Log In Sign up
The largest database of trusted experimental protocols
> Chemicals & Drugs > Organic Chemical > Solon

Solon

Solon is a city located in Cuyahoga County, Ohio, United States.
It is a suburb of Cleveland and is known for its affluent residential areas and thriving business community.
Solon is home to a diverse population and offers a high quality of life, with excellent schools, recreational amenities, and a strong local economy.
The city is a hub for technology and innovation, attracting businesses and researchers from around the region.
Solon's strategic location, well-developed infrastructure, and skilled workforce make it an attractive destination for those seeking to optimize their research and development efforts.

Most cited protocols related to «Solon»

1
Telomere Length Measurement Assay
Cited 101 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2009
beta-Globins Biological Assay Diagnosis Escherichia coli Factor VIII Fluorescence Genes Genome HeLa Cells Homo sapiens Malignant Neoplasms Oligonucleotide Primers Platinum Real-Time Polymerase Chain Reaction Solon Sulfoxide, Dimethyl Taq Polymerase Telomere Tromethamine
2
Nasal Swabs Bacterial Community Analysis
Cited 30 times
After arrival of the samples at the study center, nasal swabs were vortexed for 20 s to allow further dissemination from the swab into the medium. The samples were aliquoted and stored at − 80 °C until analysis. For investigating the bacterial community structure the swab was used for DNA extraction using FastDNA Spin Kit for Soil (MP Biomedicals, Solon, OH, USA) based on the manufacturers’ instruction. The hypervariable region V1/V2 of the 16S rRNA gene was subsequently amplified and sequenced on an Illumina MiSeq (2 × 250 bp, Illumina, Hayward, California, USA) as previously described [6 (link)].
Caputo M., Zoch-Lesniak B., Karch A., Vital M., Meyer F., Klawonn F., Baillot A., Pieper D.H, & Mikolajczyk R.T. (2019). Bacterial community structure and effects of picornavirus infection on the anterior nares microbiome in early childhood. BMC Microbiology, 19, 1.
Full text: Click here
Publication 2019
Bacteria Genes Nose RNA, Ribosomal, 16S Solon
3
Urine Exosome Isolation and Analysis
Cited 22 times
Urine (96 ml) was used for centrifugation. Urine samples were placed in a centrifuge (Beckman L8-70M ultracentrifuge; Beckman Coulter, Fullerton, CA) and centrifuged at 17,000 × g for 10 min at 37 °C (13,600 r.p.m.). The supernatant was saved and the 17,000 × g pellets were resuspended in an isolation solution (250 mM sucrose, 10 mM triethanolamine (pH 7.6)) followed by incubation with either DTT (final concentration of 200 mg/ml; MP Biomedicals, Solon, OH) or vehicle at 37 °C for 5–10 min. During the DTT or vehicle incubation, samples were vortexed every 2 min. The temperature, incubation time, and DTT concentration were chosen on the basis of preliminary experiments (see Supplementary Figures). The incubated suspensions were then transferred to clean centrifuge tubes (Beckman polycarbonate catalog no. 355630) and more isolation solution was added to a final volume of 8 ml. The samples were centrifuged again at 17,000 × g for 10 min at 37 °C. The two supernatants from the 17,000 × g spins were pooled and ultracentrifuged at 200,000 × g for 1 h at 37 °C. Pellets were solubilized in 1.5% SDS and 50 mM Tris-HCl (pH 6.8). These samples were used for immunoblotting as described below. For the electron microcopy of urinary exosomes, pellets obtained from the 200,000 × g spin from each subject were resuspended in 1 × phosphate-buffered saline.
