Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Saran

Saran

Saran is a thermoplastic polymer widely used in a variety of applications, including food packaging, medical devices, and chemical industries.
It is known for its transparency, durability, and resistance to chemicals and heat.
Saran is commonly used to create flexible, moisture-resistant films and wraps that help preserve the freshness and quality of food products.
Its versatility and desirable properties make it a valuable material in many industries, contributing to its widespread use and importance in modern manufacturing and consumer products.

Most cited protocols related to «Saran»

1
Adherence Questionnaire for Dialysis Patients
Cited 10 times
The End-Stage Renal Disease-Adherence Questionnaire (ESRD-AQ) for patients requiring in-center HD was designed to measure treatment adherence behaviors in four dimensions: HD attendance, medication use, fluid restrictions, and diet recommendations. Items were initially generated based on in-depth literature reviews and in consultation with clinical experts, such as nephrologists and nephrology researchers, HD nurses, and renal dieticians. The final version of the ESRD-AQ consists of 46 questions/items divided into five sections (see Table 1). The first section pursues general information about patients' ESRD and RRT-related history (5 items), and the remaining four sections ask about treatment adherence to HD treatment (14 items), medications (9 items), fluid restrictions (10 items), and diet recommendations (8 items). These four final sections directly measure adherence behaviors (14, 17, 18, 26, 31, and 46), and patients' knowledge and perceptions about treatment (11, 12, 22, 23, 32, 33, 41, and 42). Responses to the ESRD-AQ utilize a combination of Likert scales and multiple choice, as well as “yes/no” answer format.
The adherence behavior subscale is scored by summing the responses to questions 14, 17, 18, 26, and 46. The weighting system for scores was determined based on the degree of importance relevant to clinical outcome of each dimension. For example, missing or shortening HD has been reported to have a stronger association with mortality of patients with ESRD than other components of adherence behavior; therefore, it was given more weight in computing the adherence scores (Leggat et al., 1998 (link); Saran et al., 2003 (link)). In addition, the ESRD-AQ adjusts scores for question numbers 14 (“During the last month, how many complete dialysis treatments did you miss?”), 18 (“During the last month, when your dialysis treatment was shortened, what was the average numbers of minutes?”), and 26 (“During the past week, how often have you missed your prescribed medicines?”), depending on the reasons for not adhering. For example, patients with medical reasons for missing or shortening the HD treatment (such as having HD access problems or physical symptoms during HD) obtained a full score (see Table 2).
The attitude/perception subscale is scored by summing the responses to questions 11, 12, 22, 23, 32, 33, 41, and 42. The remaining questions obtain information about patients' ESRD and RRT related history. The ESRD-AQ is designed such that higher scores indicate better adherence.
Kim Y., Evangelista L.S., Phillips L.R., Pavlish C, & Kopple J.D. (2010). The End-Stage Renal Disease Adherence Questionnaire (ESRD-AQ): Testing The Psychometric Properties in Patients Receiving In-Center Hemodialysis. Nephrology nursing journal : journal of the American Nephrology Nurses' Association, 37(4), 377-393.
Publication 2010
Behavior Therapy Dialysis Diet Dietitian Kidney Kidney Failure, Chronic Nephrologists Nurses Patients Pharmaceutical Preparations Physical Examination Saran
2
In Vitro RNA Transcription and Purification
Cited 9 times
