media, and then addition of fresh media plus 25 µM deoxycytidine. At 6 h post-release (post-S phase) cells were treated with either the Cdk1 inhibitor RO3306 (RO) or the PP2A/PP1 inhibitor Okadaic acid (OA). The efficiency of the cell synchrony was confirmed by flow cytometry (FACS) as previously described.49 (link) HeLa cells stably expressing H2B-mCherry were made by transiently transfecting cells with a pH2B_mCherry_IRES_neo3 plasmid (H2B-mCherry)(Addgene #21044) using Turbofect (Thermo Scientific #R0533) as per the manufacturer instructions. Cells were selected for 1–2 wk with 500 µg/ml of G418 and sorted by flow cytometry to isolate a homogenous pool of cells expressing a medium level of H2B-mCherry. These were then maintained in 500 µg/ml of G418. HeLa cells co-expressing H2B-mCherry and EB3-GFP were a generous gift from Dr J Ellenberg (European Molecular Biology Laboratory) and Dr V Doye (Institut Jacques-Monod), and were cultured as previously described.16 (link)
McCloy R.A., Rogers S., Caldon C.E., Lorca T., Castro A, & Burgess A. (2014). Partial inhibition of Cdk1 in G2 phase overrides the SAC and decouples mitotic events. Cell Cycle, 13(9), 1400-1412.
Publication 2014
antibiotic G 418 CDK1 protein, human Cells Deoxycytidine Eagle Europeans Fetal Bovine Serum Flow Cytometry HeLa Cells HEPES Homozygote Internal Ribosome Entry Sites Okadaic Acid Plasmids Protein Phosphatase 2A RO 3306 Thymidine
3
Engineered CENPA Allele Cell Lines
Cited 6 times
T-REx Flp-In DLD-1 cells (provided by S. Taylor, University of Manchester, UK) were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Thermo Fisher) supplemented with 10% tetracycline-free fetal bovine serum (Omega Scientific) and 100 U/mL penicillin-streptomycin. Cells were maintained at 37°C under 5% CO2 and atmospheric oxygen. CENPA alleles were genetically modified in TIR1-expressing T-REx Flp-In DLD-1 cells26 by co-transfection with pcDNA3.1 plasmids (Invitrogen) encoding TAL effector nucleases, as previously described18 (link), and an EYFP-AID donor construct targeting the translation start codon of CENPA. Single EYFP+ cells were isolated by fluorescence-activated cell sorting (Sony SH800) and screened by immunoblotting and PCR for CENP-A–/EYFP-AID clones. CENP-AWT and CENP-AC-H3 rescue cDNAs were cloned into pcDNA5/FRT/TO plasmids and co-transfected with pOG44 into TIR1-DLD-1 CENP-A–/EYFP-AID cells using X-tremeGENE 9 (Roche). Cells that underwent stable Flp recombinase-mediated transgene integration at the FRT locus were selected with 100 μg/mL hygromycin (Thermo Fisher), and Y chromosome-positive clones were confirmed by FISH.
To generate stable cell lines expressing fluorescent reporters of interest, H2B-mRFP and mCherry-NLS-TagRFP (annotated as 2×RFP-NLS, a gift from E. Hatch and M. Hetzer, Salk Institute, USA) open reading frames were cloned into pBABE retroviral vectors and packaged in 293GP cells by co-transfection with pVSV-G using X-tremeGENE 9. Viral supernatants after 48- or 72-hour transfection were filtered (0.45 μm) and target cells were infected in the presence of 5 μg/mL polybrene (Santa Cruz) for ~16 hours. Fluorescent cells were isolated by fluorescence-activated cell sorting (Sony SH800).
