Protocol full text hidden due to copyright restrictions
Open the protocol to access the free full text link
>
Chemicals & Drugs
>
Organic Chemical
>
Sulfate, Dextran
Sulfate, Dextran
Sulfate and dextran are important biomolecules with diverse applications in research and industry.
Sulfate is a chemical compound containing sulfur and oxygen, often found in various biological contexts.
Dextran, on the other hand, is a polysaccharide composed of glucose units, widely used in medical and pharmaceutical applications.
PubCompare.ai's AI-driven platform helps researchers optimize their work with sulfate and dextran by providing access to the best protocols from literature, preprints, and patents.
The platform's advanced AI comparisons identify the most effective methods and products, enabling seamless, reproducible, and efficient experimentation.
Explore PubCompare.ai's intuitive tools and data-driven insights to embark on your journey towards advancd sulfate and dextran research today.
Sulfate is a chemical compound containing sulfur and oxygen, often found in various biological contexts.
Dextran, on the other hand, is a polysaccharide composed of glucose units, widely used in medical and pharmaceutical applications.
PubCompare.ai's AI-driven platform helps researchers optimize their work with sulfate and dextran by providing access to the best protocols from literature, preprints, and patents.
The platform's advanced AI comparisons identify the most effective methods and products, enabling seamless, reproducible, and efficient experimentation.
Explore PubCompare.ai's intuitive tools and data-driven insights to embark on your journey towards advancd sulfate and dextran research today.
Most cited protocols related to «Sulfate, Dextran»
Acid Hybridizations, Nucleic
Apolipoprotein A-I
Buffers
Cloning Vectors
DAPI
Embryo
Fishes
Fluorescent Antibody Technique
Formaldehyde
formamide
Goat
Immunoglobulins
Microscopy
Microscopy, Confocal, Laser Scanning
Reading Frames
Salmo salar
Sperm
Submersion
Sulfate, Dextran
Tween 20
vanadyl ribonucleoside complex
Embryos were fixed in 4% paraformaldehyde at 4°C overnight and stored in methanol at -20°C. 24-hpf embryos were permeabilized in 2% hydrogen peroxide in methanol for 20 minutes (min) at room temperature (RT) and stepwise rehydrated to PBST (phosphate buffered saline, 0.1% Tween-20 pH 7.3). After rehydration, embryos were further permeabilized by a 10-min proteinase K treatment and postfixed for 20 min with 4% paraformaldehyde at RT. Prehybridization, probe hybridization and washes were performed as described [5 (link)] except for addition of 5% dextran sulfate to the hybridization buffer. In two-color experiments, digoxigenin- and dinitrophenol-labeled probes were mixed together in hybridization buffer at the appropriate concentrations and hybridized simultaneously.
Acid Hybridizations, Nucleic
Buffers
Digoxigenin
Dinitrophenols
Embryo
Endopeptidase K
Methanol
paraform
Peroxide, Hydrogen
Phosphates
Rehydration
Saline Solution
Sulfate, Dextran
Tween 20
BLOOD
Calcium, Dietary
Cholesterol
Cholesterol Oxidase
Determination, Blood Pressure
Dextran
Diagnosis
Diet
Drugs, Non-Prescription
Enzymes
Fibrosis
Glucose
Hemoglobin A, Glycosylated
Hexokinase
High-Performance Liquid Chromatographies
High Density Lipoprotein Cholesterol
Index, Body Mass
Low-Density Lipoproteins
Magnesium
Mental Recall
Plasma
Potassium
Saturated Fatty Acid
Serum
Sphygmomanometers
Sulfate, Dextran
Sulfate, Magnesium
Therapy, Diet
The rate constant for SOMAmer:protein complex dissociation was determined for each aptamer by measuring the fraction of pre-formed aptamer:protein complexes that remain bound after addition of a competitor as a function of time. Radiolabled SOMAmer was renatured as described above. Approximately 5×10–11 M SOMAmer was equilibrated in SB18T (40 mM HEPES, 100 mM NaCl, 5 mM KCl, 5 mM MgCl2, 0.05% Tween-20 at pH 7.5) at 37°C with protein at a concentration 10X greater than the measured Kd value. Samples were then diluted 2X with 40 nM non-labeled SOMAmer or 0.3 mM dextran sulfate in SB18T at various time points. Complexes were partitioned to separate free aptamer from protein:aptamer complexes. The type of partitioning was dependent upon the protein used since not all proteins bind to the same type of partitioning resin. For LBP and Histone H1.2, Zorbax PSM-300A (Agilent Technologies) resin was used for partitioning; for Kallistatin, MyOne TALON beads were used; for biotinylated-TIG2, MyOne Streptavidin beads were used. Complexes were captured on the appropriate resin, and the sample was passed through a MultiScreen HV Plate under vacuum. The samples were washed with SB18T. The MultiScreen HV Plates were phosphorimaged and the amount of radioactivity in each sample quantified using a FUJI FLA-3000. The fraction of complex remaining was plotted as a function of time, and the dissociation rate constant was determined by fitting the data to an analytic expression for bimolecular dissociation kinetics using non-linear regression.
