Log In Sign up
The largest database of trusted experimental protocols
> Disorders > Acquired Abnormality > Senile Plaques

Senile Plaques

Senile Plaques are extracellular deposits of amyloid beta peptide found in the brains of individuals with Alzheimer's disease.
These plaques are a hallmark pathological feature and a key target for research into understanding and treating the disease.
PubCompare.ai's AI-powered platform provides researchers with the most effective protocols and insights to optimize their Senile Plaques studies, leveraing the latest literature, preprints, and patents to identify the best methods and products.
Streamline your research and discover new avenues for investigation with PubCompare.ai's user-friendly, data-driven tools.

Most cited protocols related to «Senile Plaques»

1
Comprehensive Neuropathological Evaluation
The post-mortem neuropathologic evaluation includes a uniform structured assessment of AD pathology, cerebral infarcts, Lewy body disease, and other pathologies common in aging and dementia. The procedures follow those outlined by the pathologic dataset recommended by the National Alzheimer’s Disease Coordinating Center (NACC) [80 (link)]. Pathologic diagnoses of AD use NIA-Reagan and modified CERAD criteria, and the staging of neurofibrillary pathology uses Braak Staging [81 (link)–83 (link)]. The location, size, and age of each macroscopic infarct are recorded as described [35 (link)]. Microscopic infarctions are identified on H&E stained sections as is nigral degeneration; amyloid angiopathy is identified with amyloid immunostained sections; nigral, limbic, and neocortical Lewy bodies are identified on sections stained with α-synuclein [84 (link)–89 (link)].
Other post-mortem data are collected as part of separately funded projects. For example, counts of neuritic plaques diffuse plaques, and neurofibrillary tangles based on silver stain from five brain regions are used to create a global measure of AD pathology [75 (link)]. Amyloid load and the density of paired helical filament tau (PHFtau) are determined in eight brain regions and summarized [86 (link)]. More recently we have started to quantify TDP-43 [90 (link)].
Bennett D.A., Schneider J.A., Arvanitakis Z, & Wilson R.S. (2012). OVERVIEW AND FINDINGS FROM THE RELIGIOUS ORDERS STUDY. Current Alzheimer research, 9(6), 628-645.
Publication 2012
Alzheimer's Disease Amyloid angiopathy Amyloid Proteins Autopsy Brain Cerebral Infarction Dementia Diagnosis Infarction Lewy Bodies Lewy Body Disease MAPT protein, human Microscopy Neurofibrillary Tangle protein TDP-43, human Senile Plaques Silver SNCA protein, human Stains Substantia Nigra
2
Comprehensive Neuropathological Evaluation for Aging and Dementia
The post-mortem neuropathologic evaluation includes a uniform structured assessment of AD pathology, cerebral infarcts, Lewy body disease, and other pathologies common in aging and dementia. The procedures follow those outlined by the pathologic dataset recommended by the National Alzheimer's Disease Coordinating Center (NACC) [87 (link)]. Pathologic diagnoses of AD use NIA-Reagan and modified CERAD criteria, and the staging of neurofibrillary pathology uses Braak Staging [88 (link)–90 (link)]. The location, size, and age of each macroscopic infarct are recorded as described [91 ]. Microscopic infarctions are identified on H&E stained sections; Lewy bodies are identified on alpha-synuclein immunostained sections [91 ].
Counts of neuritic plaques diffuse plaques, and neurofibrillary tangles based on silver stain from five brain regions are used to create a global measure of AD pathology [70 ]. Amyloid load and the density of paired helical filament tau (PHFtau) are determined in eight brain regions and summarized [70 ].
Bennett D.A., Schneider J.A., Buchman A.S., Barnes L.L., Boyle P.A, & Wilson R.S. (2012). Overview and Findings from the Rush Memory and Aging Project. Current Alzheimer research, 9(6), 646-663.
Publication 2012
Alzheimer's Disease APP protein, human Autopsy Brain Cerebral Infarction Dementia Diagnosis Infarction Lewy Bodies Lewy Body Disease MAPT protein, human Microscopy Neurofibrillary Tangle Senile Plaques Silver SNCA protein, human Stains
3
Influenza Virus Plaque Assay Optimization
One hour after infecting the cell monolayers with 30–50 plaque forming units of the virus in 1 ml of maintenance medium without trypsin, we removed the virus inoculum, covered the cells with 3 ml of the different overlay media and incubated cultures at 35°C in 5% CO2 atmosphere. In the case of MC and Avicel overlays, care was taken not to disturb the plates during the incubation period in order to avoid formation of non-even plaques. After three days of incubation, we removed the overlays and fixed the cells. Agar overlay was removed using metal spatula; MC, Avicel, and liquid overlays were removed by suction. The cells were fixed with 4% paraformaldehyde solution in MEM for 30 min at 4°C and washed with PBS. All subsequent treatments of the cells were performed at room temperature. We permeabilized the cells and