> Chemicals & Drugs > Organic Chemical > Saponin

Saponin

Saponins are a diverse class of natural compounds found in various plants, characterized by their ability to form stable, soap-like foams in aqueous solutions.
These plant-derived glycosides possess a wide range of biological activities, including antimicrobial, anti-inflammatory, and cholesterol-lowering properties.
Saponins have been the focus of extensive research, particularly in the fields of pharmacology and nutraceutical development.
Their unique structural features and diverse functional properties make them valuable targets for exploration in areas such as drug discovery, dietary supplement formulation, and agricultural applications.
Researchers can leverage advanced AI-driven platforms like PubCompare.ai to streamline their saponin research, easily identify the most effective protocols and products, and accelerate their scientific discoveries.

Most cited protocols related to «Saponin»

Primary Rat Hippocampal Neuron Culture and Imaging

Cited 30 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2010

Antibodies Cold Temperature Equus asinus Immunoglobulins Infection matrigel Microscopy, Confocal Neurogenesis Neurons Papain paraform Saponin Serum Technique, Dilution

Fixation and Immunostaining of Cells

Cited 28 times

This is modification from a previously published protocol described in [29 (link)]. Cells in 25 μl growth medium were rapidly fixed by the addition of 25 μl aldehyde in PBS to achieve a final concentration of 4% FA and 0.2% GA (glutaraldehyde); fixation was allowed to proceed for 15 min at room temperature (20–24 °C) before rinsing three times with PBS containing 50 mM NH₄Cl. Slides were then placed on a metal plate in a deep ice bath and chilled for at least 2 min. All subsequent steps were performed on ice, with all solutions pre-chilled. Cells were blocked and permeabilized for 45 min with a solution of buffer A containing 5% (v/v) NGS (normal goat serum), 50 mM NH₄Cl and 0.5% saponin. 100 nM GST–PH-PLCδ1 was included at this stage when the protein was used as a probe for PtdIns(4,5)P₂, and GST-tagged protein was then removed by two rinses with buffer A. Primary antibodies were applied in buffer A with 5% NGS and 0.1% saponin for 1 h. After two washes in buffer A, a 45 min incubation with secondary antibody in buffer A with 5% NGS and 0.1% saponin was performed. Slides were then rinsed four times with buffer A, and cells were post-fixed in 2% FA in PBS for 10 min on ice, before warming to room temperature for an additional 5 min. FA was removed by three rinses in PBS containing 50 mM NH₄Cl, followed by one rinse in distilled water. Wells were then dried, covered with 3 μl ProLong Gold (Invitrogen) supplemented with 1 μg/ml DAPI (4′,6-diamidino-2-phenylindole) and covered with 22 mm×22 mm glass cover slips (No. 1 thickness, Scientific Laboratory Supplies), and sealed with nail varnish.

Hammond G.R., Schiavo G, & Irvine R.F. (2009). Immunocytochemical techniques reveal multiple, distinct cellular pools of PtdIns4P and PtdIns(4,5)P2. Biochemical Journal, 422(Pt 1), 23-35.

Publication 2009

Aldehydes Antibodies Bath Buffers Cells Culture Media DAPI Electroplating Glutaral Goat Gold Immunoglobulins Nails Phosphatidylinositols Proteins Saponin Serum

Immunofluorescence Detection of CPAF in Chlamydia

Cited 27 times

Immunofluorescence detection of CPAF in chlamydia-infected cells was carried out as described previously 67. In brief, HeLa cell monolayer was infected with Chlamydia trachomatis L2 for 30 h. The monolayer, after it was fixed with paraformaldehyde (Sigma-Aldrich) and permeabilized with Saponin (Sigma-Aldrich), was costained with Hoechst 32258 (blue), anti-MOMP antibody MC22 (probed with an FITC-conjugated, mouse IgG3-specific secondary antibody), and anti-CPAFn antibody 54b (probed with a Cy3-conjugated, mouse IgG1-specific secondary antibody). Images were acquired individually for each stain in gray using a Cooker digital camera connected to an AX70 Olympus microscope, and the single-color images were merged in frame into the triple-color image using the software Image Pro.