Fernández-Llama P., Khositseth S., Gonzales P.A., Star R.A., Pisitkun T, & Knepper M.A. (2010). Tamm-Horsfall protein and urinary exosome isolation. Kidney International, 77(8), 736-742.
Publication 2010
Centrifugation Electrons Exosomes isolation Pellets, Drug Phosphates polycarbonate Saline Solution Solon Sucrose triethanolamine Tromethamine Urine
4
Bisulfite Modification and Sequencing of Imprinted Genes
Cited 16 times
A sodium bisulphite DNA modification protocol was used as described previously (7 (link)). The example data were derived from bisulphite sequencing of the differentially methylated region (DMR) in the imprinted ZAC (PLAGL1) tumour-suppressor gene (7 (link)). The reference sequence corresponds to nucleotides 48434376–48433838 of the Chromosome 6 assembly, accession NT_025741.14. PCR of bisulphite-modified DNA was carried out using the following primers, which amplify both methylated and unmethylated sequences: Zac9: dCCCAACCRTATCTAAATCAAAACT; and Zac1: dGTGTTTAGGATAGTGTTTGGTT. PCR conditions were as follows: denaturation at 94°C for 3 min followed by 35 cycles of 94°C, 30 s; 58°C, 30 s; 72°C, 30 s and a final extension step at 72°C for 3 min. PCR products were gel-extracted, purified using the Geneclean II kit (MP Biomedicals, Solon, OH, USA) and ligated into pGEM-T Easy vector (Promega, Madison, WI, USA) according to the manufacturer's protocol. Ligations were transformed into DH5α cells and DNA extracted from recombinant clones using the Qiaprep Spin miniprep kit (Qiagen, Valencia, CA, USA).
Carr I.M., Valleley E.M., Cordery S.F., Markham A.F, & Bonthron D.T. (2007). Sequence analysis and editing for bisulphite genomic sequencing projects. Nucleic Acids Research, 35(10), e79.
Publication 2007
Cells Chromosomes, Human, Pair 6 Clone Cells Cloning Vectors hydrogen sulfite Ligation Nucleotides Oligonucleotide Primers PLAGL1 protein, human Promega prostaglandin M sodium bisulfite Solon Tumor Suppressor Genes
5
DSS-Induced Colitis Model in Mice
Cited 13 times
Mice were administered DSS (MP Biomedicals, Solon, OH) at 0.25, 0.5, 1.0 and 4.0% in drinking water ad libitum for 7 days (5 mice per group). Control mice were given water only. During this period, mice were weighed and feces were collected every day and frozen at −20°C. After 7 days, mice were bled via retroorbital plexus and hemolysis-free serum was collected by centrifugation using serum separator tubes (BD Biosciences, Franklin Lakes, NJ). Mice were sacrificed by CO2 euthanasia. Spleen and colon weights and lengths were measured. A small piece (50 mg) of proximal colon was taken for MPO analysis and RNA extraction, and the rest of the colon fixed in 10% buffered formalin for histological studies. For fecal Lcn-2 expression during mucosa healing, mice were given 1.5% DSS in drinking water for 7 days followed by 29 days of water without DSS prior to analysis of fecal Lcn-2.
Chassaing B., Srinivasan G., Delgado M.A., Young A.N., Gewirtz A.T, & Vijay-Kumar M. (2012). Fecal Lipocalin 2, a Sensitive and Broadly Dynamic Non-Invasive Biomarker for Intestinal Inflammation. PLoS ONE, 7(9), e44328.
Full text: Click here
Publication 2012
Centrifugation Colon Euthanasia Feces Formalin Freezing Hemolysis Mice, House Mucous Membrane Serum Solon Spleen

