Tanshinone II A

Due to the disadvantages of biological experiments as time-consuming and high-cost, identification of ADME (absorption, distribution, metabolism and excretion) properties by in silico tools has now become an inevitable paradigm in pharmaceutical research. In this study, three ADME-related models, including the evaluation of oral bioavailability (OB), Caco-2 permeability and drug-likeness (DL), were employed to identify the potential bioactive compounds of ASC.
Oral bioavailability. OB prescreening is used to determine the fraction of the oral dose of bioactive compound which reaches systemic circulation in the TCM remedy. Here, a reliable in silico model OBioavail 1.1^{59 (link)} which integrates the metabolism (P450 3A4) and transport (P-glycoprotein) information was employed to calculate the OB values of herbal ingredients.
Caco-2 permeability. The Caco-2 cell monolayers are widely applied as standard permeability-screening assay for prediction of the compound’s intestinal absorption and fraction of the oral dose absorbed in humans^{60 (link)}. The Caco-2 cell permeation values of all molecules are calculated by in silico model using the VolSurf approach⁶¹ .
Drug-likeness evaluation. Drug-likeness is a qualitative profile used in drug design to evaluate whether a compound is chemically suitable for the drug, and how drug-like a molecule is with respect to parameters affecting its pharmacodynamic and pharmacokinetic profiles which ultimately impact its ADME properties^{62 (link)}. In order to identify drug-like compounds, we apply a database-dependent model using the Tanimoto coefficient to calculate the DL (see Eq. (1)) of each compound in ASC. $$\mathrm{f}(x,y)=\frac{xy}{{\left|x\right|}^2+{\left|y\right|}^2-xy}$$
x represents the molecular parameters of herbal ingredients, and y represents the average molecular properties in DrugBank database (available online: http://www.drugbank.ca).
The OB, Caco-2 permeability and DL of all compounds are described in Table S9.
In this work, the compounds of OB ≥ 30%, Caco-2 > −0. 4 and DL ≥ 0.18 were selected for subsequent research, others are excluded.
According to these indexes, several compounds were included: 1,2,5,6-tetrahydrotanshinone, 3-beta-Hydroxymethyllenetanshiquinone, 3α-hydroxytanshinone IIA, 4-methylenemiltirone, 537-15-5, 87112-49-0, 97399-70-7, 97411-46-6, C09092, Cryptotanshinone, Dan-shexinkum D, Danshenol A, Danshenol B, Danshenspiroketallactone, Dehydrotanshinone IIA, Deoxyneocryptotanshinone, Dihydrotanshinlactone, Dihydrotanshinone I, Epidanshenspiroketallactone, Formyltanshinone, Isocryptotanshinone, Isoimperatorin, Isotanshinone II, Luteolin, Manool, Methylenetanshinquinone, Microstegiol, Miltionone I, Miltionone II, Miltipolone, Miltirone II, Miltirone, MOL007155, MOL007140, MOL007036, MOL007048, MOL007050, MOL007070, Neocryptotanshinone II, Neocryptotanshinone, NSC122421, Poriferast-5-en-3beta-ol, Poriferasterol, Przewaquinone E, Przewaquinone F, Prolithospermic acid, Przewalskin A, Przewalskin B, Przewaquinone B, Przewaquinone C, Salvianolic acid G, Salvilenone I, Salvilenone, Salviolone, Sclareol, Sugiol, Tanshinaldehyde, Tanshindiol B, Tanshinone VI, Tanshinone IIA, α-Amyrin, 1,7-Dihydroxy-3,9-dimethoxy pterocarpene, 3,9-di-O-methylnissolin, 64474-51-7, 64997-52-0, 7-O-methylisomucronulatol, 73340-41-7, Bifendate, Calycosin, Formononetin, Hederagenin, Isodalbergin, Isorhamnetin, Jaranol, Kaempferol, Mairin, Quercetin.

Human embryonic kidney (HEK) 293 cells were engineered to express human renin (Genomeditech, Shanghai, China). The stably transfected cells were cultured in Dulbecco’s modified Eagle medium (Biosera, Nuaille, France) containing 10% foetal bovine serum at 37 °C in a humidified atmosphere of 95% air and 5% CO₂, and treated with vehicle (DMSO) or aliskiren (10⁻⁶ M, Sigma, St. Louis, MO) or well-known active compounds (National Institutes for Food and Drug Control, Beijing, China) in Salvia miltiorrhiza, including tanshinone IIA, succinic acid, ferulic acid, caffeic acid and danshinolic acid, with different final concentrations (10⁻⁸, 10⁻⁷, 10⁻⁶ M). After drug treatment for 24 h, cell protein was isolated by RIPA lysis buffer (Beyotime, Beijing, China) for further analysis on renin activity and ANG II protein expression.