Doxycycline and the auxin plant hormone indole-3-acetic acid (IAA) purchased from Sigma were dissolved in cell culture-grade water and used at 1 μg/mL and 500 μM, respectively. For cell cycle arrest experiments, 100 ng/mL nocodazole (Sigma) was used for mitotic arrest, 1 μM PD-0332991 (provided by S. Dowdy, UC San Diego, USA) was used for G1 arrest, and 10 μM RO-3306 (Sigma) was used for G2 arrest, all of which were dissolved in DMSO. The following DNA damage repair inhibitors were dissolved in DMSO and used at the indicated concentrations: 250 μM SCR7 (LIG4 inhibitor), 25 μM RI-1 (RAD51 inhibitor, both provided by A. Shiau, Ludwig Institute for Cancer Research, USA), and 10 μM NU7026 (DNA-PKcs inhibitor, Abcam).
All cell lines were tested for mycoplasma and confirmed free of contamination. The cell lines used in this study were not authenticated and are not found in the database of commonly misidentified cell lines that is maintained by ICLAC and NCBI BioSample.
Ly P., Teitz L.S., Kim D.H., Shoshani O., Skaletsky H., Fachinetti D., Page D.C, & Cleveland D.W. (2016). Selective Y centromere inactivation triggers chromosome shattering in micronuclei and repair by canonical NHEJ. Nature cell biology, 19(1), 68-75.
Publication 2016
Alleles Auxins Cell Culture Techniques Cell Cycle Arrest Cell Lines Cells Cloning Vectors Codon, Initiator Culture Media DNA, Complementary DNA Repair Doxycycline Eagle Fetal Bovine Serum Fishes FLP recombinase hygromycin A indoleacetic acid inhibitors LIG4 protein, human Malignant Neoplasms Mycoplasma Nocodazole NU 7026 Open Reading Frames Oxygen PD 0332991 Penicillins Plant Growth Regulators Plasmids Polybrene PRKDC protein, human Retroviridae RO 3306 Streptomycin Sulfoxide, Dimethyl Tetracycline Tissue Donors Transcription Activator-Like Effector Nucleases Transfection Transgenes Y Chromosome
4
Cell Cycle Regulation Assay
Cited 6 times
The following chemicals were used: RO3306 (Axon MedChem), Okadaic Acid sodium salt (A.G. Scientifix), Thymidine and 2’-Deoxycytidine hydrate (Santa Cruz Biotechnology). The following antibodies were used; BUB1B (BubR1) (#4116), Cyclin B1 (#12231), Phospho-(Ser) CDK Substrate (#2324), pCdc2-Tyr15 (CDK1-Y15) (#9111), Plk1 (#4535), Aurora B (#3094) and Lamin A/C (#4777) (Cell Signaling Technologies), Securin (ab3306) (Abcam), Cyclin A (sc-596), Cdc2 (CDK1) (sc-137034), Mad2 (sc-47747), Cdc25C (sc-327) (Santa Cruz Biotechnology), centrin (#04–1624) (Millipore) and β-actin (A5441) (Sigma-Aldrich). Anti-Greatwall was obtained as previously described (Vigneron et al., 2009), and monoclonal β-Tubulin hybridoma antibody was a generous donation from Dr Natalie Morin (CRBM, France).
McCloy R.A., Rogers S., Caldon C.E., Lorca T., Castro A, & Burgess A. (2014). Partial inhibition of Cdk1 in G2 phase overrides the SAC and decouples mitotic events. Cell Cycle, 13(9), 1400-1412.