Most recents protocols related to «Solon»

1
Gene Expression Analysis of AGR2 and XBP1
The cDNA template was prepared and amplified via PCR for 30 cycles at 95 °C for 15 s, 54 °C for 15 s, and 72 °C for 30 s (AGR2) or for 33 cycles at 95 °C for 15 s, 57 °C for 15 s, and 72 °C for 30 s (XBP1). 18S rRNA was used as an internal control. PCR products were examined via 2% agarose gel (Amresco, Solon, OH, USA) electrophoresis. The following primers were used: AGR2 Forward-5′ GAGCCAAAAAGGACACAAAGGA 3′, Reverse-5′ TGAGTTGGTCACCCCAACCT 3′; XBP1 Forward-5′ TTACGAGAGAAAACTCATGGCC 3′, Reverse-5′ GGGTCCAAGTTGTCCAGAATGC 3′. 18S rRNA Forward-5′ GCAGCTCACCTACCTGGAGAAATA 3′, Reverse-5′ TGCGTGTGTGGGTCTTTGAA 3′.
Tsai H.W., Chen Y.L., Wang C.I., Hsieh C., Lin Y.H., Chu P.M., Wu Y.H., Huang Y.C, & Chen C.Y. (2023). Anterior gradient 2 induces resistance to sorafenib via endoplasmic reticulum stress regulation in hepatocellular carcinoma. Cancer Cell International, 23, 42.
Full text: Click here
Publication 2023
DNA, Complementary Electrophoresis Oligonucleotide Primers RNA, Ribosomal, 18S Sepharose Solon X-box binding protein 1, human
2
Wheat DNA Extraction and SSR Genotyping
Total genomic DNA was isolated by a micro-extraction protocol (Prabhu et al., 1998 (link)). A polymerase chain reaction (PCR) was performed in a 10 μL total reaction volume containing 2–3 μL (60–70 ng/μL) DNA, 2.0 μL 109 buffer with 25 mM MgCl2, 0.5 μL dNTPs (10 mM) (Bangalore Genei, Bangalore, Karnataka, India), 1.0 μL each forward and reverse SSR primers (20 mM) (Sigma Inc., St. Louis, MO, United States), 0.3 μL Taq polymerase (3 U/μL) (Bangalore Genei, Bangalore, Karnataka, India), and 5.2 μL distilled water (sterile). Amplification of the template DNA was performed according to the annealing conditions for the wmc, gwm, barc, cfa, and cfd series of SSR markers used (Roder et al., 1998 (link); Pestsova et al., 2000 (link); Gupta et al., 2002 (link); Somers et al., 2004 (link); Quarrie et al., 2005 (link); Kumar et al., 2012 (link)). Amplified products were resolved on a 3.2% agarose gel (MetaPhor, Lonza, Rockland, ME, United States), along with a DNA ladder size standard (MBI, Fermentas), stained with 0.5 μg/mL ethidium bromide (Amresco, Solon, OH, United States), and documented with a gel documentation system (Bio-Rad, Hercules, CA, United States). The donor parent, C306, and recurrent parent, HD2733, were screened with 700 SSR markers, including markers associated with targeted traits.
Kumar P.K., Bellundagi A., Krishna H., Mallikarjuna M.G., Thimmappa R.K., Rai N., Shashikumara P., Sinha N., Jain N., Singh P.K., Singh G.P, & Prabhu K.V. (2023). Development of bread wheat (Triticum aestivum L) variety HD3411 following marker-assisted backcross breeding for drought tolerance. Frontiers in Genetics, 14, 1046624.
Full text: Click here
Publication 2023
Buffers DNA, A-Form Ethidium Bromide Genome Magnesium Chloride Oligonucleotide Primers Parent Polymerase Chain Reaction Sepharose Solon Sterility, Reproductive Taq Polymerase Tissue Donors
3
Rearing Aedes aegypti Mosquitoes for Bioassays
A laboratory colony of Aedesaegypti (Rockefeller strain) was maintained at 26 °C, 70% relative humidity (RH) and 10:14 h (L:D photoperiod). Mated females held in plastic cages (11 cm high × 9.5 cm diameter) were fed via an artificial feeding system using citrated bovine blood (HemoStat Laboratories Inc., Dixon, CA, USA). Blood feeding was done routinely using membrane style multiple glass feeders (Chemglass, Life Sciences LLC, Vineland, NJ, USA) attached via tubing to a circulating water bath (HAAKE S7, Thermo-Scientific, Waltham, MA, USA) set at 37 °C. A parafilm M membrane was stretched over the base of the inner chamber of each glass feeder (154 mm2 area). Each feeder was then positioned on the top mesh covering a cage containing mated females. Approximately 350–400 μL of bovine blood was added to the funnel of the glass feeder using a Pasteur pipet (Fisherbrand, Fisher Scientific, Waltham, MA, USA) and the adults were allowed to blood feed for at least an hour. Gravid females were then provided with 10% sucrose solution and allowed to oviposit eggs on moist filter paper lining the inside of a solo ultra clear souffle cup (1.25 Fl. Oz size, Dart Container Corp., Mason, MI, USA) half filled with water placed inside the cage. Filter papers with eggs were placed in Ziploc bags (SC Johnsons, Racine, WI) and stored at 26 °C. Eggs were hatched and batches of approximately 200–250 larvae were reared in plastic trays and larvae were fed with a mixture of rabbit food (ZuPreem, Premium Natural Products, Inc., Mission, KS, USA), liver powder (MP Biomedicals, LLC, Solon, OH, USA) and fish flakes (TetraMin, Tetra GMPH, Mell, Germany) at 2:1:1 ratio. Late third instar larvae were used for our bioassays.
