> Chemicals & Drugs > Organic Chemical > Streptavidin-agarose

Streptavidin-agarose

Most cited protocols related to «Streptavidin-agarose»

Detecting Genome Rearrangements with LAM-HTGTS

Cited 78 times

The procedure starts with the isolation of genomic DNA from cultured cells using a standard proteinase K digestion method. However, prior to DNA extraction, cells must be cultured for a limited duration to allow for nuclease expression to induce cleavage of the bait break-site and for translocation of bait broken ends to prey DSBs. Prey DSBs can be generated by endogenous mechanisms (e.g. activation-induced cytidine deaminase (AID) or recombination activating gene 1/2 (RAG) cleavage sites, transcriptional start sites, etc.) or ectopic mechanisms (e.g. nuclease-generated DSBs). The numerous approaches available to generate cells with bait DSBs (e.g. transfection, viral transduction, nucleofection) are not described in this procedure but are described elsewhere for commonly used cell lines^{6 (link),7 ,9 (link),10 (link)}.
Genomic DNA is sheared by sonication and the bait-prey junctions are then amplified by LAM-PCR¹⁶, using directional primers lying on one or the other side of the bait break-site (or sites). LAM-PCR with a single 5’ biotinylated primer amplifies across the bait sequence into the unknown prey sequence (Fig. 1b). Junction-containing ssDNAs are enriched via binding to streptavidin-coated magnetic beads (Fig. 1b). After washing, bead-bound ssDNAs are unidirectionally ligated to a bridge adapter^{18 (link)}. Adapter-ligated, bead-bound ssDNA fragments are then subjected to nested PCR to incorporate a barcode sequence necessary for de-multiplexing (Fig. 1b). Following an optional blocking digest to suppress the potentially large number of uncut and/or perfectly rejoined or minimally-modified bait sequences (Figs. 1b and 2a,b), a final PCR step fully reconstructs Illumina Miseq adapter sequences at the ends of the amplified bait-prey junction sequence (Figs. 1b and 2c). Samples are then separated on an agarose gel, and a resulting population of 0.5-1 kb fragments are collected and quantified prior to Miseq paired-end sequencing, with a typical 2x 250bp HTGTS library sampling ~1×10⁶ sequence reads.
We generated a custom bioinformatic pipeline that can be used to characterize the bait-prey junctions from the library of sequence reads and should be sufficient for most LAM-HTGTS applications using long paired-end sequence reads. The pipeline is available at http://robinmeyers.github.io/transloc_pipeline/ and consists of both third-party stand-alone tools (e.g. aligners) as well as custom programs built in Perl and R, enabling the processing of sequence reads directly off the sequencer into fully annotated translocation junctions in as few as two commands (Fig. 3). Briefly, library pre-processing steps consist of deconvoluting the barcoded libraries and trimming Illumina primers. The main processing pipeline is made up of three major steps: 1) local read alignment, 2) junction detection, and 3) results filtering. We use bowtie 2 to perform read alignments¹⁹. The junction detection algorithm is based on the Optimal Query Coverage (OQC) algorithm from the YAHA read aligner and breakpoint detector^{20 (link)}. The OQC attempts to achieve the following objective: to optimally infer the full paired-end query sequence from one or more alignments to a reference sequence. The optimal set is determined by using a best-path search algorithm, which enables the detection of not only simple bait-prey junction reads, but also un-joined bait sequences, as well as reads harboring multiple consecutive junctions. The algorithm allows for overlapping alignments, which is required for micro-homology analyses and naturally extends to paired-end reads. The final characterization is an ordered set of alignments termed the Optimal Coverage Set (OCS). The library of resulting OCSs is subjected to a number of filters; the combination of filters and filter parameters used will depend largely on the application. Description of the filters currently employed can also be found at http://robinmeyers.github.io/transloc_pipeline.

Hu J., Meyers R.M., Dong J., Panchakshari R.A., Alt F.W, & Frock R.L. (2016). Detecting DNA Double-Stranded Breaks in Mammalian Genomes by Linear Amplification-mediated High-Throughput Genome-wide Translocation Sequencing (LAM-HTGTS). Nature protocols, 11(5), 853-871.