All RNAs were prepared as in prior work24 (link)41 (link) by in vitro transcription with T7 RNA polymerase from PCR products (with the 20 bp T7 promoter sequence TTCTAATACGACTCACTATA included at the 5′ end), with transcription volumes up to 1.5 mL. Transcriptions were precipitated by adding 1/10 volume of sodium acetate (pH 5.2) and 3 volumes of cold ethanol (taken out of −20°C storage), cooling on dry ice for at least 15 minutes, and centrifuging at 14,000 g for 1.5 hours. After removal of supernatant, pellets were rinsed with 1 mL 70% cold ethanol twice, dried in air for at least 30 minutes, and resolubilized in deionized water at volumes equal to 1/10 of the original transcription. A half volume of denaturing loading buffer (90% formamide, 0.1% xylene cyanol, 0.1% bromophenol blue) was added, and the samples were loaded onto polyacrylamide gels. The gels were 0.5 mm in thickness, 20 cm in height (direction of electrophoresis), and 27 cm in width. The gel mix contained 1x TBE (89 mM Tris-Borate, 1 mM EDTA), 8% polyacrylamide (29:1 acrylamide:bis, Sigma), and 7 M urea, and were polymerized by the addition of 1/100 volume of 10% ammonium persulfate and 1/1000 volume of TEMED (N,N,N′,N′-Tetramethylethylenediamine); after pouring between glass plates, the gels were given at least 1.5 hours to polymerize. Variations with longer polymerization times and use of flavin mononucleotide as the polymerization activating reagent are discussed in SI Figure S1. Gels were run at 25 W or less for 1 to 3 hours (temperatures remained less than 40°C under electrophoresis conditions).
Gels were transferred from gel plates onto UV-transparent plastic wrap (Saran), covered with wrap on both sides, and placed on a fluorescent TLC plate (Life Technologics). Samples were exposed to UV hand-held lamps (Ultraviolet Products UVG-54, 254 nm, 6 W; unless specified otherwise) and boxes were marked on plastic wrap around band locations with Sharpie markers. In most cases, half of the lanes were exposed, with the other half being covered with aluminum foil; the halves were excised separately, with the covered portions serving as UV-untreated controls. The radiation exposure was estimated assuming that the radiation was reflected into one hemisphere underneath the lamp, decreasing as distance squared; this is an underestimate since the radiating tubes are not point sources but extend over approximately 10 cm. For time course measurements (Fig. 2), early timepoints were acquired by turning on the lamp for a few seconds (for warm-up) and transiently removing the foil for the presented times. Gel slices were excised with sterile, disposable scalpels (BD) after peeling back plastic wrap and placed in 1.5 mL Eppendorf tubes with 200 μL deionized water. RNAs passively eluted into the water during incubation overnight at 4°C, and concentrations were estimated by absorption measurements at 260 nm on a Nanodrop spectrophotometer.
Kladwang W., Hum J, & Das R. (2012). Ultraviolet Shadowing of RNA Can Cause Significant Chemical Damage in Seconds. Scientific Reports, 2, 517.
Publication 2012
Acrylamide Aluminum ammonium peroxydisulfate ARID1A protein, human bacteriophage T7 RNA polymerase Borates Bromphenol Blue Buffers Cold Temperature Dry Ice Edetic Acid Electrophoresis Ethanol formamide Neoplasm Metastasis Pellets, Drug polyacrylamide polyacrylamide gels Polymerization Radiation Radiation Exposure Riboflavin 5'-Phosphate RNA Saran Sodium Acetate Sterility, Reproductive tetramethylethylenediamine Transcription, Genetic Tromethamine Urea xylene cyanol
3
Radioactive Labeling and Microarray Hybridization
Cited 6 times
R2Bm 5′ RNA was radioactively labeled with γ 32P-ATP on the 5′-end according to standard procedure and purified on an 8% polyacrylamide denaturing gel. For hybridization, labeled R2Bm 5′ RNA was used at an approximate concentration of 10 nM. The hybridizations were performed as described previously (15 (link)) and in the same buffers used for folding. R2Bm 5′ RNA was incubated with the microarray for 18 h at room temperature or 4°C using probe-clip press seal incubation chambers with 200 µl of hybridization buffer. After hybridization, buffers with R2Bm 5′ RNA were poured out and slides were washed in buffers with the same salt concentrations for 1 min at 0°C. (One minute is the estimated half-life predicted at 0°C for binding of the least stable probe (#9) that binds strongly to its exact complement.) Then, slides were dried by slow centrifugation in a clinical centrifuge and covered with saran wrap. Hybridization was visualized by exposure to a phosphorimager screen, which was then scanned on a Molecular Dynamics 840 Storm Phosphorimager. Quantitative analysis was done with ImageQuant 5.2 software. Binding was considered strong when the integrated intensity was ≥1/3 of the strongest integrated intensity for a given condition. Experiments were repeated at least three times and the average of the data is presented.
Kierzek E., Kierzek R., Moss W.N., Christensen S.M., Eickbush T.H, & Turner D.H. (2008). Isoenergetic penta- and hexanucleotide microarray probing and chemical mapping provide a secondary structure model for an RNA element orchestrating R2 retrotransposon protein function. Nucleic Acids Research, 36(6), 1770-1782.