Flor-Weiler L.B., Behle R.W., Berhow M.A., McCormick S.P., Vaughn S.F., Muturi E.J, & Hay W.T. (2023). Bioactivity of brassica seed meals and its compounds as ecofriendly larvicides against mosquitoes. Scientific Reports, 13, 3936.
Full text: Click here
Publication 2023
Adult ARID1A protein, human Bath Biological Assay Blood Cattle Eggs Females Fishes Food Hemostasis Humidity Larva Liver Natural Products Powder Pregnant Women Rabbits Solon Sucrose Tetragonopterus Tissue, Membrane
4
Fabrication of Microfluidic Devices
Microfluidic device was fabricated according to procedures reported elsewhere.34,35 (link) The glass slides were cleaned in a boiling 7× cleaning solution (MP Biomedicals, Solon, OH) for 1.5 h, rinsed copiously with purified water, and then dried with high purity nitrogen gas. The photolithographically patterned photoresist (Microposit S1813, Shipley Corp., Marlborough, MA) was deposited on the glass surface. A patterned glass slide was HF-etched to form a model glass slide and washed with acetone. PDMS was degassed under vacuum for at least 1 h and was then poured onto a clean model glass slide and cured in incubator at 70 °C for 3 h. Small holes were poked with a needle in PDMS mold, serving as inlet and outlet ports for flowing liquid. The PDMS mold and glass slide were placed in a plasma cleaner (PDC-32 G, Harrick, Pleasantville, NY) for 1 min of plasma treatment. Immediately after plasma treatment, PDMS mold and glass slide were pressed together, and annealed at 108 °C for 1 min. PDMS well setup was fabricated by placing a PDMS film (∼0.5 mm) with a 6 mm diameter hole in the middle.
He N, & Zhao T. (2023). Propranolol induces large-scale remodeling of lipid bilayers: tubules, patches, and holes. RSC Advances, 13(11), 7719-7730.
Publication 2023
Acetone Fungus, Filamentous Microchip Analytical Devices Needles Nitrogen Plasma Solon Vacuum
5
DNA Extraction from Filters and Sediments
DNA was extracted as described previously for filters (Orsi et al., 2015 (link)) and sediments (Coskun et al., 2018 (link)). DNA from the sediments was performed exactly as described previously (Coskun et al., 2018 (link)). For the filters, some modifications to the original DNA extraction protocol (Orsi et al., 2015 (link)) were made. For the filters, the silica bead contents from four 2 mL Lysing Matrix E tubes (MP Biomedicals, Solon, OH, USA) was poured into a 15-ml falcon tube containing the filter 4 ml of a sterile-filtered sucrose ethylene-diaminetetraacetic lysis buffer (0.75 M sucrose, 0.05 M Tris-Base, 0.02 M ethylenediaminetetraacetic, 0.4 M NaCl, 4 ml 10% sodium dodecyl sulfate, and pH 9.0) was added to the tubes and then bead beating was performed for 40 s using a Fast-Prep 5G homogenizer (MP Biomedicals, OH, USA) at a speed of 6 m/s. Samples were subsequently heated for 2 min at 99°C. After heating, 25 ml of 20 mg/ml proteinase K was added, and tubes were incubated at 55°C overnight with constant gentle rolling in a Bambino oven. DNA was extracted and purified from the lysate using the DNeasy Blood and Tissue Kit (Qiagen). Extracted DNA was quantified fluorometrically using a Qubit 3.0 Fluorometer (Invitrogen, Eugene, OR, USA).
Coskun Ö.K., Gomez-Saez G.V., Beren M., Ozcan D., Hosgormez H., Einsiedl F, & Orsi W.D. (2023). Carbon metabolism and biogeography of candidate phylum “Candidatus Bipolaricaulota” in geothermal environments of Biga Peninsula, Turkey. Frontiers in Microbiology, 14, 1063139.
Full text: Click here
Publication 2023
BLOOD Buffers Endopeptidase K Ethylenes Silicon Dioxide Sodium Chloride Solon Strains Sucrose Sulfate, Sodium Dodecyl Tissues Tromethamine