Publication 2016

1,2-di-(4-sulfamidophenyl)-4-butylpyrazolidine-3,5-dione Cells Cultured Cells Cytidine Deaminase Cytokinesis Digestion DNA, Single-Stranded DNA Library Endopeptidase K Genome isolation Nested Polymerase Chain Reaction Oligonucleotide Primers RAG-1 Gene Sepharose Sequence Alignment Streptavidin Transcription Initiation Site Transfection Translocation, Chromosomal

SAGE Analysis of Mouse Tissues

Cited 35 times

C57BL6 mice (12–15 week old) were obtained by Charles River Laboratories (St. Constant, Québec). They were housed in an air-condition room (19–25°C) with controlled lighting from 07:15 to 19:15 h and were given free access to food (Lab Rodent Diet No. 5002) and water. The GDX and ADX groups had surgery 7 days before death. The intact, GDX and ADX groups received vehicle solution (0.4% (w/v) Methocel A15LV Premium/5% ethanol) 24 hours before sacrifice. DHT (0.1 mg) was injected 3 h prior to killing in GDX+DHT groups. ADX mice received sodium chloride (0.9 g/dl) in their drinking water after the surgery. Gcc (corticosterone, 0.1 mg per mouse) was subcutaneously injected into ADX mice, and the tissues were harvested 3 h after the injection. All animal experimentation was conducted in accord with the requirements of the Canadian Council on Animal Care. All the tissues were from male mice except for female sexual tissues. The tissues were dissected from 15–51 mice, frozen in liquid nitrogen and stocked at -80°C until analysis.
Total RNA was isolated from tissues by using the RNA extraction kit (TRIzol Reagent, Invitrogen Canada Inc., Burlington, ON). Approximately 5 μg of mRNA was extracted with Oligotex mRNA Mini Kit (Qiagen Inc., Mississauga, ON). The SAGE method was performed as previously described [13 (link),14 (link)]. In brief, double-strand cDNA was synthesized from the mRNA using a biotinylated (T)₁₈primer and cDNA synthesis kit (Invitrogen Canada Inc.). The cDNA libraries were digested with the restriction enzyme NlaIII (New England Biolabs Inc., Pickering, ON). The 3'-terminal cDNA fragments were captured using streptavidin-coated magnetic beads (Dynal, Biotech LLC, Brown Deer, WI). After ligation of 2 annealed linker pairs, the cDNA fragments were digested with BsmFI (New England Biolabs Inc.). The blunting kit from Takara Bio Inc. (Otsu, Japan) was used for the blunting and ligation of the two tag populations. The resulting ligation products were amplified by PCR and digested with NlaIII. The band containing the ditags was extracted from the 12% polyacrylamid gel. Using T4 ligase (Invitrogen Canada Inc.), the ditags were self-ligated to form concatemers that were cloned into SphI site of pUC19. White colonies were screened by PCR and agarose gel to select long inserts for automated sequencing (Applied Biosystems 3730, Foster City, CA). The data discussed in this publication have been deposited in NCBIs Gene Expression Omnibus [72 ] and are accessible through GEO Series accession number GSE5915. The sequence and occurrence of each of the transcript tags has been determined using the software SAGEana.pl, an updated version of SAGEparser.pl [73 (link)]. To identify the transcripts, we have generated a SAGEmap of 11 bp tags by the script SAGEmap.pl using the NCBI 10 bp tags SAGEmap, as well as the UniGene Clusters and mitochondrial mRNA sequences. The tag sequences must perfectly match at the last NlaIII restriction site (CATG) at the 3' end of a given transcript. To overcome the lower quality of some EST sequences, the tags that did not identify a well-characterized mRNA were required to match at least two ESTs in the same UniGene Cluster including one EST with a known polyA tail. To identify the transcripts, the sequences of 15 bp SAGE tags were matched with public databases. The tag numbers normalized by 100000 are shown in Tables 1, 2, 3, 4, 5.
The SAGE method has very good reproducibility [73 (link)]. However, several factors can affect this reproducibility such as the failure to provide relevant matching statistics. When a tag matches multiple genes, it is impossible to know the number of copies which are contributed by each gene since the matching stastitic is giving by the mixture of all contributing genes. However, using a 15 bp (CATG + 11 bp) tag, the SAGEparser program decreases the number of multiple matches and increases the number of tags which uniquely identify a transcript [73 (link)]. Therefore, the tags matching multiple genes were excluded from the current report. We used the comparative count display (CCD) test to identify the transcripts that were significantly (p ≤ 0.05) differentially expressed between the groups with more than 2-fold change. CCD test performs a key-by-key comparison of two key-count distributions by generating a probability that the frequency of any key in the distribution differs by more than a given fold factor from the other distribution. This statistical test has already been described elsewhere [74 (link)]. We have used the web site source at Stantford [75 ] to add the comparison of the tissue-specific genes with the UniGene and EST expression database information.