Claw
HEPES
Histone H1
kallistatin
Kinetics
Magnesium Chloride
Protein C
Proteins
Radioactivity
Resins, Plant
Sodium Chloride
Streptavidin
Sulfate, Dextran
Tween 20
Vacuum
Imaging platform and automated fluidics delivery system were similar to those previously described with some modifications. In brief, the flow cell on the sample was first connected to the automated fluidics system. Then the region of interests(ROI) was registered using nuclei signals stained with 10 μg/mL of DAPI (D8417; Sigma). For cell culture experiments, blank images containing beads only were first imaged before the first round of serial hybridization. Each serial hybridization buffer contained three unique sequences with different concentrations of 15-nt readouts conjugated to either Alexa Fluor 647(50 nM), Cy3B(50 nM) or Alexa Fluor 488(100 nM) in EC buffer made from 10% Ethylene Carbonate (E26258; Sigma), 10% Dextran Sulfate (D4911; Sigma), 4X SSC and 1:100 dilution of SUPERase In RNase Inhibitor. The 100 μL of serial hybridization buffers for 80 rounds of seqFISH+ imaging with a repeat for round 1 (in total 81 rounds) were pipetted into a 96 well-plate. During each serial hybridization, the automated sampler will move to the well of the designated hyb buffer and flow the 100 μL hyb solution through a multichannel fluidic valves (EZ1213-820-4; IDEX Health & Science) to the flow cell (required ~25 μL) using a syringe pump (63133–01, Hamilton Company). The serial hyb solution was incubated for 17 minutes for cell culture experiments and 20 minutes for tissue slice experiments at room temperature. After serial hybridization, the sample was washed with ~300 μL of 10% formamide wash buffer (10% formamide and 0.1% Triton X-100 in 2X SSC) to remove excess readout probes and non-specific binding. Then, the sample was rinsed with ~200 μL of 4X SSC supplemented with 1:1000 dilution of SUPERase In RNase Inhibitor before stained with DAPI solution (10 μg/mL of DAPI, 4X SSC, and 1:1000 dilution of SUPERase In RNase Inhibitor) for ~15 seconds. Next, an anti-bleaching buffer solution made of 10% (w/v) glucose, 1:100 diluted catalase (Sigma C3155), 0.5 mg/mL Glucose oxidase (Sigma G2133), 0.02 U/μL SUPERase In RNase Inhibitor, 50 mM pH8 Tris-HCl in 4x SSC was flowed through the samples. Imaging was done with the microscope (Leica, DMi8) equipped with a confocal scanner unit (Yokogawa CSU-W1), a sCMOS camera (Andor Zyla 4.2 Plus), 63 × oil objective lens (Leica 1.40 NA), and a motorized stage (ASI MS2000). Lasers from CNI and filter sets from Semrock were used. Snapshots were acquired with 0.35 μm z steps for two z slices per FOV across 647-nm, 561-nm, 488-nm and 405-nm fluorescent channels. After imaging, stripping buffer made from 55% formamide and 0.1% Triton-X 100 in 2x SSC was flowed through for 1 minute, followed by an incubation time of 1 minute before rinsing with 4X SSC solution. In general, the 15-nt readouts were stripped off within seconds, and a 