Zhong G., Fan P., Ji H., Dong F, & Huang Y. (2001). Identification of a Chlamydial Protease–Like Activity Factor Responsible for the Degradation of Host Transcription Factors. The Journal of Experimental Medicine, 193(8), 935-942.

Publication 2001

Antibodies, Anti-Idiotypic Cells Chlamydia Chlamydia trachomatis Chlorpropamide-Alcohol Flushing Fingers Fluorescein-5-isothiocyanate Fluorescent Antibody Technique HeLa Cells hoechst 32258 IgG1 IgG3 Immunoglobulins Microscopy Mus paraform Reading Frames Saponin Stains

Neutralizing antibody potency assay for CHIKV

Cited 23 times

Serial dilutions of MAb were incubated with 100 FFU of CHIKV for one hour at 37°C. MAb-virus complexes were added to cells in 96-well plates. After 90 minutes, cells were overlaid with 1% (w/v) methylcellulose in Modified Eagle Media (MEM) supplemented with 4% FBS. Plates were harvested 18 to 24 hours later, and fixed with 1% PFA in PBS. The plates were incubated sequentially with 500 ng/ml of ch-CHK-9 and horseradish peroxidase (HRP)-conjugated goat anti-human IgG in PBS supplemented with 0.1% saponin and 0.1% BSA. CHIKV-infected foci were visualized using TrueBlue peroxidase substrate (KPL) and quantitated on an ImmunoSpot 5.0.37 macroanalyzer (Cellular Technologies Ltd). Non-linear regression analysis was performed, and EC50 values were calculated after comparison to wells infected with CHIKV in the absence of antibody.

Pal P., Dowd K.A., Brien J.D., Edeling M.A., Gorlatov S., Johnson S., Lee I., Akahata W., Nabel G.J., Richter M.K., Smit J.M., Fremont D.H., Pierson T.C., Heise M.T, & Diamond M.S. (2013). Development of a Highly Protective Combination Monoclonal Antibody Therapy against Chikungunya Virus. PLoS Pathogens, 9(4), e1003312.

Full text: Click here

Publication 2013

anti-IgG Cells Eagle Goat Homo sapiens Horseradish Peroxidase Immunoglobulins Methylcellulose Peroxidase Saponin Technique, Dilution Virus

CD8+ T Cell Activation Assay

Cited 22 times

Splenocytes (0.2–1 × 10⁶) or CD8⁺ T cells (10⁵, CD8a⁺ T Cell Isolation Kit; Miltenyi Biotec) were incubated with the following: (a) transfected cells (see previous paragraph), (b) synthetic peptides, (c) DC2.4 pulsed with synthetic peptides at various concentrations, or (d) DC2.4 infected with VACV (see Viruses and cell lines) in the wells of a 96-well plate at 37°C and 5% CO₂. Synthetic peptides (if used) were added to a final concentration of 0.5 μM; cells (except those transfected in 96-well format) were used at 1–2 × 10⁵ cells per well. 10 μg/ml brefeldin A was added after 1 h, and the incubation continued for another 3–4 h. Plates were spun, medium was removed, and cells were resuspended in 50 μl of α-CD8-PE (clone 53–6.7; BD Biosciences; some experiments used FITC or PE-Cy5) and incubated on ice for 20 min. Cells were washed, resuspended in 50 μl of 1% paraformaldehyde, and incubated at room temperature for 20 min before another two washes and staining with α-IFN-γ–allophycocyanin (clone XMG1.2; BD Biosciences; some experiments used FITC or PE) overnight in PBS with 0.5% saponin at 4°C. Cells were washed once before acquisition and analysis of fluorescence using a FACSCalibur (BD Biosciences). Analysis was done using Flowjo software (Tree Star Inc.); events were gated for live lymphocytes on FSC × SSC followed by CD8⁺ cells using CD8 × SSC and displayed as CD8 × IFN-γ. Data was recorded as IFN-γ⁺, CD8⁺ cells as a percentage of total CD8⁺ cells. Backgrounds as determined using irrelevant peptides, cells transfected with irrelevant constructs or uninfected cells were usually in the order of 0.1% and were subtracted from the values presented for test samples.