Publication 2008
Acid Hybridizations, Nucleic Buffers Centrifugation Clip Microarray Analysis Molecular Dynamics Phocidae polyacrylamide gels Saran Sodium Chloride
4
Agarose Gel Shift Assay for eIF3 Binding
Cited 5 times
Recombinant eIF3 was expressed and purified from E. coli and native human eIF3 was purified from HeLa cells as previously described32 (link). The gel shift protocol was adapted from 33 (link) and 34 (link). A 0.7% agarose gel was prepared using Agarose Type 1B (Sigma A0576) in buffer consisting of 1× TBE supplemented with 75 mM KCl, and gel and buffer were pre-cooled at 4 °C. For each gel shift, 2 μl water, 1 μl of 5× Binding Buffer (25 mM Tris-HCl pH 7.5, 5 mM Mg(OAc)2, 70 mM KCl, 0.1 mM CaCl2, 0.1 mg ml-1 BSA, 2 mM TCEP), 1 μl labeled RNA, and 1 μl of purified eIF3 or protein buffer was added, in the listed order, and incubated at 25 °C for 30 min. 1 μl of room temperature 6× non-denaturing loading dye (40% w/v sucrose, with xylene cyanol and bromophenol blue) was added to the reactions and these were loaded on the agarose gel. The gel was run for 1 h at 40 V at 4 °C, buffer was replaced with fresh cold buffer, and the gel was run for another hour at 40 V. The gel was placed on top of positively charged nylon membrane with four pieces of Whatman filter paper underneath, covered in saran wrap, and dried for 1 h at 75 °C on a pre-heated gel drier. The gel was imaged using a phosphoimager.
Lee A.S., Kranzusch P.J, & Cate J.H. (2015). eIF3 targets cell proliferation mRNAs for translational activation or repression. Nature, 522(7554), 111-114.
Publication 2015
Bromphenol Blue Buffers Cold Temperature Escherichia coli Eukaryotic Initiation Factor-3 HeLa Cells Homo sapiens MMP2 protein, human Nylons Proteins Saran Sepharose Strains Sucrose Tissue, Membrane tris(2-carboxyethyl)phosphine Tromethamine xylene cyanol
5
Attenuation Coefficient Estimation of Tissue-Mimicking Phantoms
Cited 4 times
The reference phantom method13 (link) was used to estimate the attenuation coefficient of a sample from RF echo signals obtained from a clinical scanner. The reference phantom method accounts for system-dependent parameters (transducer and pulser-receiver transfer functions) using power spectral density estimates from a reference material (with speed of sound equal to that of the sample), generated at the same depths as estimates from the sample. The sample consisted of a homogeneous tissue-mimicking phantom composed of water-based gel containing graphite powder (50mg/cm3 of agar) to control the attenuation and 3000E glass beads (Potters Industries, Inc., Valley Forge, PA; 5 to 40μm diameter, 4mg/cm3 of agar) to provide scattering.45 (link) The reference phantom was a similar homogeneous material, consisting of an emulsion of 70% safflower oil in gelatin and also containing 3000E glass-bead scatterers (4mg/cm3 of emulsion). Both the sample and the reference phantoms were in acrylic boxes that had 25μm thick Saran wrap® (Dow Chemical, Midland, MI) scanning windows.
During phantom fabrication, 2.5cm-thick test samples were prepared to measure the sound speed and attenuation of the phantom materials. Laboratory estimates of α(f) and the speed of sound of these materials were performed using a narrowband substitution technique46 (link) at frequencies from 2.25 to 10MHz. The attenuation coefficient was modeled as a power of frequency f, using: α(f)=α0fβ.
Table I shows the resultant α0 and β (and the corresponding R2 of the power-law fit), and the estimated speed of sound c ± one standard deviation for both phantoms. The speed of sound of the sample and the reference materials agreed within 0.4%. This difference is not expected to be a significant source of bias in the attenuation estimates.47 (link) The laboratory-estimated parameters of the power-law fit were used as the expected values to which the α0 and β estimates from scanner derived backscatter signals were compared.
Rosado-Mendez I.M., Nam K., Hall T.J, & Zagzebski J.A. (2013). Task-Oriented Comparison of Power Spectral Density Estimation Methods for Quantifying Acoustic Attenuation in Diagnostic Ultrasound Using a Reference Phantom Method. Ultrasonic imaging, 35(3), 10.1177/0161734613495524.
Publication 2013
Agar ECHO protocol Emulsions Gelatins Graphite Powder Safflower oil Saran Sound Tissues Transducers