Kouadjo K.E., Nishida Y., Cadrin-Girard J.F., Yoshioka M, & St-Amand J. (2007). Housekeeping and tissue-specific genes in mouse tissues. BMC Genomics, 8, 127.

Publication 2007

Immunoprecipitation of DDX3 Protein

Cited 24 times

HuH-7 cells were washed with PBS, lysed in lysis buffer (20 mM Tris/HCl pH 7.4, 20 mM iodoacetamide, 150 mM NaCl, 1 mM EDTA and 0.5 % Triton X-100) and the lysate was spun briefly to remove nuclei. The clarified cell lysates were incubated with the anti-DDX3 antibodies as described in the text and the immune complexes precipitated using protein G agarose beads (Sigma). Following washes of the Sepharose beads, the immune complexes were analysed by SDS-PAGE followed by Western blotting using biotinylated R648 and anti-streptavidin-horseradish peroxidase (HRP) conjugate.

Angus A.G., Dalrymple D., Boulant S., McGivern D.R., Clayton R.F., Scott M.J., Adair R., Graham S., Owsianka A.M., Targett-Adams P., Li K., Wakita T., McLauchlan J., Lemon S.M, & Patel A.H. (2010). Requirement of cellular DDX3 for hepatitis C virus replication is unrelated to its interaction with the viral core protein. The Journal of General Virology, 91(Pt 1), 122-132.

Publication 2010

Anti-Antibodies Buffers Cell Nucleus Cells Complex, Immune Edetic Acid G-substrate Horseradish Peroxidase Iodoacetamide SDS-PAGE Sepharose Sodium Chloride Streptavidin Triton X-100 Tromethamine

Affinity Capture of Protein-SOMAmer Complexes

Cited 23 times

Not all complexes are able to be captured in the “Catch-3” step of the affinity capture assay (Figure 5), and therefore analyzed by PAGE, because the 3′ end of the SOMAmer is sometimes involved in its structure or interaction with the target. Additional affinity capture examples for the subset of the CKD-related targets whose complexes can be captured on “Catch-3” beads are shown in Figure 5.
50% plasma samples were prepared by diluting ethylene diamine tetraacetic acid (EDTA)-plasma 2X in SB18T with 2 µM Z-Block_2 (the modified nucleotide sequence (AC-BnBn)7-AC). The plasma spike samples were prepared by diluting 500 ng protein with the 50% plasma in SB17T (SB18T with 1 mM EDTA) with 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF) and ethylene glycol tetraacetic acid (EGTA). The plasma samples were prepared by diluting the 50% plasma in SB17T with AEBSF and EGTA. The buffer spike samples were prepared by diluting 500 ng protein in SB17T with AEBSF and EGTA. These samples were combined with 10 pmoles of SOMAmer to give final concentrations of 10% plasma, 2 mM AEBSF, 0.5 mM EGTA, and 100 nM SOMAmer. Complexes were formed by incubating at 37°C for 45 minutes. 50 µL of a 20% slurry of Streptavidin agarose beads (ThermoFisher Scientific) was added to each sample and shaken for 10 minutes at room temperature. The samples were added to a MultiScreen HV Plate to perform washes under vacuum filtration. Each sample was washed one time quickly with 200 µL of SB17T, one time for one minute with 200 µL of 100 µM biotin in SB17T with shaking, one time with 200 µL of SB17T for one minute with shaking, and one time with 200 µL of SB17T for nine minutes with shaking. Proteins in the sample were labeled with both biotin and a fluorophore by incubating each sample in 100 µL of 1 mM EZ Link NHS-PEO4-biotin (Pierce), 0.25 mM NHS-Alexa-647 (Invitrogen) in SB17T for five minutes with shaking. Each sample was washed one time with 200 µL of 20 mM glycine in SB17T and five times with 200 µL of SB17T, shaking each wash for one minute. The final wash was removed using centrifugation at 1000 relative centrifugal force (RCF) for 30 seconds. The beads were resuspended with 100 µL of SB17T. SOMAmers (complexed and free) were released from the beads by exposure under a BlackRay light source (UVP XX-Series Bench Lamps, 365 nm) for ten minutes with shaking. The samples were spun out of the plate by centrifugation at 1000 RCF for 30 seconds. 10 µL of each sample was removed and reserved as “Catch-1 eluate” for SDS-PAGE analysis. The remainder of the samples was captured through the biotinylated proteins by adding 20 µL of a 20% slurry of monomeric Avidin beads and shaking for ten minutes. The beads were transferred to a MultiScreen HV Plate and washed four times with 100 µL of SB17T for one minute with shaking. The final wash was removed using centrifugation at 1000 RCF for 30 seconds. Proteins were eluted from the beads by incubating each sample with 100 µL of 2 mM biotin in SB17T for five minutes with shaking. Each eluate was transferred to 0.4 mg MyOne Streptavidin beads with a bound biotinylated-primer complementary to the 3′ fixed region of the SOMAmer. The samples were incubated for five minutes with shaking to anneal the bead-bound fixed region to the SOMAmer complexes. Each sample was washed two times with 100 µL of 1XSB17T for one minute each with shaking and one time with 100 µL of 1XSB19T (5 mM HEPES, 100 mM NaCl, 5 mM KCl, 5 mM MgCl₂, 1 mM EDTA, 0.05% Tween-20, pH 7.5) for one minute with shaking, all by magnetic separation. The complexes were eluted by incubating with 45 µL of 20 mM NaOH for two minutes with shaking. 40 µL of each eluate was added to 10 µL of 80 mM HCl with 0.05% Tween-20 in a new plate. 10 µL of each sample was removed and reserved as “Catch-2 aptamer-bound eluate” for SDS-PAGE analysis. Gel samples were run on NuPAGE 4–12% Bis Tris Glycine gels (Invitrogen) under reducing and denaturing conditions according to the manufacturer's directions. Gels were imaged on an Alpha Innotech FluorChem Q scanner in the Cy5 channel to image the proteins.