Tscharke D.C., Karupiah G., Zhou J., Palmore T., Irvine K.R., Haeryfar S.M., Williams S., Sidney J., Sette A., Bennink J.R, & Yewdell J.W. (2005). Identification of poxvirus CD8+ T cell determinants to enable rational design and characterization of smallpox vaccines. The Journal of Experimental Medicine, 201(1), 95-104.

Publication 2005

allophycocyanin Brefeldin A CD8-Positive T-Lymphocytes Cell Lines Cells Cell Separation Clone Cells Fluorescein-5-isothiocyanate Fluorescence Interferon Type II Lymphocyte paraform peptide B Peptides Saponin Trees Virus

Most recents protocols related to «Saponin»

Investigating Virus Infectivity's Role in Plaque Size

Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5

PCR primer sequences.

Gene TargetPrimer Sequence

DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA

TGCC (SEQ ID NO: 24)

Reverse: GAGACAGCAGGATCTCTGGTCTY

TC (SEQ ID NO: 25)

GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT

(SEQ ID NO: 26)

Reverse: TTGATTTTGGAGGGATCTCG

(SEQ ID NO: 27)

CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC

(SEQ ID NO: 28)

Reverse: GTCCATCCTTGGAAGCACTGCA

(SEQ ID NO: 29)

ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT

(SEQ ID NO: 30)

Reverse: ATCTTCCACCGAGCTGTGTCCA

(SEQ ID NO: 31)

IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG

(SEQ ID NO: 32)

Reverse: CATTTTAGTTGCCGTAGG

(SEQ ID NO: 33)

IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA

(SEQ ID NO: 34)

Reverse: AAGACCTTCTGGGTCATCACG

(SEQ ID NO: 35)

IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG

(SEQ ID NO: 36)

Reverse: ACGTCCTCCAGGATTATCTCCA

(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].

Full text: Click here

Patent 2024

Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication

Colocalization of Antibodies in B-cells

Not available on PMC !

Example 4

To determine where 2F2-grafted “humanized” antibodies and antibody variants are delivered upon internalization into the cell, colocalization studies of the anti-CD79b antibodies internalized into B-cell lines may be assessed in Ramos cell lines. LAMP-1 is a marker for late endosomes and lysosomes (Kleijmeer et al., Journal of Cell Biology, 139(3): 639-649 (1997); Hunziker et al., Bioessays, 18:379-389 (1996); Mellman et al., Annu. Rev. Dev. Biology, 12:575-625 (1996)), including MHC class II compartments (MIICs), which is a late endosome/lysosome-like compartment. HLA-DM is a marker for MIICs.

Ramos cells are incubated for 3 hours at 37° C. with 1 μg/ml 2F2-grafted “humanized” antibodies and antibody variants, FcR block (Miltenyi) and 25 μg/ml Alexa647-Transferrin (Molecular Probes) in complete carbonate-free medium (Gibco) with the presence of 10 μg/ml leupeptin (Roche) and 5 μM pepstatin (Roche) to inhibit lysosomal degradation. Cells are then washed twice, fixed with 3% paraformaldehyde (Electron Microscopy Sciences) for 20 minutes at room temperature, quenched with 50 mM NH4Cl (Sigma), permeabilized with 0.4% Saponin/2% FBS/1% BSA for 20 minutes and then incubated with 1 μg/ml Cy3 anti-mouse (Jackson Immunoresearch) for 20 minutes. The reaction is then blocked for 20 minutes with mouse IgG (Molecular Probes), followed by a 30 minute incubation with Image-iT FX Signal Enhancer (Molecular Probes). Cells are finally incubated with Zenon Alexa488-labeled mouse anti-LAMP1 (BD Pharmingen), a marker for both lysosomes and MIIC (a lysosome-like compartment that is part of the MHC class II pathway), for 20 minutes, and post-fixed with 3% PFA. Cells are resuspended in 20 μl saponin buffer and allowed to adhere to poly-lysine (Sigma) coated slides prior to mounting a coverglass with DAPI-containing VectaShield (Vector Laboratories). For immunofluorescence of the MIIC or lysosomes, cells are fixed, permeabilized and enhanced as above, then co-stained with Zenon labeled Alexa555-HLA-DM (BD Pharmingen) and Alexa488-Lamp1 in the presence of excess mouse IgG as per the manufacturer's instructions (Molecular Probes).