Most recents protocols related to «Saran»

1
Evidence Gap Mapping Protocols for Policy Domains
Saran and White (2018 ) define an EGM as ‘a systematic [visual] presentation of the availability of relevant evidence for a particular policy domain. The evidence is identified by a search following a pre‐specified, published search protocol. The map may be accompanied by a descriptive report to summarize the evidence for stakeholders such as researchers, research commissioners, policy makers, and practitioners’ (p. 11). An important distinction to note is that EGMs summarise what evidence exists but not what the evidence says. For instance, an EGM describes studies in a particular policy area in terms of outcomes and interventions.
EGMs are useful in identifying evidence gaps, collections of studies for review, and an EGM will identify where there is a need for more research or rigorous evaluation. They can be used to generate higher‐level evidence products such as guidelines or in the development of interventions. Traditional methods adopted for EGMs include a focus on quantitative data only. However, there are EGMs that set a new precedent as these include different research designs and qualitative data (Tallent et al., 2022 (link)) as this EGM will do (see ‘Treatment of qualitative research’).
Rogers M., Lockwood K., Speake E, & Campbell F. (2023). PROTOCOL: Domestic abuse interventions for mothers in or exiting prison: An evidence and gap map. Campbell Systematic Reviews, 19(1), e1313.
Full text: Click here
Publication 2023
Muscle Rigidity Policy Makers Saran
2
Fungal Symbionts Alter Lodgepole Pine Terpene Chemistry
We carried out a field experiment in lodgepole pine forests to characterize how different species of fungal symbionts of MPB alter the terpene chemistry of host phloem over time. We selected 10 healthy (asymptomatic) lodgepole pine trees (DBH = 25.05 ± 0.78 cm) at 22 km North-East of Hinton (Alberta; 53°30′50.7″ N 117°17′31.2″ W). On each tree, we open four holes 20 mm in size in four cardinal directions equidistant from each other at breast height (1.40 cm) along the tree stem. We placed 1 2 cm-sized plug of fungal mycelium (one of three fungal species) on each hole and 1 agar plug without fungal mycelium as control. The fungal plugs were taken from the edges of 10-day-old fungal cultures on potato dextrose agar media. Then, the wounds were covered with saran wraps. Phloem samples (from the fungal-infected and immediate upper part of the initial inoculation point, at different locations along the tree stems, i.e., 5–6 cm above the earlier sample) were collected after every 2 weeks for a total of 6 weeks, stored in dry ice in the field, brought to the laboratory, and stored at −40 °C until analysis. The tissues were processed and extracted based on the method described earlier [46 (link)]. The following fungi were used in this experiment; G. clavigera (EL004), O. montium (EL 031), and L. longiclavatum (EL002). Fungal cultures were obtained from different sources: G. clavigera was originally isolated from MPB in Fox Creek (Alberta) and provided by AV Rice (Northern Forestry Centre, Canadian Forest Service, Edmonton, Alberta), L. longiclavatum (NOF 3100) was provided by the Northern Forestry Centre Culture Collection, and O. montium (UAMH 4838) was provided by the University of Alberta Microfungus Collection and Herbarium (Edmonton).
Zaman R., May C., Ullah A, & Erbilgin N. (2023). Bark Beetles Utilize Ophiostomatoid Fungi to Circumvent Host Tree Defenses. Metabolites, 13(2), 239.
Full text: Click here
Publication 2023
Agar Breast Dry Ice Forests Fungi Glucose Mycelium Oryza sativa Phloem Pinus Saran Solanum tuberosum Stem, Plant Terpenes Tissues Trees Vaccination Wounds
3
Spectrophotometric Determination of SPF
In vitro determination of the SPF via spectrophotometry with integrated sphere was carried out using UV-2000S Labsphere® equipment, in which a sample is positioned on a quartz plate, functioning as a substrate that is ideally transparent in the UV range, with texture and porosity similar to human skin. The literature recommends alternative complementary substrates to meet all these requirements. Surgical tape (TransporeTM, 3M), a polyvinylidene chloride film (Saran Wrap®), and collagen membrane covering the quartz plate for meeting the experimental conditions. The quartz plate was prepared with approximately 50 mg of glycerin to obtain a base line in the equipment. The next step was the deposition of approximately 50 mg of the evaluated NE sample on the plate, covered by the film, spread with the help of a latex fingertip, aiming at obtaining the most uniform and homogeneous layer possible for the equipment reading. This reading was performed at nine different points on the quartz plate. The plate was placed on a metal support, which is taken to the equipment and receives the UV light. The SPF readings were made in triplicates for calculating the mean ± relative standard deviation.