simultaneously blocked residual aldehyde groups by incubating the cells for 10–20 min with 1 ml/well of solution containing 0.5 % Triton-X-100 and 20 mM glycine in PBS. We immuno-stained virus-infected cells by incubating for 1 hr with monoclonal antibodies specific for the influenza A virus nucleoprotein (kindly provided by Dr. Alexander Klimov at Centers for Disease Control, USA) followed by 1 hr incubation with peroxidase-labeled anti-mouse antibodies (DAKO, Denmark) and 30 min incubation with precipitate-forming peroxidase substrates. Solution of 10% normal horse serum and 0.05% Tween-80 in PBS was used for the preparation of working dilutions of immuno-reagents. We washed the cells after the primary and secondary antibodies by incubating them three times for 3–5 min with 0.05% Tween-80 in PBS. As peroxidase substrates, we employed either ready to use True Blue™ (KPL) or solution of aminoethylcarbazole (AEC, Sigma) (0.4 mg/ml) prepared in 0.05 M sodium acetate buffer, pH 5.5 and containing 0.03% H2O2. Stained plates were washed with tap water to stop the reaction and dried. In the case of True Blue staining, which is relatively unstable in water solutions, plates were dried inverted in order to minimize bleaching. Stained plates were scanned on a flat bed scanner and the data were acquired by Adobe Photoshop 7.0 software.
As an alternative to immuno-staining, in some experiments we revealed plaques as areas of destroyed cells. To this end, after removing the overlays, we stained the cells with 1% crystal violet solution in 20% methanol in water.
Matrosovich M., Matrosovich T., Garten W, & Klenk H.D. (2006). New low-viscosity overlay medium for viral plaque assays. Virology Journal, 3, 63.
Publication 2006
Agar Aldehydes Anti-Antibodies Antibodies Atmosphere Avicel Buffers Dental Plaque Equus caballus Glycine Metals Methanol Monoclonal Antibodies Mus NP protein, Influenza A virus paraform Peroxidase Peroxide, Hydrogen Senile Plaques Serum Sodium Acetate Suction Drainage Technique, Dilution Triton X-100 true blue Trypsin Tween 80 Violet, Gentian Virus
4
Comprehensive Phage Host Range Evaluation
The six phages that displayed the widest bactericide host range in the spot assays were selected for a more thorough assessment of productive infection as defined by the efficiency of plating (EOP). Each phage was tested three times for each of four different dilutions against all the bacterial strains that it had been shown to be able to lyse in the spot assays. This was done under the same conditions as in the spot assays, i.e. using stationary phase bacteria. Thus, all bacterial strains to be tested were grown overnight (18 hours) at 30°C and 200 μl of each of those cultures was used in double layer plaque assays together with 100 μl of diluted phage lysate. The four phage lysates were 106–109 times dilutions from the phage stock. This means that EOP assay replicates for a particular phage were done in parallel on all bacterial strains tested, and also at concentrations comparable to what was used in the spot tests. The plates were incubated overnight at 30°C and the number of plaque forming units (PFU) was counted for each combination. When the 106 dilution did not result in any plaques, a lower dilution was tried afterwards to verify that the EOP was lower than 0.001. Finally, the EOP was calculated (average PFU on target bacteria / average PFU on host bacteria) along with the standard deviation for the three measurements (S1 Table).
The average EOP value for a particular phage—bacterium combination was classified as “High production” when the ratio was 0.5 or more, i.e. when the productive infection on the target bacterium resulted in at least 50% of the PFU found for the primary host. An EOP of 0.1 or better, but below 0.5, was considered to be of “Medium production” efficiency, and between 0.001 and 0.1 as “Low production” efficiency. An EOP equal to or under 0.001 was classified as inefficient [34 (link)].
Khan Mirzaei M, & Nilsson A.S. (2015). Isolation of Phages for Phage Therapy: A Comparison of Spot Tests and Efficiency of Plating Analyses for Determination of Host Range and Efficacy. PLoS ONE, 10(3), e0118557.
Publication 2015
Bacteria Bacterial Infections Bacteriophages Biological Assay Dental Plaque Host Range Infection Senile Plaques Strains Technique, Dilution
5
Virus Plaque Assay in MDCK Cells
We infected MDCK or MDCK-SIAT1 cell monolayers in 96-well plates with 50 μl/well of serial dilutions of the virus in the maintenance medium without trypsin. After 1 h incubation at 35°C in 5% CO2, we removed the virus, added 100 μl/well of either MC or Avicel overlay media, and incubated the cells for further 24 h to allow plaque formation. Fixation and immuno-staining were performed as described above for 6-well plates but using 50 μl of reagents per well.
Matrosovich M., Matrosovich T., Garten W, & Klenk H.D. (2006). New low-viscosity overlay medium for viral plaque assays. Virology Journal, 3, 63.
Publication 2006
Avicel Madin Darby Canine Kidney Cells Senile Plaques Technique, Dilution Trypsin Virus