Accordingly, colocalization of 2F2-grafted “humanized” antibodies or antibody variants with MIIC or lysosomes of B-cell lines as assessed by immunofluorescence may indicate the molecules as excellent agents for therapy of tumors in mammals, including B-cell associated cancers, such as lymphomas (i.e. Non-Hodgkin's Lymphoma), leukemias (i.e. chronic lymphocytic leukemia), and other cancers of hematopoietic cells.

US11866496B2. Humanized anti-CD79B antibodies and immunoconjugates and methods of use (2024-01-09). Genentech, Inc. [US]. Inventors: Yvonne Chen [US], Mark Dennis [US], Kristi Elkins [US], Jagath Reddy Junutula [US], Andrew Polson [US], Bing Zheng [US].

Full text: Click here

Patent 2024

Alexa Fluor 647 Anti-Antibodies Antibodies, Monoclonal, Humanized B-Lymphocytes Buffers Carbonates CD79B protein, human Cell Lines Cells Chronic Lymphocytic Leukemia Cloning Vectors DAPI Electron Microscopy Endosomes Genes, MHC Class II Hematopoietic Neoplasms Immunofluorescence Immunoglobulins Leukemia leupeptin Lymphoma Lymphoma, Non-Hodgkin Lysine lysosomal-associated membrane protein 1, human Lysosomes Malignant Neoplasms Mammals Molecular Probes Mus Neoplasms paraform pepstatin Poly A Saponin Therapeutics Transferrin

Quantification of cGAS Localization in Cells

4–5 d following transduction, 500,000 cells were plated on 0.1% poly-L-lysine in water-coated (#8920; Sigma-Aldrich) coverslips and left for 30 min to attach. Cells were fixed in PBS 4% paraformaldehyde for 20 min at RT. Coverslips were washed twice in PBS and quenched with 500 μl of freshly prepared PBS glycine (375 mg glycine in 50 ml of PBS) for 10 min at RT. Cells were then permeabilized and simultaneously blocked with PBS, 0.2 % BSA, 0.05% saponin, and 1% goat serum (#G9023; Sigma-Aldrich) for 30 min at RT. Coverslips were incubated with primary antibody against cGAS (clone D1D3G) or isotype control (clone DA1E) at a concentration of 0.085 μg/ml in PBS, 0.2% BSA, and 0.05% saponin, and left overnight at 4°C in a moist chamber. Coverslips were washed five times with PBS, 0.2% BSA, and 0.05% saponin, and incubated in secondary antibody goat anti-rabbit IgG at 1:400 (#A21246; Invitrogen) for 45 min at RT. Coverslips were washed five times with PBS, 0.2% BSA, and 0.05% saponin, rinsed in water, and mounted on a glass slide using 10 µl fluoromount-G with DAPI (#00-4959-520; Invitrogen). Glass slides were allowed to dry in a 37°C chamber for 30 min and stored at 4°C. Images were acquired on a Leica DmI8 inverted microscope equipped with an SP8 confocal unit using a 40× (1.3 NA) oil objective. Image analysis was performed using Fiji software (Schindelin et al., 2012 (link)). Homemade scripts were used to analyze cGAS localization. All images were smoothened using a filtering of mean radius 1 pixel. For each Z-stacks, an optical section in the middle of the nuclei was chosen. Then, for each condition, a binary mask of the nuclei and a mask of the cell were obtained by applying a threshold respectively on the DAPI signal or the cGAS signal to define nuclear and cytosolic regions. To avoid out-of-focus cells and to be sure that measurement will be done inside nuclei, a filter was applied to keep only cells with a section larger than 20 µm² containing a nucleus section larger than 16 μm². Finally, average cGAS and GFP intensities were measured in the whole cell, the nuclei, and the cytosol (defined by the whole cell excluding the nuclear region).