Publication 2014
Actins Antibodies AURKB protein, human Axon BUB1B protein, human CDC25C protein, human CDK1 protein, human Cherubism Cyclin A Cyclin B1 Deoxycytidine Hybridomas LMNA protein, human Monoclonal Antibodies morin Okadaic Acid PLK1 protein, human PTTG1 protein, human RO 3306 Sodium Sodium Chloride Thymidine Trimethoprim-Sulfamethoxazole Combination Tubulin
5
Cell Synchronization and Inhibitor Treatments
Cited 5 times
HCT116 p21+/+, HCT116 p21−/−, HeLa, MDA-MB-231, MCF7 and U2OS cells were cultured as instructed. Stable HeLa 776-6, expressing shRNA targeting cyclin B1, were generated as described [18 (link), 19 (link)]. To synchronize cells in prometaphase, cells were treated with 50 ng/ml nocodazole (Sigma-Aldrich, Taufkirchen). Thymidine (Sigma-Aldrich) synchronization and release was performed as described [46 (link)]. The Plk1 inhibitor BI2536 (25 nM) was obtained from Selleck Chemicals LLC (Houston, USA), the specific Cdk1 inhibitor RO-3306 (9 μM) and the MAP cascade inhibitor PD98059 (10 μM) from Merck Millipore (Darmstadt). λ-Phosphatase (λ-PPase) was purchased from NEB (Frankfurt), MG132 (Z-Leu-Leu-al; 10 μM), cycloheximide (25 μg/ml) and DMSO from Sigma-Aldrich, the calpain inhibitor PD150606 (200 μM) from Santa Cruz (Heidelberg), and the pan-caspase inhibitor Z-VAD-FMK (Z-VAD; 20 μM) from Enzo Life Science GmbH (Lörrach). siRNA (10 to 20 nM) was transiently transfected with Oligofectamine™ (Life Technology). siRNAs targeting p21 (sense: ACACCUCCUCAUGUACAUAUU and antisense: AAUAUGUACAUGAGGAGGUGU), cyclin B1 (sense: GAAAUGUACCCUCCAGAAATT and antisense: GCUGACCCUGAAGUUCAUCUU) and Cdk2 (sense: ACACUCACCUUCUAGUCUUUU and antisense: AAGACUAGAAGGUGAGUGUUU) were manufactured by Sigma-Aldrich. Control siRNA was obtained from Qiagen (Hilden). For transient transfections with pBI-p21 and its constructs, electroporation was used (250 V, 250 μF, 500 Ω). The generation of the stable cell line HCT116 with H2B-tdTomato and the performance of time-lapse imaging are described [6 (link)]. FLAG constructs were transfected with FuGENE® HD in a ratio 1:3 (Promega, Mannheim).
Kreis N.N., Friemel A., Zimmer B., Roth S., Rieger M.A., Rolle U., Louwen F, & Yuan J. (2016). Mitotic p21Cip1/CDKN1A is regulated by cyclin-dependent kinase 1 phosphorylation. Oncotarget, 7(31), 50215-50228.
Full text: Click here
Publication 2016
benzyloxycarbonylvalyl-alanyl-aspartyl fluoromethyl ketone BI 2536 calpain inhibitor Caspase Inhibitors CDK1 protein, human CDK2 protein, human Cell Lines Cyclin B1 Cycloheximide Electroporation FuGene HeLa Cells leucylleucine MCF-7 Cells MG 132 Nocodazole oligofectamine PD 98059 PD 150606 Phosphoric Monoester Hydrolases PLK1 protein, human Promega Prometaphase RNA, Small Interfering RO 3306 Short Hairpin RNA Sulfoxide, Dimethyl tdTomato Thymidine Transfection Transients

Most recents protocols related to «RO 3306»

1
Cell Culture and Transfection Protocol
Cells were propagated in Dulbecco’s modified Eagle’s medium supplemented with 10% (v/v) calf serum (for HeLa) or fetal bovine serum (for H1299) and 50 U/ml of penicillin streptomycin (Thermo Fisher Scientific).