The critical wavelength is a spectrophotometrically-determined value based on spectral absorbance and is used to assess whether a photoprotector offers UVA protection. Because it is a relative value–not an absolute value-of spectral absorbance, it is not considered a sensitive measure, such as SPF or that obtained using Boot’s Star Rating (Table 5). For the analysis, the measured spectral transmittance was converted into spectral absorbance, where the ratio (R) was calculated. The critical wavelength is defined as the first value found when the value of R is > 0.9, that is, the wavelength for which the area under the integrated optical density curve, which starts at 290 nm, is equal to 90% of the integrated area between 290 and 400 nm. Therefore, the value of the critical wavelength is related to the level of protection, in which λc values between 340 and 370 nm indicate intermediate protection against UVA radiation, and values above 370 nm indicate greater protection over a wide spectrum [37 (link)].
Boots Star rating measured the % of UVA that’s been absorbed compared to UVB rays (source), so in a sense it measured the evenness of the UV protection. The closer the UVA/UVB ratio is to 1, the more stars a sunscreen gets. Five stars on the Boots system means that UVA protection achieved more than 90% UVB protection.
Reis-Mansur M.C., Firmino Gomes C.C., Nigro F., Ricci-Júnior E., de Freitas Z.M, & dos Santos E.P. (2023). Nanotechnology as a Tool for Optimizing Topical Photoprotective Formulations Containing Buriti Oil (Mauritia flexuosa) and Dry Aloe vera Extracts: Stability and Cytotoxicity Evaluations. Pharmaceuticals, 16(2), 292.
Full text: Click here
Publication 2023
BaseLine dental cement Collagen Glycerin Homo sapiens Latex Metals polyvinylidene chloride Quartz Radiation Radiation Protection Saran Skin Spectrophotometry Stars, Celestial Surgical Tape Tissue, Membrane Vision
4
Evaluating Ophthalmic Viscosurgical Device Thermal Profiles
The test chamber used was plastic, with an approximate radius of 7.5 mm, height of 20 mm and volume of 3500 mm3. It was filled with balanced saline solution (BSS) and then a saran wrap membrane was placed on top of the BSS (Figures 1 and 2 [Rhino Software, Seattle, WA, USA]). While this volume did not represent any specific anatomical volume, the purpose of the chamber was to simulate the anterior chamber and the cornea in that they were two volumes that were separated by a thin layer. The four OVDs tested were Viscoat (Alcon, a dispersive OVD), DisCoVisc (Alcon, a medium viscosity dispersive [MVD] OVD), Healon5 (Johnson & Johnson Vision, a viscoadaptive OVD), and ProVisc (Alcon, a cohesive OVD). Henceforth, these OVDs will be identified by the following designations: Viscoat as OVD-1, DisCoVisc as OVD-2, Healon5 as OVD-3, and ProVisc as OVD-4. BSS (Alcon) was used as a control and for irrigation. We used a balanced 0.9 mm, 30-degree non-flared tip (Alcon) that features an aspiration bypass system (ABS). The handpiece was placed into the chamber and pierced minimally through the membrane so as to limit the amount of communication between the BSS in the chamber and the OVD on the surface of the membrane’s surface. The temperature probe was attached to an Omega Temperature Gauge (OM-EL-USB-TC-LCD; Omega Engineering, Norwalk, Connecticut) and then placed directly into the OVD, resting on the surface of the membrane, approximating where the wound would be, and maintaining a distance of at least 1 mm between the probe and the tip of the handpiece needle. Once a constant temperature was maintained, and/or 5 minutes had elapsed, the pedal of the Centurion Vision System phaco machine (Alcon Surgical, Fort Worth, Texas) was fully engaged. The continuous ultrasound ran for 30 seconds with an intraocular pressure (IOP) of 50 mm Hg, a vacuum of 0 mm Hg, and an aspiration of 12 cc/min on a continuous torsional setting at 60% power with linear torsional setting with 50% max power allowed with no longitudinal beyond intelligent phaco. Previous work has shown that present phaco technology requires active vacuum at the tip to overcome system resistance engineered to dampen post-occlusion surge in a peristaltic system. So, a setting of no vacuum will functionally result in no to very little fluid flow through the system.9 (link) The gauge recorded temperature at 0, 10, 20 and 30 seconds. This procedure was repeated 10 times for each of the OVDs.