Jeremiah N., Ferran H., Antoniadou K., De Azevedo K., Nikolic J., Maurin M., Benaroch P, & Manel N. (2023). RELA tunes innate-like interferon I/III responses in human T cells. The Journal of Experimental Medicine, 220(5), e20220666.

Publication 2023

anti-IgG Cell Nucleus Cells Chromogranin A Clone Cells Cytosol DAPI Glycine Goat Immunoglobulin Isotypes Immunoglobulins Lysine Microscopy paraform Poly A Rabbits Radius Saponin Serum Strains Vision

High-Content Imaging Analysis of Puncta

PC3 cells were plated on 96-well plates for 48 h at 37°C, 5% CO₂, fixed in 4% paraformaldehyde for 15 min and blocked in PFS (0.7% fish skin gelatin/0.025% saponin/PBS) for 1 h. Cells were stained with primary antibodies overnight at 4°C with gentle agitation. After 3 × 5-min washes in PFS, either Alexa-Fluor secondary antibodies, HCS CellMask Deep Red Stain and Hoechst 34580 (all Thermo Fisher Scientific) were added for 45 with gentle agitation at room temperature. Cells were washed 3 times in PBS for 5 min each and maintained in PBS at 4°C until imaging at room temperature was carried out. Antibodies used described in Table S3.
Plates were imaged using an Opera Phenix High-Content Screening System (×63 objective) and Harmony High-Content Imaging and Analysis Software v4.9 (PerkinElmer) used to design custom pipelines for analysis. The total number and area of puncta positive for each antibody was detected per cell in the presence and absence of ARF3. Using mNeonGreen and Hoechst 34580 to identify sub-cellular regions cells were also segmented into specific sub-cellular regions e.g., juxtanuclear, cytoplasmic, and periphery (defined as 5 pixels from outer edge of cell) and the total number and area of puncta calculated per region per cell. The percentage of puncta area “overlap” between puncta positive for different antibodies was also calculated per cell per condition as a measure of co-localization. Values are presented as mean ± SEM and cell numbers, P values, and statistical tests used are described in figure legends. n = 3 independent experiments.

Sandilands E., Freckmann E.C., Cumming E.M., Román-Fernández A., McGarry L., Anand J., Galbraith L., Mason S., Patel R., Nixon C., Cartwright J., Leung H.Y., Blyth K, & Bryant D.M. (2023). The small GTPase ARF3 controls invasion modality and metastasis by regulating N-cadherin levels. The Journal of Cell Biology, 222(4), e202206115.

Full text: Click here

Publication 2023

Antibodies Cells Cytoplasm Gelatins Hoechst 34580 Ichthyosis Congenita Immunoglobulins paraform PC 3 Cell Line Saponin Stains

Quantifying F-actin in 3D PC3 Acini

PC3 acini were cultured in GFRM as described in “Live 3D culture and analysis” section and incubated for 3 d at 37°C, 5% CO_2. Acini were gently washed with PBS prior to addition of 4% paraformaldehyde for 15 min. Samples were blocked in PFS (0.7% fish skin gelatin/0.025% saponin/PBS) for 1 h then stained with primary antibodies overnight at 4°C with gentle agitation. After 3 × 5 min washes in PFS, secondary antibodies (all Thermo Fisher Scientific) were added for 45 with gentle agitation at room temperature. Acini were washed 3× in PBS for 5 min each and maintained in PBS at 4°C until imaging was carried out. Antibodies and fluorochromes used are described in Table S3.
All images were acquired at room temperature in PBS. Confocal images were taken using A1R microscope (Nikon) with ×40 oil objective, exported as TIFF files and processed in Fiji. Other images were taken using an Opera Phenix High Content Screening System (Perkin Elmer). 35 images and 15 planes were taken per well with a 20× objective for PC3 acini. Columbus Image Data Storage and Analysis System (PerkinElmer, version 2.9.1) was used to design a custom pipeline to measure F-actin intensity per acini. F-actin staining was used to detect individual acini in maximum projection images of all planes and any acini touching the image border were excluded from further analysis. Data is presented in box and whiskers plot as total F-actin intensity per acinus. The percentage of acini with visibly reduced F-actin intensity at junctions in maximum projection images is also shown. Values are mean ± SEM and P values and statistical test used are described in figure legends. Number of experimental replicates (n), number of technical replicates per experiment, and the number of acini quantified in total per condition are stated in figure legends.