2-minute wash ensured the removal of any residual signal. The serial hybridization, imaging, and signal extinguishing steps were repeated for 80-rounds. Then, stainings buffer for segmentation purpose consists of 10 μg/mL of DAPI, 50nM LNA T20-Alexa 647, and 1: 100 dilution of Nissl stainings (N21480; Invitrogen) in 1x PBS was flowed in and allowed to incubate for 30 mins at room temperature before imaging. The integration of automated fluidics delivery system and imaging was controlled by a custom written script in Micro-Manager32
Acid Hybridizations, Nucleic
alexa fluor 488
Alexa Fluor 647
Buffers
Catalase
Cell Culture Techniques
Cell Nucleus
Cells
DAPI
ethylene carbonate
formamide
Glucose
Lens, Crystalline
Microscopy
Neoplasm Metastasis
Obstetric Delivery
Oxidase, Glucose
Ribonucleases
ribonuclease U
Staining
Sulfate, Dextran
Syringes
Technique, Dilution
Tissues
Triton X-100
Tromethamine
Most recents protocols related to «Sulfate, Dextran»
smiFISH was performed with GFP probes on mouse PCNs (P0 and DIV9) cultured on 15-mm glass coverslips as described previously44 (link), with some modifications. The media was aspirated, and cells were washed with 1× PBS. Cells were fixed with 4% paraformaldehyde (PFA) for 20 minutes at room temperature and then rinsed twice with 1× PBS. Permeabilization was done with 70% ethanol at 4 °C overnight. The cells were washed with 15% formamide freshly prepared in 1× SSC buffer for 15 minutes at room temperature. Then, 50 μl of hybridization mix (1 μl of FLAP hybridized probes in 2× SSC, 10% formamide and 10% w/v dextran sulfate) was added to each coverslip and incubated overnight at 37 °C in a humid chamber. The cells were washed twice for 30 minutes with freshly prepared 15% formamide/1× SSC at 37 °C in the dark. During the second wash, DAPI nuclear stain was added (5 ng μl−1). The cells were washed twice more in 2× SSC, and the coverslips were mounted on a glass slide with 10 μl of ProLong Glass mounting medium (Thermo Fisher Scientific, P36980) without DAPI. Then, 3 × 3 tiled z-stack images were acquired using a Dragonfly 200 spinning disc confocal microscope with a ×63 oil objective and stitched using Fusion acquisition software. Consistent laser intensity and exposure times were used across samples to detect DAPI, EGFP protein and Quasar 570 (EGFP RNA).
Acid Hybridizations, Nucleic
Anisoptera
Buffers
Cells
DAPI
enhanced green fluorescent protein
Ethanol
formamide
Microscopy, Confocal
Mus
paraform
Stains
Sulfate, Dextran
Surgical Flaps
Generally, FISH experiments were performed as previously described (Arora et al., 2022b (link)). CAD cells expressing reporter constructs were induced with 2 μg/mL doxycycline for 48 hr. Cells were then plated on PDL coated glass coverslips (neuVitro) within 12-well plates at approximately 2.5×104 cells per well in full growth media. Cells were allowed to attach for 2 hr before changing to serum depleted media supplemented with 2 μg/mL doxycycline for 48 hr.