Experimental setup.

Diagrammatic representation.

The experiment was repeated with the phaco machine set to 700+ mm Hg vacuum (a specified setting on the machine) and 20 mL/min aspiration.
Jensen N.R., Ungricht E.L., Harris J.T., Zaugg B., Barlow W.R., Murri M.S., Olson R.J, & Pettey J.H. (2023). Temperature Change of Ophthalmic Viscosurgical Devices in a Bi-Chamber Set-Up at a Flow of 0 and 20mL/min. Clinical Ophthalmology (Auckland, N.Z.), 17, 555-560.
Publication 2023
AN 12 Chambers, Anterior Cornea Dental Occlusion Foot Needles Neoplasm Metastasis Operative Surgical Procedures Peristalsis Pressures, Intraocular Radius Saline Solution Saran Tissue, Membrane Ultrasonography Vacuum Viscoat Viscosity Vision Wounds
5
Generating Transgenic Soybean Composite Plants
The wild-type GmSnRK1, GmNodH genes and their mutants were cloned into plant binary vectors. GmSnRK1 (K49M) is a kinase-dead mutant [21 (link)] and is used as a negative control. The constructs were transformed into Agrobacterium rhizogenes strain K599. The soybean (Williams 82) seeds were germinated in wet vermiculite and the seedlings were grown under conditions of 16-h light and 8-h dark photoperiod, 28 °C, and 80% soil moisture. When the cotyledons are fully opened and the shoots reach about 5 cm in height, a drop of A. rhizogenes culture (OD600 = 0.6–0.8) was injected into hypocotyls using a sterile syringe needle. The inoculated seedlings were covered with transparent Saran film to keep humidity and grown under the same conditions as above. After 15-day growth, the primary roots were removed from seedlings to induce the hairy roots when the hairy roots emerged. The plants with transgenic hairy roots are called composite plants.
Li M., Wang Y., Zhang P., Bai C., Cao L., Li L., Jiang J., Ding X, & Xiao J. (2023). The Role of GmSnRK1-GmNodH Module in Regulating Soybean Nodulation Capacity. International Journal of Molecular Sciences, 24(2), 1225.
Full text: Click here
Publication 2023
Agrobacterium rhizogenes Cloning Vectors Cotyledon Genes Hair Hartnup Disease Humidity Hypocotyl Light Needles Phosphotransferases Plant Embryos Plant Roots Plants Plants, Transgenic Saran Seedlings Soybeans Sterility, Reproductive Strains Syringes vermiculite

Top products related to «Saran»