Full text: Click here

Publication 2023

Antibodies F-Actin Fever Fluorescent Dyes Gelatins Ichthyosis Congenita Microscopy paraform Saponin Vibrissae

Top products related to «Saponin»

Saponin by Merck Group

Sourced in United States, Germany, United Kingdom, Japan, France, Sao Tome and Principe, Panama, Canada, Denmark, Ireland, Netherlands, Switzerland

Saponin is a natural, plant-derived compound that possesses surfactant properties. It can be used as a laboratory reagent for various applications, such as cell lysis, protein extraction, and assay development.

Bovine serum albumin (bsa) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico

Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.

Facscalibur by BD

Sourced in United States, Germany, United Kingdom, China, Canada, Japan, Italy, France, Belgium, Switzerland, Singapore, Uruguay, Australia, Spain, Poland, India, Austria, Denmark, Netherlands, Jersey, Finland, Sweden

The FACSCalibur is a flow cytometry system designed for multi-parameter analysis of cells and other particles. It features a blue (488 nm) and a red (635 nm) laser for excitation of fluorescent dyes. The instrument is capable of detecting forward scatter, side scatter, and up to four fluorescent parameters simultaneously.

Brefeldin a by Merck Group

Sourced in United States, Germany, United Kingdom, Macao, Canada, Switzerland, France, Japan, Sao Tome and Principe, Israel, Italy, Chile

Brefeldin A is a fungal metabolite that inhibits the function of Golgi apparatus in eukaryotic cells. It acts by blocking the exchange of materials between the endoplasmic reticulum and Golgi compartments, leading to the collapse of the Golgi structure.

Facscanto 2 by BD

Sourced in United States, Germany, United Kingdom, Belgium, China, Australia, France, Japan, Italy, Spain, Switzerland, Canada, Uruguay, Netherlands, Czechia, Jersey, Brazil, Denmark, Singapore, Austria, India, Panama

The FACSCanto II is a flow cytometer instrument designed for multi-parameter analysis of single cells. It features a solid-state diode laser and up to four fluorescence detectors for simultaneous measurement of multiple cellular parameters.

Paraformaldehyde (pfa) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Italy, France, Macao, Australia, Canada, Sao Tome and Principe, Japan, Switzerland, Spain, India, Poland, Belgium, Israel, Portugal, Singapore, Ireland, Austria, Denmark, Netherlands, Sweden, Czechia, Brazil

Paraformaldehyde is a white, crystalline solid compound that is a polymer of formaldehyde. It is commonly used as a fixative in histology and microscopy applications to preserve biological samples.

4 6 diamidino 2 phenylindole (dapi) by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand

DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.

Ionomycin by Merck Group

Sourced in United States, Germany, United Kingdom, Macao, France, Italy, China, Canada, Switzerland, Sao Tome and Principe, Australia, Japan, Belgium, Denmark, Netherlands, Israel, Chile, Spain

Ionomycin is a laboratory reagent used in cell biology research. It functions as a calcium ionophore, facilitating the transport of calcium ions across cell membranes. Ionomycin is commonly used to study calcium-dependent signaling pathways and cellular processes.

4 6 diamidino 2 phenylindole (dapi) by Merck Group

Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore

DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.

Hoechst 33342 by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, China, France, Canada, Spain, Belgium, Italy, Australia, Austria, Denmark, Netherlands, Switzerland, Ireland, New Zealand, Portugal, Brazil, Argentina, Singapore, Poland, Ukraine, Macao, Thailand, Finland, Lithuania, Sweden

Hoechst 33342 is a fluorescent dye that binds to DNA. It is commonly used in various applications, such as cell staining and flow cytometry, to identify and analyze cell populations.