C2bbe1 cells expressing reporter constructs were seeded on PDL coated glass coverslips at high density and allowed to differentiate into monolayers for 7 days in full growth media supplemented with 2 μg/mL doxycycline. Media was changed every 3–4 days. Cells were washed once with PBS before being fixed with 3.7% formaldehyde (Fisher Scientific) for 10 min at room temperature. Following 2 PBS washes, cells were permeabilized with 70% Ethanol (VWR) at 4 °C for 6–8 hr or at room temperature for 2 hr. Cells were incubated in smFISH wash buffer (2 x SSC with 10% formamide) at room temperature for 5 min. Per coverslip, 2 μL of Stellaris FISH Probes, or hybridized smiFISH probes were added to 200 μL of hybridization Buffer (10% dextran sulfate, 10% formamide in 2 X SSC). Using a homemade hybridization chamber made from an empty tip box with wet paper towels and parafilm, coverslips were incubated cell side down in the hybridization buffer overnight at 37 °C. Coverslips were washed with wash buffer in fresh 12-well plates cell side up for 30 min at 37 °C in the dark. A total of 100 ng/mL DAPI was diluted in wash buffer and added to the cells in the dark at 37 °C for 30 min. Cells were then washed for 5 min at room temperature with wash buffer.
Coverslips were then mounted onto slides with Fluoromount G and sealed with nail polish. Slides were imaged at 60 X on a widefield DeltaVision Microscope with consistent laser intensity and exposure times across samples. DAPI was imaged with 10% transmittance with an exposure of 0.05 s. FISH probes were visualized in the TRITC channel with 100% transmittance and an exposure of 0.15 s. Z stacks were collected of approximately 68 images, 0.2 µm apart for a total thickness of 13.6 µm.
C2bbe1 cells expressing reporter constructs were seeded on PDL coated glass coverslips at high density and allowed to differentiate into monolayers for 7 days in full growth media supplemented with 2 μg/mL doxycycline. Media was changed every 3–4 days. Cells were washed once with PBS before being fixed with 3.7% formaldehyde (Fisher Scientific) for 10 min at room temperature. Following 2 PBS washes, cells were permeabilized with 70% Ethanol (VWR) at 4 °C for 6–8 hr or at room temperature for 2 hr. Cells were incubated in smFISH wash buffer (2 x SSC with 10% formamide) at room temperature for 5 min. Per coverslip, 2 μL of Stellaris FISH Probes, or hybridized smiFISH probes were added to 200 μL of hybridization Buffer (10% dextran sulfate, 10% formamide in 2 X SSC). Using a homemade hybridization chamber made from an empty tip box with wet paper towels and parafilm, coverslips were incubated cell side down in the hybridization buffer overnight at 37 °C. Coverslips were washed with wash buffer in fresh 12-well plates cell side up for 30 min at 37 °C in the dark. A total of 100 ng/mL DAPI was diluted in wash buffer and added to the cells in the dark at 37 °C for 30 min. Cells were then washed for 5 min at room temperature with wash buffer.
Coverslips were then mounted onto slides with Fluoromount G and sealed with nail polish. Slides were imaged at 60 X on a widefield DeltaVision Microscope with consistent laser intensity and exposure times across samples. DAPI was imaged with 10% transmittance with an exposure of 0.05 s. FISH probes were visualized in the TRITC channel with 100% transmittance and an exposure of 0.15 s. Z stacks were collected of approximately 68 images, 0.2 µm apart for a total thickness of 13.6 µm.
Acid Hybridizations, Nucleic
Buffers
CD244 protein, human
Cells
Culture Media
DAPI
Doxycycline
Ethanol
Fishes
Formaldehyde
formamide
Laser Microscopy
Serum
Sulfate, Dextran
tetramethylrhodamine isothiocyanate
Telomere DNA FISH were performed as described (20 (link)). Briefly, Hela cells grown on eight-well chambered slide (Nunc Lab-Tek II, 155409) were transfected with ATM-SPARK plasmid. Thirty minutes after challenged with NCS, cells were fixed in 4% (w/v) paraformaldehyde for 10 min at room temperature. After fixation, cells were permeabilized in 1× phosphate-buffered saline (PBS) with 0.5% Triton X-100 for 10 min at room temperature. Cells were incubated in 0.1 N of HCl for 5 min and washed twice in 2× saline-sodium citrate (SSC) with 0.1% Tween 20 (SSCT) for 2 min. After incubated in 2× SSCT with 50% formamide for 1 hour at 60°C, the well was loaded with 150 μl of ISH solution [2× SSCT, 50% (v/v) formamide, 10% dextran sulfate, ribonuclease A (400 ng/μl), and 100 nM probe]. After denaturation at 80°C for 3 min, cells were incubated overnight at 44°C.