1
Nupage bis tris gel by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, Denmark, China, Australia, Japan, Israel
NuPAGE Bis-Tris gels are polyacrylamide gel electrophoresis (PAGE) products designed for the separation and analysis of proteins. They are pre-cast, ready-to-use gels that provide consistent and reliable protein separation performance.
2
Mops running buffer by Thermo Fisher Scientific
Sourced in United States, United Kingdom
MOPS running buffer is a laboratory reagent used in gel electrophoresis to separate and analyze biological molecules, such as proteins or nucleic acids. It provides a stable pH environment and ionic conditions to facilitate the migration and separation of these molecules based on their size and charge during the electrophoresis process.
3
Lsrfortessa by BD
Sourced in United States, United Kingdom, Germany, France, Canada, Australia, Belgium, China, Uruguay, Japan, Sweden, Switzerland, Cameroon
The LSRFortessa is a flow cytometer designed for multiparameter analysis of cells and other particles. It features a compact design and offers a range of configurations to meet various research needs. The LSRFortessa provides high-resolution data acquisition and analysis capabilities.
4
Amersham hybond n by GE Healthcare
Sourced in United States, United Kingdom, China, Japan
Amersham Hybond-N+ is a nylon membrane designed for nucleic acid transfer and immobilization. It is used in various molecular biology techniques, such as Northern, Southern, and dot-blot hybridization.
5
Pageruler plus by Thermo Fisher Scientific
Sourced in United States, Germany
The PageRuler Plus is a pre-stained protein ladder designed for monitoring protein separation in SDS-PAGE gels. It provides consistent bands with a wide range of molecular weights from 10 to 250 kDa.
6
Nupage transfer buffer by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan
NuPAGE transfer buffer is a ready-to-use buffer designed for the efficient transfer of proteins from polyacrylamide gels to membranes. It is compatible with the NuPAGE electrophoresis system and provides consistent and reliable protein transfer results.
7
T4 polynucleotide kinase by Thermo Fisher Scientific
Sourced in United States, Germany, Lithuania, Italy, United Kingdom, Switzerland
The T4 polynucleotide kinase is an enzyme used in molecular biology to catalyze the transfer of a phosphate group from ATP to the 5' hydroxyl terminus of DNA, RNA, or oligonucleotides. This enzymatic activity is commonly used in various DNA and RNA manipulation techniques.
8
Biomax xar film by Merck Group
BioMax XAR Film is a laboratory equipment product designed for use in autoradiography applications. It is a high-performance X-ray film that captures and records images of radioactive samples, such as those used in molecular biology and biochemistry experiments. The film is sensitive to a wide range of radiation wavelengths, making it suitable for a variety of autoradiographic techniques.
9
Synergy ht plate reader by Agilent Technologies
Sourced in United States, United Kingdom, Germany
The Synergy HT plate reader is a versatile and high-performance instrument designed for a wide range of microplate-based assays. It features a multimode detection system that can measure absorbance, fluorescence, and luminescence. The Synergy HT is capable of performing various applications, including cell-based assays, enzyme-linked immunosorbent assays (ELISAs), and other biochemical and molecular biology experiments.
10
Eurostar by IKA Group
Sourced in Germany
The Eurostar is a laboratory equipment product offered by IKA Group. It is a stirrer that is designed to mix and homogenize liquids and suspensions in various laboratory applications.

More about "Saran"

Saran is a versatile thermoplastic polymer that has a wide range of applications in various industries.
Also known as polyvinylidene chloride (PVDC), this material is prized for its transparency, durability, and resistance to chemicals, moisture, and heat.
Saran is commonly used to create flexible, moisture-resistant films and wraps that help preserve the freshness and quality of food products, making it a valuable material in the food packaging industry.
Beyond food packaging, Saran is also used in medical devices, such as IV tubing and blood bags, as well as in the chemical industry for the production of paints, coatings, and adhesives.
Its unique properties, including low permeability to gases and vapors, make it an ideal choice for these applications.
When it comes to laboratory equipment and techniques, Saran is not directly used, but related materials and tools such as NuPAGE Bis-Tris gels, MOPS running buffer, LSRFortessa flow cytometer, Amersham Hybond-N+ membrane, PageRuler Plus protein ladder, NuPAGE transfer buffer, T4 polynucleotide kinase, BioMax XAR Film, and Synergy HT plate reader may be employed in various experimental procedures.
These products and techniques are used in a wide range of scientific disciplines, including molecular biology, biochemistry, and cell biology.
In summary, Saran is a versatile and widely used thermoplastic polymer that offers numerous benefits across multiple industries, from food packaging to medical and chemical applications.
Its unique properties and diverse use cases make it an essential material in modern manufacturing and consumer products.