Unless stated otherwise, cells were treated with the following reagents at the indicated final concentration: blasticidin (Thermo Fisher Scientific; 3.75 μg/ml for transient selection; 2.5 μg/ml for stable selection), CHK1i (AZD7762) (Selleck Chemicals; 20 nM), CHX (Sigma-Aldrich; 10 μg/ml), Dox (Sigma-Aldrich; 2 μg/ml), hygromycin B (Thermo Fisher Scientific; 0.25 mg/ml), IAA (Sigma-Aldrich; 50 μg/ml), nocodazole (NOC) (Sigma-Aldrich; 100 ng/ml), puromycin (Sigma-Aldrich; 0.75 μg/ml for transient selection; 0.3 μg/ml for stable selection), RO3306 (Santa Cruz Biotechnology; 10 μM), and thymidine (Santa Cruz Biotechnology; 2 mM). Cells were transfected with plasmids using a calcium phosphate precipitation method (63 ). Transfection of siRNA (10 nM) was carried out using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to manufacturer instructions. Unless stated otherwise, transfected cells were cultured for 24 h before harvested for further analysis.
Ng L.Y., Ma H.T, & Poon R.Y. (2023). Cyclin A–CDK1 suppresses the expression of the CDK1 activator CDC25A to safeguard timely mitotic entry. The Journal of Biological Chemistry, 299(3), 102957.
Full text: Click here
Publication 2023
AZD-7762 calcium phosphate Cells Eagle Fetal Bovine Serum HeLa Cells Hygromycin B Lipofectamine Nocodazole Penicillins Plasmids Puromycin RNA, Small Interfering RO 3306 Serum Streptomycin Thymidine Transfection Transients
2
Cell Cycle Synchronization Methods
Synchronization with double thymidine and NOC shake-off was performed as previously described (65 (link)). Briefly, cells were grown in medium containing 2 mM of thymidine for 14 h. The cells were then washed twice with PBS and cultured in fresh medium. After 9 h, the cells were incubated with a second round of 2 mM of thymidine for 14 h to obtain early S cells. Late S and G2 cells were obtained at 6 h and 9 h after release from the double thymidine block, respectively.
For synchronization using RO3306 blockade, cells were first synchronized using 2 mM of thymidine for 14 h. The cells were then washed twice with PBS and cultured in fresh medium for 6 h before incubation with RO3306 for another 6 h. After washed twice with PBS, the attached cells were harvested as late G2 cells.
For NOC shake-off synchronization, double thymidine-synchronized cells were released for 6 h before incubation with NOC for 6 h. Mitotic cells were collected by mechanical shake-off followed by centrifugation. G1 cells were obtained by washing the mitotic cells with PBS twice and released into drug-free medium. After 3 h, attached cells were harvested as G1 cells.
Double thymidine synchronization coupling with siRNA transfection was performed as described (66 (link)). In brief, cells were transfected with siRNA after the release from the first thymidine block. Fresh medium was then replenished before applying the second thymidine block. Cell-free extracts were prepared as described previously (67 (link)).
Ng L.Y., Ma H.T, & Poon R.Y. (2023). Cyclin A–CDK1 suppresses the expression of the CDK1 activator CDC25A to safeguard timely mitotic entry. The Journal of Biological Chemistry, 299(3), 102957.