After hybridization, cells were washed four times in 2× SSCT at 60°C and rinsed in 1× PBS for 1 min. Cells then incubated with 1 μM Atto 550–labeled imager in PBS and washed twice in 1× PBS. The cells were blocked with 2% bovine serum albumin and 10% goat serum in PBS. Then stained with anti-GFP antibody (1:200 dilution; Abcam, Ab290) 3 hours at room temperature. After washing three times with phosphate-buffered saline with 0.1% Tween 20 (PBST), the cells incubated with Alexa Fluor 488–conjugated secondary antibodies (1:200 dilution; Cell Signaling Technology, #4412) at room temperature for 1 hour. The telomere probe sequence is ACATCATCATGGGCCTTTTGGCCCATGATGATGTATGATGATG/3InvdT/, and the Imager sequence is ATGATGATGTATGATGATGT.
After hybridization, cells were washed four times in 2× SSCT at 60°C and rinsed in 1× PBS for 1 min. Cells then incubated with 1 μM Atto 550–labeled imager in PBS and washed twice in 1× PBS. The cells were blocked with 2% bovine serum albumin and 10% goat serum in PBS. Then stained with anti-GFP antibody (1:200 dilution; Abcam, Ab290) 3 hours at room temperature. After washing three times with phosphate-buffered saline with 0.1% Tween 20 (PBST), the cells incubated with Alexa Fluor 488–conjugated secondary antibodies (1:200 dilution; Cell Signaling Technology, #4412) at room temperature for 1 hour. The telomere probe sequence is ACATCATCATGGGCCTTTTGGCCCATGATGATGTATGATGATG/3InvdT/, and the Imager sequence is ATGATGATGTATGATGATGT.
Acid Hybridizations, Nucleic
alexa fluor 488
Antibodies
Antibodies, Anti-Idiotypic
Cells
Fishes
formamide
Goat
HeLa Cells
paraform
Phosphates
Plasmids
Ribonucleases
Saline Solution
Serum
Serum Albumin, Bovine
Sodium Citrate
Sulfate, Dextran
Technique, Dilution
Telomere
Triton X-100
Tween 20
The effect of Oftasecur and Visuprime on HSV-1 infection was evaluated by co-treatment, cell and viral pretreatment and post-treatment via plaque reduction assays in infected cells. In the co-treatment assay, the eye drops at the selected volumes and the viral suspension at a density of 2 × 103 plaque-forming units/mL (PFU/mL) were simultaneously inoculated on the cell monolayer in DMEM without FBS for 1 h at 37 °C. In cell pre-treatment, cell monolayers were first exposed to ophthalmic solutions for 1 h at 37 °C and then infected with the viral suspension at 2 × 103 PFU/mL in DMEM without FBS for 1 h at 37 °C. In virus pretreatment, the viral suspension at 2 × 104 PFU/mL was exposed to formulations for 1–10–30 min and 1 h, diluted 1:10 in DMEM without FBS, and used to infect cell monolayers, for 1 h. Lastly, in post-treatment, cells were first infected with the viral suspension at the density of 2 × 103 PFU/mL in DMEM without FBS for 1 h at 37 °C; then, they were washed and treated with the formulations at the selected volumes for 1 h. Regarding CTRL+, melittin (5 µM) was applied in the co-treatment and virus pretreatment, dextran-sulfate (1 µM) in cell pretreatment, and aciclovir (5 µM) in post-treatment, whereas uninfected cells constituted CTRL−. After the viral adsorption time, the cell monolayer was washed twice with 1 × PBS and covered with a culture medium supplemented with 5% carboxymethylcellulose. After 48 h, Vero CCL-81 cells were fixed with 4% formaldehyde (Sigma-Aldrich, St. Louis, MO, USA) and stained with 0.5% crystal violet (Sigma-Aldrich, St. Louis, MO, USA). The plaques were counted and related to the coincident ones at the CTRL− to obtain the percentage of viral inhibition [31 (link)]. Lastly, the virus pretreatment assay was also confirmed using GFP-engineered HSV-1, exposing to 12.5–3.12 µL of Oftasecur and 6.25–1.56 µL of Visuprime for 1 h, prior to cell infection. Bright-field and fluorescent images were acquired by the Nikon ECLIPSE Ti2-U fluorescence microscope (Nikon Europe B.V., Amsterdam, The Netherlands) after 48 h of exposure. The fluorescence intensity was gained by Cytation 5 plate reader (Cytation 5, BioTek, Milan, Italy).