Intracellular Ca²⁺ transients were measured with fura-2 fluorescence at room temperature (21 ± 2°C) by a dual excitation wavelength fluorescence method as described previously (Grynkiewicz et al., 1985 (link); Wang et al., 2003 (link)) using the TILLvisION 4.0 imaging system (Till Photonics, Gräfelfing, Germany). Freshly isolated mesenteric VSMCs of rats were loaded with 5 μM fura-2/AM for 30 min. The dye was excited by alternatively using 340 nm (20 ms) and 380 nm wavelengths (10 ms) lights with a Xenon 75 W arc lamp. The emission fluorescence at 510 nm was detected by a photomultiplier tube. Photobleaching was minimized by the use of neutral density filters and shuttering excitation light (97 ms) during experiments. The intracellular free Ca²⁺ concentration ([Ca²⁺]_i) was calculated using the following equation: [Ca²⁺]_i = Kd ^∗(Sf2/Sb2)^∗ (R – Rmin)/(Rmax – R), where Kd as the dissociation constant for fura-2/calcium complex, R as the ratio of the emission fluorescence evoked by 340 and 380 nm light excitation, Rmin as the ratio obtained in the Ca²⁺-free Tyrode’s solution with 10 mM EGTA, Rmax as the ratio obtained in the saturating [Ca²⁺] solution (10 mM [Ca²⁺] Tyrode’s solution), and Sf2/Sb2 as the ratio of emission fluorescence evoked by 380 nm excitation in Ca²⁺-free Tyrode’s solution and saturating [Ca²⁺] solution. A Kd value of 224 nM was used for the calculation. Ionomycin (10 μM) was added in the solution for the measurement of the values of Rmax and Rmin.
High K⁺-induced Ca²⁺ transients in the VSMCs of rats were obtained by applying of 60 mM high K⁺ solution for 10 s using a drug delivery system (ALA VM4, ALA Scientific Instrument, Farmingdale, NY, United States). The effect of DS-201 on high K⁺-induced Ca²⁺ transients was observed after 10 min pre-incubation of the cells with DS-201 and then applied high K⁺ (60 mM) for 10 s. The cells were continuously washed out with Tyrode’s solution during the 10-min interval. High K⁺-evoked Ca²⁺ transient was presented as the change of [Ca²⁺]_i from the base level to the peak after the treatment of high K⁺ solution for 10 s. Ca²⁺ transient rise time was defined as the time from the base level to the peak of [Ca²⁺]_i. Ca²⁺ transient decay time was defined as the time for 90% reduction from the peak of [Ca²⁺]_i.

Primary bone marrow MSCs were plated in a 6-well plate at a density of 2 × 10⁵ cells/well with osteogenic differentiation medium. Cells were treated with either 500µM H₂O₂ or 500µM H₂O₂ and different concentrations of Tanshinone IIA for 72 h. Total RNA of the cells was extracted using an RNA Extraction Kit (B0004D, HifunBio, Shanghai, China) and reverse transcribed to cDNA using an RT reagent kit (RR407, Takara Bio, Japan). PCR was performed using a TB Green Premix Ex Taq II kit (RR820, Takara Bio, Japan). The primers used for specific mRNAs are listed in Table 1.
Table 1

PCR primers for specific genes

Genes	primer sequences
β-actin	Forward	5’- TATCGCTGCGCTGGTCG − 3’
	Reverse	5’- CCCACGATGGAGGGGAATAC − 3’
Runx2	Forward	5’- GTGGCAGTGTCATCATCTGAAAT − 3’
	Reverse	5’-TCGCCTCAGTGATTTAGGGCGCA-3’
osterix	Forward	5’- TGCTATACTCTGGGGGCTCTC − 3’
	Reverse	5’- AGGAGGTCGGAGCATAGGAA − 3’

Time-lapse recordings were done as described previously^{27 (link)}. Cortical bovine bone slices (0.4 mm; BoneSlices.com, Jelling, Denmark) were labeled with rhodamine fluorescent dye (ThermoFisher) as previously described^{27 (link)}. Mature OCs were detached with accutase (Biowest BW, France), harvested by centrifugation (500 g for 5 min), and resuspended in αMEM containing 10% FCS, 25 ng/ml M-CSF, and 25 ng/ml RANKL. For control and lower inhibitor concentrations cells from 3 to 5 donors were used and for the highest inhibitor concentrations (T06 1 µM and ODN 50 nM) 2 donors were used. For each condition and for each donor 3–5 bone slices were used and cells were seeded at a density of 100,000 cells per bone slice in a 96-well plate. In order to label F-actin in living OCs, 100 nM SiR-actin (excitation at 652 nm; emission at 674 nm) and 10 μM verapamil (both supplied by Spirochrome, Stein am Rhein, Switzerland) were added and incubated for 5 h at 37 °C in 5% CO₂ in a humidified chamber. Inhibitors (ODN and tanshinone IIA sulfonate (T06), which block CatK activity, were added to the plates. Subsequently, bone slices were transferred to Nunc Lab-Tek™ II Chambered Coverglass (ThermoFisher Scientific) wells in medium containing M-CSF, RANKL, SiRactin, and verapamil (with or without inhibitors) as described above. Time-lapse images were made using an Olympus Fluoview FV10i microscope (Olympus Corporation, Shinjuku, Tokyo, Japan) at 5% CO₂ and 37 °C, with a 10 × objective lens with a confocal aperture of 2.0 corresponding to a z-plane depth of 20.2 μm. The initial focus was set to the bone surface. Recordings were made for a period of 72 h taking images every 7 or 21 min (at least 3 recording areas per bone slice). Neither SiR-actin nor verapamil affected the extent of resorption. We analyzed between 50 and 150 OCs per condition on 3–5 bone slices per donor-derived OCs.