Full text: Click here
Publication 2023
Cell Extracts Cells Centrifugation RNA, Small Interfering RO 3306 Thymidine Transfection Tremor
3
Comprehensive Cell Culture and Assay Materials
Dulbecco’s PBS, DMEM, McCoy’s 5A (Modified) Medium, Opti-MEM I Reduced Serum Medium, sodium pyruvate (100 mM), penicillin–streptomycin (PenStrep, 10,000 U/ml penicillin, 10,000 μg/ml streptomycin), puromycin (10 mg/ml), Lipofectamine LTX Reagent with PLUS Reagent, PageRuler Prestained Protein Ladder, Spectra Multicolor High Range Protein Ladder, propidium iodide (PI), trypsin–EDTA solution (TE), Power SYBR Green PCR Master Mix, DNase I, RNase A (10 mg/ml), High-Capacity RNA-to-cDNA Kit, TRIzol, and the Pierce BCA Protein Assay Kit were purchased from Thermo Fisher Scientific or their associated companies Invitrogen or Applied Biosystems. Fetal calf serum (FCS) was obtained from Capricorn Scientific GmbH. PhosSTOP, cOmplete Mini (from Roche), MISSION shRNA pLKO.1-vectors, MEM non-essential amino acid solution (100×), polybrene, polyethylene glycol (PEG8000), polyethylenimine (PEI), coenzyme A (lithium salt), sodium hydrosulfite (Na2S2O4), and adenosine 5′-monophosphate (disodium salt; AMP) were obtained from Sigma-Aldrich. Tris(hydroxymethyl)aminomethane (Tris), Tween-20, Triton X-100, Hepes, DTT, magnesium sulfate (MgSO2), and sodium dodecyl sulfate were bought from PanReac AppliChem ITW Reagents. Sodium chloride (NaCl) and ethanol were purchased from Carl Roth. NEBuilder HiFi DNA Assembly Master Mix and all restriction enzymes used were purchased from New England Biolabs, Inc. Primers were obtained from Eurofins Scientific SE. Peroxide-free ARA, butylhydroxytoluol, cobimetinib, dactolisib, erlotinib, HLM006474, LB42708, PD184352, SCH772984, temsirolimus, pifithrin-ɑ, NSC68811, and wortmannin were purchased from Cayman Chemical Company. Palbociclib and Ro-3306 were purchased by MedChemExpress. EDTA (Titriplex III) and ɑ-D-glucose were purchased from Merck KGaA. Adenosine 5′-triphosphate (disodium salt; ATP) and calcium chloride were obtained from Carl Roth GmbH + Co. KG. Beetle luciferin (potassium salt; D-luciferin) was purchased from Promega Corporation.
Göbel T., Goebel B., Hyprath M., Lamminger I., Weisser H., Angioni C., Mathes M., Thomas D, & Kahnt A.S. (2023). Three-dimensional growth reveals fine-tuning of 5-lipoxygenase by proliferative pathways in cancer. Life Science Alliance, 6(5), e202201804.
Full text: Click here
Publication 2023
Adenosine Monophosphate Adenosine Triphosphate Amino Acids, Essential Beetles Biological Assay Caimans Calcium chloride Cloning Vectors cobimetinib Coenzyme A dactolisib Deoxyribonuclease I DNA, Complementary DNA Restriction Enzymes Edetic Acid Erlotinib Ethanol Fetal Bovine Serum Glucose HEPES HLM006474 LB42708 Lipofectamine Lithium Luciferins methylamine Oligonucleotide Primers palbociclib PD 184352 Penicillins Peroxides pifithrin Polybrene polyethylene glycol 8000 Polyethylene Glycols Polyethyleneimine Potassium Promega Propidium Iodide Proteins Puromycin Pyruvate Ribonucleases RO 3306 SCH772984 Serum Short Hairpin RNA Sodium Sodium Chloride sodium hydrogen sulfite Streptomycin Sulfate, Magnesium Sulfate, Sodium Dodecyl SYBR Green I temsirolimus Triton X-100 trizol Tromethamine Trypsin Tween 20 Wortmannin
4
Cell Cycle Regulation Inhibition Assay
LY294002 (PI3K kinase inhibitor), SB216763 (GSK3-β inhibitor), RO-3306 (Cyclin-dependent kinase 1 inhibitor), Flavopiridol (pan-CDK inhibitor), TAME (N2-[(4-Methylphenyl)sulfonyl]-L-arginine methyl ester) (APC/CCdc20 inhibitor), AG556 (EGFR inhibitor), CAS 587871-26-9 (ATM inhibitor), Wortmannin (PI3K/Akt pathway inhibitor), PD98059 (MAPK inhibitor), and TBCA (Casein Kinase II inhibitor) were purchased from Sigma Aldrich (Berlin, Germany). Antibodies against HN1 were either produced as previously described [13 (link)] or purchased from Invitrogen (Waltham MA, USA). β-actin antibodies were purchased from Sigma (Berlin, Germany). Antibodies against Cyclin B1, Cdk1, p-H3(S10), Cdt1, control IgG (mouse and rabbit), Ubiquitin, Cdc20, Emi1, BrdU, GAPDH, Lamin B1, Acetylated H4, and Cdh1 were either purchased from Sigma Aldrich, Invitrogen, or Santa Cruz Biotechnology (Heidelberg, Germany). Anti-mouse and anti-rabbit AlexaFluor, 488- and 594-conjugated antibodies, were purchased from Invitrogen (Carlsbad, USA). The antibodies were used at concentrations of 0.2 to 1 µg/mL.