Acyclovir
Adsorption
Biological Assay
Carboxymethylcellulose
Cells
Culture Media
Dental Plaque
Eye Drops
Fluorescence
Formaldehyde
Herpes Simplex
Human Herpesvirus 1
Infection
Melitten
Microscopy, Fluorescence
Ophthalmic Solution
Psychological Inhibition
Senile Plaques
Sulfate, Dextran
Vero Cells
Violet, Gentian
Virus
Protocol full text hidden due to copyright restrictions
Open the protocol to access the free full text link
2',5'-oligoadenylate
Acid Hybridizations, Nucleic
alexa fluor 488
ammoniacal ferrous citrate
Antibodies, Anti-Idiotypic
Aves
Buffers
Cells
Chickens
Culture Media
DAPI
Dyes
Ethanol
formamide
Gold
Kinetics
Light
Luciferases, Renilla
Metals
Microscopy
Molecular Probes
Nucleotides
paraform
Protein Biosynthesis
RNA, Messenger
Sea Pansy
Stem, Plant
Sulfate, Dextran
Tissues
Transcription, Genetic
Top products related to «Sulfate, Dextran»
Sourced in United States, Germany, Belgium, Macao
Dextran sulfate is a polysaccharide derived from the fermentation of sucrose. It is a high-molecular-weight anionic compound commonly used in laboratory research as a precipitation agent and for the separation of biomolecules.
Sourced in United States, United Kingdom, Germany, Canada, Japan, France, Switzerland, Panama, Spain, China, Italy
Vectashield is a non-hardening, aqueous-based mounting medium designed for use with fluorescent-labeled specimens. It is formulated to retard photobleaching of fluorescent dyes and provides excellent preservation of fluorescent signals.
Sourced in United States, Germany, United Kingdom, China, Poland, Israel, France, Ireland, Canada, Spain, Japan
Formamide is a colorless, odorless, and hygroscopic liquid. It is a common laboratory solvent used in various chemical and biological applications. Formamide has a high boiling point and is miscible with water and many organic solvents.
Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore
DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.
Sourced in United States
Dextran sulphate is a polymeric carbohydrate derivative used as a laboratory reagent. It is a linear, highly sulfated polysaccharide produced from the bacterial fermentation of sucrose. Dextran sulphate is primarily used as an anticoagulant and precipitating agent in various biochemical applications.
Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand
DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.
Sourced in United States, United Kingdom
The Stellaris Probe Designer is a web-based tool that enables the design of custom fluorescent probes for use in gene expression analysis and other molecular biology applications. The tool provides access to a comprehensive database of gene sequences and supports the design of probes that target specific regions of interest.
Sourced in Japan
The Hitachi 7150 Autoanalyzer is a compact, automated biochemical analyzer designed for routine clinical chemistry testing. It performs a variety of tests, including measurements of proteins, enzymes, and metabolites, using a combination of photometric and potentiometric detection methods.
