Valium

Rats were anesthetized with Isoflurane (3% induction, 1.5–2% for surgery, and 1.5% maintenance in a 65:35 mixture of N₂O:O₂). A brain infusion kit 1 (Alzet, USA) was implanted into the right lateral ventricle (1 mm posterior; 1.5 mm lateral; 3.5 mm depth from bregma) and connected to an osmotic pump (1007D, Alzet, USA) containing (1) control siRNA, (2) PDI siRNA, (3) vehicle, and (4) l-NAME (15 μg/μl), respectively. A PDI siRNA sequence corresponding to coding region (5′→3′) is sense: CUGCAAAACUGAAGGCAGAUU, and antisense: UCUGCCUUCAGUUUUGCAGUU. A non-silencing RNA was used as the control siRNA. The osmotic pump was subcutaneously placed in the interscapular region. Three days after surgery, some animals were treated with pilocarpine (380 mg/kg i.p.) 20 min after atropine methylbromide (5 mg/kg i.p.). Control animals received an equal volume of normal saline instead of PILO after the pretreatment with atropine methylbromide. Diazepam (Valium; Hoffman la Roche, Neuilly sur-Seine, France; 10 mg/kg, i.p.) was administered 2 h after onset of SE and repeated, as needed. Three days after SE, animals were used for western blot, co-immunoprecipitation, measurements of SHO-thiol or immunohistochemistry (see below).

Animals were given LiCl (3 mEq/kg, i.p) 24 h before the pilocarpine treatment. To reduce the peripheral effects of pilocarpine, atropine methylbromide (5 mg/kg, i.p.) was also received 20 min before the pilocarpine treatment. To induce SE, animals were treated with pilocarpine (30 mg/kg, i.p.). Control animals received saline in place of pilocarpine. For evaluation of the effect of siRNA knockdown on seizure susceptibility in response to LiCl-pilocarpine, animals were recorded EEG signals with a DAM 80 differential amplifier (0.1–3000 Hz bandpass; World Precision Instruments, Sarasota, FL, USA). EEG activity was measured during the 2 h recording session from each animal. The data were digitized (400 Hz) and analyzed using LabChart Pro v7 (AD Instruments, Bella Vista, NSW, Australia). Time of seizure onset was defined as the time point showing paroxysmal depolarizing shift, which lasted more than 3 s and consisted of a rhythmic discharge between 4 and 10 Hz with amplitude of at least two times higher than the baseline EEG (Kim and Kang, 2011 (link)). EEG activity was measured during the 2 h recording session from each animal. Spectrograms were also automatically calculated using a Hanning sliding window with 50% overlap. Two hours after SE onset, diazepam (Valium; Roche, France; 10 mg/kg, i.p.) was administered and repeated, as needed.

Medication data were retrieved from the medical records of participants. It included mainly antipsychotics, mood stabilizers, benzodiazepines, anticholinergics, and antidepressants.
Mood stabilizers comprised lithium carbonate and antiepileptic medications (valproic acid, carbamazepine, pregabalin, topiramate, and phenytoin). The benzodiazepines included lorazepam, clonazepam, alprazolam, diazepam, alprazolam, and bromazepam. Anticholinergics consisted of trihexyphenidyl. Antidepressants were divided into two groups, i.e., tricyclic antidepressants (TCA, including amitriptyline, clomipramine, and imipramine) and other antidepressants (venlafaxine, sertraline).
The total anticholinergic burden was calculated based on the updated version of the Anticholinergic Drug Scale (ADS), where each medication was assigned a numerical value from 0 to 3, depending on their anticholinergic strength, and the overall ADS score for a patient was calculated by summing the values of all scheduled medications used by each participant [28 (link)]. This scale is the most comprehensive currently available for quantifying the anticholinergic burden for most medicines used to treat psychotic symptoms [28 (link)].
Serum anticholinergic activity (SAA) is considered the current gold standard in quantifying anticholinergic burden [28 (link)]. However, it is only quantified in a small number of research laboratories. An ADS scale might help determine who is the most at risk for adverse side effects and offer guidance in interventions [28 (link)]. Previous studies have shown that the ADS score was significantly associated with SAA, suggesting it is a helpful tool for assessing anticholinergic burden [28 (link), 38 (link)]. However, using ADS ratings to classify medications is a method of limited accuracy since there will be variations in anticholinergic potencies across medications within each group, regardless of the accuracy of the classification. Also, SAA might be influenced by endogenous substances, which are not measurable by the ADS scale, which only evaluates anticholinergic characteristics of medications.
Furthermore, antipsychotic medications were divided into second-generation antipsychotics or SGA (risperidone, clozapine, olanzapine, quetiapine, and paliperidone) and first-generation antipsychotics or FGA (haloperidol, chlorpromazine, pimozide, zuclopenthixol, fluphenazine, and perphenazine). The sum of antipsychotics taken was calculated for each patient. The chlorpromazine equivalent dose was calculated using the Andreasen method to assess the relative antipsychotic dose [39 (link)], and the doses of benzodiazepines were calculated using the equivalent benzodiazepine calculator based on the valium equivalence [40 ].

Pentobarbital sodium was purchased from Cheminova de Mexico, Mexico City, Mexico. Reg. SAGARPA Q-7048-044). Benzalkonium chloride from Medipharm^®, San Luis Río Colorado, Sonora, Mexico. Dipirona50^® was obtained from Virbac Animal Health, Guadalajara, Mexico. Dimethylsulfoxide (DMSO) was purchased from Golden Bell Reactivos (Mexico City, Mexico). Atropine sulphate, chrysin (Chry, 5,7-Dihydroxyflavone < 97%) and allopregnanolone (Allo, 5α-Pregnan-3α-ol-20-one) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Diazepam (Valium, injectable solution) was obtained from Laboratory Roche (Mexico City, Mexico). Saline solution (0.9%) was purchased from PiSA Farmacéutica (Guadalajara, Jalisco, Mexico).