Javed A., Özduman G., Varışlı L., Öztürk B.E, & Korkmaz K.S. (2023). HN1 Is Enriched in the S-Phase, Phosphorylated in Mitosis, and Contributes to Cyclin B1 Degradation in Prostate Cancer Cells. Biology, 12(2), 189.
Full text: Click here
Publication 2023
Actins AG 556 Antibodies arginine methyl ester Bromodeoxyuridine Casein Kinase II CCNB1 protein, human CDH1 protein, human CDK1 protein, human Cyclin-Dependent Kinase Inhibitor Proteins EGFR protein, human flavopiridol GAPDH protein, human GSK3B protein, human LMNB1 protein, human LY 294002 Mus PD 98059 Phosphotransferases PIK3CB protein, human Rabbits RO 3306 SB 216763 Tosylarginine Methyl Ester Ubiquitin Wortmannin
5
Immunocytochemistry Protocol for Cellular Analysis
Cells were plated onto glass coverslips and fixed in 4% paraformaldehyde solution in PBS (Sigma-Aldrich). Samples were permeabilized in permeabilization solution (PBS with 3% horse serum (Sigma-Aldrich) and 0.1% Triton X-100 (Sigma-Aldrich)). Primary antibody incubation was performed overnight in permeabilization solution at 4 °C. Samples were then washed 3 times in PBS, 5 min each wash. Secondary antibody incubation was performed for 1 h in permeabilization solution at 25 °C protected from light. Samples were washed 3 times in PBS, 5 min each wash, with 1 µg/mL DAPI (Sigma-Aldrich) added to the second wash. Coverslips were then mounted using ProLong Gold Antifade on glass slides and imaged.
For EdU staining, cells were plated on glass coverslips. 24 h prior to fixation, cells were treated with 10 µM RO-3306 (Sigma-Aldrich). 2 h prior to fixation, 10 µM EdU was added to cell culture media. Samples were then fixed in 4% paraformaldehyde solution in PBS. EdU detection was then performed using the Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher). For further ICC steps, samples were subsequently treated as described above.
All microscopy images were acquired using a Nikon Eclipse TE2000-E epifluorescence microscope using the NIS-Element 4.51.00 64-bit software.
Turkalo T.K., Maffia A., Schabort J.J., Regalado S.G., Bhakta M., Blanchette M., Spierings D.C., Lansdorp P.M, & Hockemeyer D. (2023). A non-genetic switch triggers alternative telomere lengthening and cellular immortalization in ATRX deficient cells. Nature Communications, 14, 939.
Full text: Click here
Publication 2023
Alexa Fluor 647 Cell Culture Techniques Cells Culture Media DAPI Equus caballus Gold Immunoglobulins Light Microscopy paraform RO 3306 Serum Triton X-100

Top products related to «RO 3306»

1
Ro 3306 by Merck Group
Sourced in United States, Germany
RO-3306 is a small molecule that inhibits the activity of Cyclin-dependent kinase 1 (Cdk1), a key regulator of the cell cycle. It functions by blocking the transition from G2 phase to mitosis (M phase) in the cell cycle.
2
Thymidine by Merck Group
Sourced in United States, Germany, United Kingdom, Sao Tome and Principe, France, Italy, Japan, China
Thymidine is a nucleoside that is a component of DNA. It serves as a building block for DNA synthesis and is essential for cellular division and growth.