Gold L., Ayers D., Bertino J., Bock C., Bock A., Brody E.N., Carter J., Dalby A.B., Eaton B.E., Fitzwater T., Flather D., Forbes A., Foreman T., Fowler C., Gawande B., Goss M., Gunn M., Gupta S., Halladay D., Heil J., Heilig J., Hicke B., Husar G., Janjic N., Jarvis T., Jennings S., Katilius E., Keeney T.R., Kim N., Koch T.H., Kraemer S., Kroiss L., Le N., Levine D., Lindsey W., Lollo B., Mayfield W., Mehan M., Mehler R., Nelson S.K., Nelson M., Nieuwlandt D., Nikrad M., Ochsner U., Ostroff R.M., Otis M., Parker T., Pietrasiewicz S., Resnicow D.I., Rohloff J., Sanders G., Sattin S., Schneider D., Singer B., Stanton M., Sterkel A., Stewart A., Stratford S., Vaught J.D., Vrkljan M., Walker J.J., Watrobka M., Waugh S., Weiss A., Wilcox S.K., Wolfson A., Wolk S.K., Zhang C, & Zichi D. (2010). Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery. PLoS ONE, 5(12), e15004.

Publication 2010

Exosome Isolation and Characterization from Plasma and Serum

Cited 21 times

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2014

Most recents protocols related to «Streptavidin-agarose»

Biotin Pull-Down Assay for SRE Binding

Biotin pull-down assays were performed as described previously (20 (link)). A 24 nucleotide sequence containing the SRE binding site (−75 to −52, 5’ GCTGTCAGCCCATGTGGCGTGGCC) of the fatty acid synthase promoter. Only the upper strand is shown. Two biotinylated complementary DNAs were synthesized (Bioneer Corporation, Daejeon, Korea) and annealed. Binding assays were performed by incubating 500 μg nuclear proteins with 2 μg biotinylated DNA probe and 25 μl streptavidin-conjugated agarose beads for 1 hr. DNA-protein complexes were analyzed via western blot using the indicated antibodies.

Kim S.M., Kim D.Y., Park J., Moon Y.A, & Han I.O. (2024). Glucosamine increases macrophage lipid accumulation by regulating the mammalian target of rapamycin signaling pathway. BMB Reports, 57(2), 92-97.

Publication 2024

Affinity Enrichment of Palmitoylated Proteins

Timing: 1 day

In this step, biotin tag is added to the newly available free thiol sites which were previously palmitoylated for affinity enrichment. The palmitoylated proteins can be detected using antibody against the protein of interest or if the protein was co-expressed with a tag on it.