Top products related to «Solon»

1
Fastdna spin kit for soil by MP Biomedicals
Sourced in United States, France, Germany, United Kingdom, Australia, Switzerland, Canada, China, Panama, Netherlands, Japan
The FastDNA SPIN Kit for Soil is a product designed for the extraction and purification of DNA from soil samples. The kit provides a fast and efficient method to obtain high-quality DNA from a variety of soil types, which can then be used for downstream molecular biology applications.
2
Dextran sulfate sodium (dss) by MP Biomedicals
Sourced in United States, France, Germany, China, Canada, United Kingdom, Australia, Japan, Panama, Philippines
The DSS is a laboratory instrument designed for the separation and analysis of molecules and particles in complex samples. It utilizes a specialized technique called differential sedimentation to achieve precise separation and characterization of the components within a sample. The core function of the DSS is to provide accurate and reliable data on the size, distribution, and concentration of the analytes present, without interpretation or extrapolation on its intended use.
3
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
4
Methyl thiazolyl tetrazolium (mtt) by Avantor
Sourced in United States, China, Portugal, Germany, France, Poland
MTT is a colorimetric assay used to measure cell metabolic activity. It is a quantitative technique that can be used to assess cell proliferation, viability, and cytotoxicity.
5
Dimethyl sulfoxide (dmso) by Avantor
Sourced in United States, Poland, Germany, France, United Kingdom, China, Belgium, Hungary, Spain, Italy, Denmark, Canada, Portugal
DMSO (Dimethyl Sulfoxide) is a widely used solvent in laboratory applications. It is a colorless, odorless, and polar aprotic liquid that is miscible with water and many organic solvents. DMSO serves as an effective solvent for a variety of compounds and is commonly used in various research and experimental settings.
6
Bovine serum albumin (bsa) by Avantor
Sourced in United States, Germany, United Kingdom, China, France, Switzerland, Poland
BSA (Bovine Serum Albumin) is a widely used laboratory reagent. It functions as a protein stabilizer and blocking agent in various biological assays and procedures.
7
Dimethyl sulfoxide (dmso) by Merck Group
Sourced in United States, Germany, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, India, Canada, Switzerland, Japan, Australia, Spain, Poland, Belgium, Brazil, Czechia, Portugal, Austria, Denmark, Israel, Sweden, Ireland, Hungary, Mexico, Netherlands, Singapore, Indonesia, Slovakia, Cameroon, Norway, Thailand, Chile, Finland, Malaysia, Latvia, New Zealand, Hong Kong, Pakistan, Uruguay, Bangladesh
DMSO is a versatile organic solvent commonly used in laboratory settings. It has a high boiling point, low viscosity, and the ability to dissolve a wide range of polar and non-polar compounds. DMSO's core function is as a solvent, allowing for the effective dissolution and handling of various chemical substances during research and experimentation.
8
Triton x 100 by Avantor
Sourced in United States, United Kingdom, Spain, Germany, China, Sweden, Canada, France, Italy
Triton X-100 is a non-ionic surfactant commonly used in laboratory applications. It is a clear, viscous liquid that can be used to facilitate the solubilization and extraction of proteins and other biomolecules.
9
Fastdna spin kit by MP Biomedicals
Sourced in United States, France, Germany, United Kingdom, China, Canada, Japan
The FastDNA Spin Kit is a laboratory product designed for the efficient extraction and purification of DNA from a variety of sample types. It utilizes a simple and rapid spin-column procedure to isolate high-quality genomic DNA, which can then be used in various downstream applications.
10
Fastprep 24 by MP Biomedicals
Sourced in United States, Germany, France, Australia, United Kingdom, Canada, Spain
The FastPrep-24 is a benchtop homogenizer designed for the rapid and efficient disruption of biological samples. It utilizes high-speed shaking to agitate samples, allowing for the effective lysis of cells and tissues. The FastPrep-24 is a versatile tool suitable for a wide range of applications, including DNA/RNA extraction, protein isolation, and metabolite analysis.

More about "Solon"

Solon, Ohio is a thriving hub of technology and innovation, nestled in the heart of Cuyahoga County.
This affluent suburb of Cleveland boasts a diverse population, excellent schools, and a robust local economy, making it an attractive destination for researchers and businesses alike.
Solon's strategic location, well-developed infrastructure, and skilled workforce create an optimal environment for research and development efforts.
The city is home to a variety of industry-leading companies, drawing in professionals from across the region.
Whether you're working on a groundbreaking scientific project or optimizing your laboratory protocols, Solon offers a wealth of resources and opportunities.
When it comes to DNA extraction and analysis, the FastDNA SPIN Kit for Soil and the FastDNA Spin Kit are popular choices for researchers in Solon.
These kits, coupled with tools like DSS, FBS, MTT, DMSO, BSA, and Triton X-100, provide efficient and reliable solutions for DNA isolation, purification, and quantification.
The FastPrep-24 instrument further enhances the DNA extraction process, ensuring high-quality samples for downstream applications.
Solon's thriving business community and skilled workforce make it an ideal location for researchers to collaborate, innovate, and push the boundaries of scientific discovery.
Whether you're exploring new frontiers in biotechnology, developing cutting-edge medical devices, or revolutionizing the field of renewable energy, Solon offers the perfect blend of resources, infrastructure, and talent to support your research and development efforts.