3
Nocodazole by Merck Group
Sourced in United States, Germany, United Kingdom, Japan, Sao Tome and Principe, Canada, China, Switzerland, France, Poland, Macao, Australia
Nocodazole is a synthetic compound that acts as a microtubule-destabilizing agent. It functions by binding to and disrupting the polymerization of microtubules, which are essential components of the cytoskeleton in eukaryotic cells. This property makes Nocodazole a valuable tool in cell biology research for studying cell division, cell motility, and other cellular processes that rely on the dynamics of the microtubule network.
4
Ro 3306 by Selleck Chemicals
Sourced in United States, Japan
RO-3306 is a chemical compound used in laboratory research. It functions as a specific CDK1 inhibitor, which plays a key role in cell cycle regulation. The core function of RO-3306 is to provide researchers with a tool to study cell cycle dynamics and cell division processes.
5
Mg132 by Merck Group
Sourced in United States, Germany, China, United Kingdom, Macao, Sao Tome and Principe, France, Canada, Italy, Switzerland, Morocco, Belgium, Japan, Sweden, Australia, Austria, Israel, Spain
MG132 is a proteasome inhibitor, a type of laboratory reagent used in research applications. It functions by blocking the activity of the proteasome, a complex of enzymes responsible for the degradation of proteins within cells. MG132 is commonly used in cell biology and biochemistry studies to investigate the role of the proteasome in various cellular processes.
6
Ro 3306 by Bio-Techne
Sourced in United Kingdom
RO-3306 is a selective inhibitor of Cyclin-Dependent Kinase 1 (CDK1). It functions by blocking the cell cycle progression at the G2/M phase transition.
7
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
8
Ro 3306 by Enzo Life Sciences
Sourced in United States
RO-3306 is a selective inhibitor of the serine/threonine protein kinase Cdk1 (cyclin-dependent kinase 1). It acts as a cell cycle regulator by preventing the G2/M phase transition.
9
Aphidicolin by Merck Group
Sourced in United States, Germany, United Kingdom, Denmark
Aphidicolin is a laboratory reagent that functions as a DNA polymerase inhibitor. It is commonly used in cell biology and molecular biology research applications.
10
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.

More about "RO 3306"

Explore the Versatile Applications of RO 3306: Unlocking the Secrets of Cell Cycle Regulation RO 3306 is a powerful small-molecule inhibitor that selectively targets the cyclin-dependent kinase 1 (CDK1) enzyme, also known as cell division control protein 2 (CDC2).
This crucial regulator plays a central role in the cell cycle, particularly the critical G2/M phase transition.
Researchers have widely utilized RO 3306 in their studies to unravel the functions of CDK1 and its implications in cellular processes such as mitosis, apoptosis, and cancer development.
Beyond RO 3306, other cell cycle modulators like Thymidine, Nocodazole, MG132, FBS, and Aphidicolin have also been extensively employed in biological research.
These compounds target various stages of the cell cycle, providing scientists with a comprehensive toolkit to investigate the complex mechanisms governing cellular division and proliferation.
To optimize your RO 3306 research and enhance reproducibility, consider leveraging the power of AI-driven platforms like PubCompare.ai.
These innovative tools can help you identify the most relevant protocols from literature, preprints, and patents, empowering you to make informed decisions and accelerate your discoveries.
By utilizing the comparative analysis capabilities of PubCompare.ai, you can locate the best experimental approaches and products, ensuring accuracy and consistency in your RO 3306 studies.
Unlock the full potential of RO 3306 and other cell cycle regulators with the support of cutting-edge AI technologies.
Explore the wealth of information available and embark on your journey to unravel the intricate secrets of cellular dynamics, paving the way for groundbreaking advancements in fields such as cancer biology, developmental biology, and regenerative medicine.