32.

Dissolve the protein pellet in 200 μL of flex buffer supplemented with 20 mM Biotin-HPDP.

33.

Incubate the samples at 22°C–24°C with end-over-end rotation for 1 h.

34.

Perform protein precipitation one final time as described in steps 19–24.

35.

Dissolve the protein in 100 μL of flex buffer.

36.

Estimate protein concentration by mini-BCA assay (Figure 1C) using a 10 μL protein sample.

37.

Normalize protein concentration for any variability across samples.a.

Remove a 20 μL aliquot from each sample to load as an input control. Mix the sample with 20 μL of 2x SDS-PAGE Laemmli buffer and store at −20°C until ready to load.

38.

Dilute the remaining 70 μL sample 10 times by adding 630 μL of core buffer. This dilutes the SDS concentration to 0.1%.

39.

Add 30 μL of pre-washed streptavidin agarose beads directly to each sample and vortex for ∼10 s to mix the contents.a.

To first wash and prepare the streptavidin-agarose beads, add 30 μL agarose beads per sample to 500 μL of core buffer.

Spin at 10,000 g for 2 min at room temperature.

Wash the agarose beads for a total of 3 times taking 500 μL core buffer each time. After the final wash step, resuspend the beads in 30 μL of core buffer per sample.

40.

Incubate the samples with end-over-end rotation at 4°C for 18 h–24 h.

41.

The following day, wash the samples with 500 μL of core buffer supplemented with 0.1% SDS and 0.1% NP-40.a.

Repeat washes for a total of 3 times, spinning the samples at 12,000 g for 5 min between each of the washes.

42.

To the pellet (Figure 1D), add 75 μL of 1x Laemmli buffer and store at −20°C until ready for SDS-PAGE.

Leishman S., Aljadeed N.M, & Anand P.K. (2024). Protocol for a semi-quantitative approach to identify protein S-palmitoylation in cultured cells by acyl biotin exchange assay. STAR Protocols, 5(2), 103054.

Publication 2024

Biotinylation and Immobilization of Avi-tagged Proteins

1 mg of purified His₆-Avi-EndoN or His₆-Avi-EndoN_DM were biotinylated as previously described (Li and Sousa 2012 (link)). Briefly, Avi-tagged proteins and BirA were incubated together with 1:0.01 ratio in the presence of 0.3 mM biotin and 5 mM ATP in 25 mM Tris-HCl pH 8 for 4 h at room temperature with rotating. Excess biotin was removed from the reaction and protein was concentrated by filtering though 3 K MWCO Amicon centrifugal units to a final concentration of 0.5 mg/mL protein in PBS. Biotinylation was assessed by analysis of 0.25 μg protein by SDS-PAGE and blotting with HRP-conjugated streptavidin. The blot was developed using an ECL chemiluminescence substrate kit (Thermo Scientific).
A streptavidin-agarose slurry (Sigma) was washed with PBS prior to adding biotinylated His₆-Avi-EndoN or His₆-Avi-EndoN_DM. The protein was incubated with the beads at room temperature for 1 h with rotation. Following incubation, beads were transferred to mini columns (Thermo Scientific) for washing. They were washed with 0.1% BSA in PBS-Tween and then PBS, before storing in PBS at 4 °C.
To conjugate biotinylated His_6-Avi-Endo-N to magnetic streptavidin beads (New England Biolabs), the beads were washed with PBS and incubated with biotinylated EndoN for 1 h at room temperature with rotation. For removing unbound enzyme and other contaminants, the complex was washed three times with 1% SDS in PBS and then seven times with PBS.

Hunter C., Derksen T., Makhsous S., Doll M., Perez S.R., Scott N.E, & Willis L.M. (2024). Site-specific immobilization of the endosialidase reveals QSOX2 is a novel polysialylated protein. Glycobiology, 34(5), cwae026.