What are the main types or variations of saponins?

Saponins are a diverse class of natural compounds with a wide range of structural variations. The main types include triterpenoid saponins, which are the most common, and steroidal saponins. Triterpenoid saponins are further classified based on the aglycone (sapogenin) moiety, such as oleanane, ursane, and dammarane-type saponins. These different types of saponins can exhibit distinct biological activities and functional properties.

What are some of the key applications of saponins?

Saponins have a wide range of applications due to their unique properties. They are used in the pharmaceutical industry as adjuvants in vaccine formulations, owing to their ability to enhance immune responses. Saponins also have potential applications in the food and cosmetic industries, where they can act as natural emulsifiers, foaming agents, and cholesterol-lowering compounds. Additionally, saponins have been explored for their antimicrobial, anti-inflammatory, and anti-cancer properties, making them valuable targets for drug discovery and nutraceutical development.

How can saponin research be optimized using PubCompare.ai?

PubCompare.ai is a powerful AI-driven platform that can help streamline and optimize saponin research. The platform allows you to efficiently screen protocol literature more effectively, leveraging AI to pinpoint critical insights. PubCompare.ai can help researchers identify the most effective protocols related to saponins for their specific research goals. The platform's AI-driven analysis can highlight key differences in protocol effectiveness, enabling researchers to choose the best option for reproducibility and accuracy, ultimately accelerating their scientific discoveries.

What are some common usage challenges or considerations when working with saponins?

One of the main challenges in working with saponins is their potential for foaming and emulsifying properties, which can make handling and formulation more complex. Saponins also exhibit a bitter taste, which can be a consideration in food and beverage applications. Additionally, some saponins may have hemolytic (red blood cell-rupturing) effects, requiring careful dosing and safety evaluations. Researchers should be mindful of these properties when designing experiments and developing saponin-based products.

How can PubCompare.ai help researchers compare the effectiveness of different saponin protocols and products?

PubCompare.ai's AI-driven analysis capabilities can be particularly helpful when comparing the effectiveness of different saponin protocols and products. The platform can quickly sift through the vast number of published studies, preprints, and patents to identify the most relevant and impactful research. By leveraging advanced natural language processing and machine learning, PubCompare.ai can pinpoint the key differences in protocol parameters, experimental conditions, and reported outcomes, enabling researchers to make informed decisions on the most effective approaches for their specific needs. This streamlines the research process and accelerates the identification of the optimal saponin-related protocols and products.

More about "Saponin"

Saponins are a diverse group of natural compounds found in various plants, also known as plant-derived glycosides or triterpenoid glycosides.
These unique compounds possess the ability to form stable, soap-like foams when mixed with water, hence the name 'saponin' derived from the Latin word 'sapo' meaning soap.
Saponins are renowned for their wide range of biological activities, including antimicrobial, anti-inflammatory, and cholesterol-lowering properties, making them valuable targets for research in the fields of pharmacology, nutraceutical development, and agricultural applications.
Bovine serum albumin (BSA) is a commonly used protein in biological research, often employed as a blocking agent or stabilizer in various experimental protocols involving saponins.
The FACSCalibur and FACSCanto II are flow cytometry instruments that can be utilized to analyze the effects of saponins on cell populations, while Brefeldin A is a chemical compound used to disrupt protein transport within cells, potentially impacting saponin-mediated cellular responses.
Paraformaldehyde is a fixative commonly used to preserve cellular structures, and DAPI is a fluorescent stain that binds to DNA, both of which may be employed in studies exploring the mechanisms of saponin action.
Ionomycin and Hoechst 33342 are other chemical agents that can be used in conjunction with saponin research to modulate and investigate cellular processes.
By leveraging advanced AI-driven platforms like PubCompare.ai, researchers can streamline their saponin studies, easily identify the most effective protocols and products from the literature, preprints, and patents, and accelerate their scientific discoveries.
PubCompare.ai's powerful tools can help optimize saponin research, leading to more efficient and reproducible results.