Sourced in United States, Canada, United Kingdom, Germany, Japan, France, Spain, Italy
Vectashield mounting medium is a proprietary aqueous-based formulation used for the preservation and visualization of fluorescent stained specimens. It is designed to maintain the brightness and stability of fluorescent dyes during microscopic examination.
Sourced in United States
Yeast tRNA is a type of transfer ribonucleic acid (tRNA) isolated from the baker's yeast, Saccharomyces cerevisiae. tRNA molecules are responsible for the translation of genetic information from messenger RNA (mRNA) into proteins within cells. The core function of yeast tRNA is to facilitate the incorporation of amino acids into the growing polypeptide chain during protein synthesis.
More about "Sulfate, Dextran"
Sulfate and Dextran: Versatile Biomolecules for Cutting-Edge Research Sulfate, a chemical compound containing sulfur and oxygen, is a ubiquitous presence in various biological contexts.
From its role in sulfur metabolism to its applications in medical research, sulfate is a vital component in numerous scientific endeavours.
Dextran, on the other hand, is a polysaccharide composed of glucose units, widely utilized in medical and pharmaceutical applications, such as blood plasma substitutes and drug delivery systems.
Dextran sulfate, a derivative of dextran, has found widespread use in fields like immunology, cell biology, and nucleic acid research.
This versatile compound has been employed in techniques like Vectashield mounting medium, which is used to preserve fluorescent signals in microscopy studies.
Formamide, another key player, is commonly used as a solvent in DNA hybridization experiments, including the Stellaris Probe Designer, a tool for designing fluorescent probes for RNA detection.
The Hitachi 7150 Autoanalyzer, a sophisticated instrument, has been instrumental in the quantitative analysis of sulfate and other analytes in biological samples.
DAPI, a fluorescent stain, is frequently used in conjunction with dextran-based reagents to visualize cellular structures and nucleic acids.
PubCompare.ai's AI-driven platform is a valuable resource for researchers navigating the complex world of sulfate and dextran.
By providing access to the best protocols from literature, preprints, and patents, the platform empowers scientists to optimize their experiments and achieve reproducible, efficient results.
The advanced AI comparisons offered by PubCompare.ai help identify the most effective methods and products, ensuring seamless and data-driven research.
Embark on your journey towards cutting-edge sulfate and dextran research with the help of PubCompare.ai's intuitive tools and data-driven insights.
Discover the power of this platform to unlock new possibilities in your scientific endeavors.
From its role in sulfur metabolism to its applications in medical research, sulfate is a vital component in numerous scientific endeavours.
Dextran, on the other hand, is a polysaccharide composed of glucose units, widely utilized in medical and pharmaceutical applications, such as blood plasma substitutes and drug delivery systems.
Dextran sulfate, a derivative of dextran, has found widespread use in fields like immunology, cell biology, and nucleic acid research.
This versatile compound has been employed in techniques like Vectashield mounting medium, which is used to preserve fluorescent signals in microscopy studies.
Formamide, another key player, is commonly used as a solvent in DNA hybridization experiments, including the Stellaris Probe Designer, a tool for designing fluorescent probes for RNA detection.
The Hitachi 7150 Autoanalyzer, a sophisticated instrument, has been instrumental in the quantitative analysis of sulfate and other analytes in biological samples.
DAPI, a fluorescent stain, is frequently used in conjunction with dextran-based reagents to visualize cellular structures and nucleic acids.
PubCompare.ai's AI-driven platform is a valuable resource for researchers navigating the complex world of sulfate and dextran.
By providing access to the best protocols from literature, preprints, and patents, the platform empowers scientists to optimize their experiments and achieve reproducible, efficient results.
The advanced AI comparisons offered by PubCompare.ai help identify the most effective methods and products, ensuring seamless and data-driven research.
Embark on your journey towards cutting-edge sulfate and dextran research with the help of PubCompare.ai's intuitive tools and data-driven insights.
Discover the power of this platform to unlock new possibilities in your scientific endeavors.