Publication 2024

Protein Interaction and Binding Assays

Cells were lysed on ice with IP lysis buffer (50 mM Tris-HCL, pH 7.5, 150 mM NaCl, 0.5% NP-40) containing a protease inhibitor cocktail. Supernatants were obtained after centrifugation and then incubated with streptavidin agarose. The precipitates were washed with IP lysis buffer, boiled with SDS sample buffer, and analyzed by Western blotting.
For GST pulldown, GST and GST-PBD recombinant proteins were expressed in Rosetta (DE3) cells and induced by treatment with 0.5 mM isopropyl-β-D-thiogalactopyranoside at 37 °C for 3 h. GST recombinant proteins were purified with Glutathione Sepharose. Flag-SBP-AMOT was expressed in 293 T cells and purified with streptavidin agarose. When ready for GST pulldown, Glutathione Sepharose was incubated with recombinant protein and Flag-SBP-AMOT mixture on a rotor at 4 °C for 3 h. The precipitates were washed, denatured with 2× SDS sample buffer, and finally detected by SDS–PAGE gels.
For the PAR binding assay, 0.4 μmol GST or GST-PBD recombinant protein was incubated with 1 μL 100 μM biotin (terminal)-PAR polymer and 10 μL streptavidin agarose in a total volume of 400 μL IP lysis buffer. Proteins bound to PAR polymer could be precipitated by streptavidin agarose and detected by anti-GST antibody for WB.

Li Y., Zhang X., Liu N., Liu R., Zhang W., Chen L, & Chen Y. (2024). RNF166 promotes colorectal cancer progression by recognizing and destabilizing poly-ADP-ribosylated angiomotins. Cell Death & Disease, 15(3), 211.

Publication 2024

Affinity Purification of CCL2 Promoter Binding Proteins

Six overlapping segments of 700 bp covering the CCL2 gene promoter were amplified by PCR using primers biotinylated at 3′ or 5′. Then, 5 µg of the mixed amplified sequences were incubated for 2 h at room temperature with 30 µL of streptavidin–agarose beads (Sigma-Aldrich, St. Louis, MI, USA). NS-SV-AC nuclear extract was prepared using the Nuclear Extract Kit (Active Motif, Carlsbad, CA, USA) according to the manufacturer’s instructions. Then, 400 µg of nuclear protein extract were incubated overnight at 4 °C with DNA–streptavidin–agarose beads. The complex was washed 2 times with PBS containing protease inhibitors and 3 times with a buffer containing 20 mM of TrisHCl and 2 mM of CaCl₂. The nuclear proteins–DNA–streptavidin agarose beads complex was resuspended in 150 µL of the latter buffer and stored until further processing.

Chivasso C., Parisis D., Cabrol X., Datlibagi A., Delforge V., Gregoire F., Bolaky N., Soyfoo M.S., Perret J, & Delporte C. (2024). Involvement of CCL2 in Salivary Gland Response to Hyperosmolar Stress Related to Sjögren’s Syndrome. International Journal of Molecular Sciences, 25(2), 915.

Publication 2024

Top products related to «Streptavidin-agarose»

Streptavidin agarose bead by Thermo Fisher Scientific

Sourced in United States, China

Streptavidin agarose beads are a type of affinity chromatography resin. They consist of streptavidin, a protein that binds to biotin, immobilized on agarose beads. These beads are commonly used for the purification and immobilization of biotinylated molecules.

Biotin rna labeling mix by Roche

Sourced in United States, Switzerland, Germany, China

Biotin RNA Labeling Mix is a reagent used for the incorporation of biotin labels into RNA molecules during in vitro transcription or reverse transcription reactions. It enables the detection and analysis of labeled RNA samples through various downstream applications, such as northern blotting, microarray hybridization, or pull-down experiments.

Streptavidin agarose beads by Merck Group

Sourced in United States, Germany

Streptavidin-agarose beads are a laboratory product that consists of streptavidin, a protein derived from the bacterium Streptomyces, immobilized on agarose beads. The core function of these beads is to provide a solid support for affinity-based purification and detection of biotinylated molecules, such as proteins, nucleic acids, and other biomolecules.

Rneasy mini kit by Qiagen

Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway

The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.

Streptavidin agarose resin by Thermo Fisher Scientific

Sourced in United States

Streptavidin agarose resin is a solid-phase support material composed of streptavidin immobilized on an agarose matrix. It is designed for the capture and purification of biotinylated molecules through high-affinity streptavidin-biotin interactions.

Streptavidin agarose by Thermo Fisher Scientific

Sourced in United States, Switzerland

Streptavidin agarose is a solid-phase affinity matrix used for the purification and immobilization of biotinylated molecules. Streptavidin, a protein derived from the bacterium Streptomyces avidinii, is covalently coupled to agarose beads, providing a high-affinity binding site for biotin-labeled compounds.

T7 rna polymerase by Roche

Sourced in United States, Switzerland, Germany

T7 RNA polymerase is an enzyme that transcribes DNA into RNA. It is commonly used in molecular biology and biochemistry research to produce large quantities of RNA from DNA templates.

Rnase free dnase 1 by Roche

Sourced in United States, Switzerland, Germany, Japan, China, Netherlands

RNase-free DNase I is a laboratory enzyme used for the removal of DNA from RNA samples. It functions by cleaving and degrading double-stranded and single-stranded DNA molecules, while leaving RNA molecules intact.

Streptavidin agarose by Merck Group

Sourced in United States

Streptavidin-agarose is a solid-phase affinity resin composed of streptavidin, a protein derived from the bacterium Streptomyces avidinii, covalently coupled to agarose beads. It is designed for the capture and purification of biotinylated molecules from complex samples.

Ez link sulfo nhs ss biotin by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Canada

EZ-Link Sulfo-NHS-SS-Biotin is a water-soluble, cleavable biotinylation reagent. It attaches a biotin group to primary amines on proteins, enabling their detection and purification using streptavidin.

What are the common challenges in optimizing Streptavidin-agarose experiments?

How can PubCompare.ai help with Streptavidin-agarose optimization?

PubCompare.ai's AI-driven protocol comparison tool can be extremely helpful in optimizing Streptavidin-agarose experiments. The platform allows you to efficiently screen protocol literature, leveraging AI to pinpoit critical insights. This helps researchers identify the most effective protocols related to Streptavidin-agarose for their specific research goals. The platform's analysis can highlight key differences in protocol effectiveness, enabling you to choose the best option for reproducibility and accuracy.

What are the different variations or types of Streptavidin-agarose available?

Streptavidin-agarose is available in a variety of formats, including different bead sizes, binding capacities, and agarose matrices. Some common variations include high-capacity Streptavidin-agarose, ultra-pure Streptavidin-agarose, and Streptavidin-agarose with low nonspecific binding. Researchers should carefully consider the specific requirements of their application when selecting the appropriate Streptavidin-agarose product.

What are some common applications of Streptavidin-agarose?

Streptavidin-agarose is widely used for the purification and detection of biotinylated biomolecules, such as proteins, nucleic acids, and lipids. It is a versatile tool that can be employed in a range of applications, including affinity chromatography, pull-down assays, and immobilization of biotinylated probes or antibodies. The high-affinity interaction between Streptavidin and biotin makes Streptavidin-agarose an invaluable reagent for various research and diagnostic procedures.

Can PubCompare.ai help in selecting the optimal Streptavidin-agarose product for my research needs?

Absolutely! PubCompare.ai's AI-driven analysis can help you identify the most effective Streptavidin-agarose products and protocols for your specific research goals. By comparing the performance characteristics and experimental outcomes reported in the literature, the platfrom can guide you towards the best options in terms of binding capacity, selectivity, and reproducibility. This can save you time and ensuire you achieve the most accurate and reliable results in your Streptavidin-agarose-based studies.

More about "Streptavidin-agarose"

Streptavidin-agarose is a widely used affinity chromatography resin composed of the high-affinity streptavidin protein immobilized on an agarose bead matrix.
It is commonly employed for the purification and detection of biotinylated biomolecules, such as proteins, nucleic acids, and lipids.
Optimizing Streptavidin-agarose experiments can be challenging, but PubCompare.ai's AI-driven protocol comparison tool can help researchers identify the most accurate and reproducible procedures from published literature, preprints, and patents.
This powerful feature enables users to easily find the best products and methods, improving research outcomes and facilitating seamless Streptavidin-agarose optimization.
With PubCompare.ai, experienece enhanced efficiency and data quality in your Streptavidin-agarose-based studies.
Streptavidin agarose beads, Biotin RNA Labeling Mix, and Streptavidin-agarose beads are commonly used in conjunction with Streptavidin-agarose for biomolecule purification and detection.
The RNeasy Mini Kit, Streptavidin agarose resin, and Streptavidin agarose can also be utilized in Streptavidin-agarose-based experiments.
T7 RNA polymerase and RNase-free DNase I are often employed in these protocols as well.
Streptavidin-agarose provides a robust and versatile platform for a variety of biotechnology applications, and PubCompare.ai's AI-powered tools can help optimize its use.
EZ-Link Sulfo-NHS-SS-Biotin is another related product that can be used in conjunction with Streptavidin-agarose for specific labeling and purification needs.