Most recents protocols related to «Senile Plaques»

1
Investigating Virus Infectivity's Role in Plaque Size
Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5
PCR primer sequences.
Gene TargetPrimer Sequence
DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA
TGCC (SEQ ID NO: 24)
Reverse: GAGACAGCAGGATCTCTGGTCTY
TC (SEQ ID NO: 25)
GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT
(SEQ ID NO: 26)
Reverse: TTGATTTTGGAGGGATCTCG
(SEQ ID NO: 27)
CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC
(SEQ ID NO: 28)
Reverse: GTCCATCCTTGGAAGCACTGCA
(SEQ ID NO: 29)
ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT
(SEQ ID NO: 30)
Reverse: ATCTTCCACCGAGCTGTGTCCA
(SEQ ID NO: 31)
IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG
(SEQ ID NO: 32)
Reverse: CATTTTAGTTGCCGTAGG
(SEQ ID NO: 33)
IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA
(SEQ ID NO: 34)
Reverse: AAGACCTTCTGGGTCATCACG
(SEQ ID NO: 35)
IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG
(SEQ ID NO: 36)
Reverse: ACGTCCTCCAGGATTATCTCCA
(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].
Patent 2024
Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication
2
Detecting Endogenous Bacteriophages in E. coli Nissle
Not available on PMC !

Example 56

Escherichia coli Nissle 1917 (E. coli Nissle) and engineered derivatives test positive for a low level presence of phage 3 in a validated bacteriophage plaque assay. Bacteriophage plaque assays were conducted to determine presence and levels of bacteriophage. In brief, supernatants from cultures of test bacteria that were grown overnight were mixed with a phage-sensitive indicator strain and plated in soft agar to detect the formation of plaques, indicative of the presence of bacteriophage. Polymerase chain reaction (PCR) primers were designed to detect the three different endogenous prophages identified in the bioinformatics analyses, and were used to assess plaques for the presence of phage-specific DNA.

US11879123B2. Bacteria for the treatment of disorders (2024-01-23). Synlogic Operating Company, Inc. [US]. Inventors: Dean Falb [US], Adam B. Fisher [US], Vincent M. Isabella [US], Jonathan W. Kotula [US], David Lubkowicz [US], Paul F. Miller [US], Yves Millet [US], Sarah Elizabeth Rowe [US].
Patent 2024
Agar Bacteria Bacteriophage Plaque Assay Bacteriophages derivatives Escherichia coli Oligonucleotide Primers Polymerase Chain Reaction Prophages Senile Plaques Strains
3
Production of Bifidobacterium breve Powder
Not available on PMC !

Example 3

Bifidobacterium breve M-16V (NITE BP-02622) is added to 3 mL of an MRS liquid medium and is anaerobically cultured at 37° C. for 16 hours, and the culture liquid is concentrated, followed by lyophilization, to obtain a lyophilized powder of the bacterium (bacterial powder). Next, crystalline cellulose is put in an agitation granulator and mixed. Then, purified water was added, followed by granulation. The granulated product is dried to obtain granules that contain an extracted component of the bacterium and an excipient. By administering the composition, modulation of palatability, maintenance of body temperature, and protection of a blood vessel can be expected. Furthermore, the composition can be used for preventing or treating unbalanced diet, sensitivity to cold, hypothermia, myocardial infarction, ischemia-reperfusion injury, cardiac hypertrophy, diabetic cardiomyopathy, arteriosclerosis, or vascular plaque formation.

US11857579B2. Composition for promoting the secretion of FGF21 (2024-01-02). MORINAGA MILK INDUSTRY CO., LTD. [JP]. Inventors: Tatsuya Ehara [JP], Hirohisa Izumi [JP], Takashi Shimizu [JP].
Patent 2024
Arteriosclerosis Bacteria Bifidobacterium breve Blood Vessel Body Temperature Cardiac Hypertrophy Cellulose Cold Temperature Cytoplasmic Granules Diabetic Cardiomyopathies Diet Excipients fibroblast growth factor 21 Freeze Drying Hypersensitivity Myocardial Infarction Powder Reperfusion Injury secretion Senile Plaques
4
Probiotic-Milk Protein Composition for FGF21 Secretion
Not available on PMC !

Example 2

Bifidobacterium breve M-16V (NITE BP-02622) is added to 3 mL of an MRS liquid medium and is anaerobically cultured at 37° C. for 16 hours and the culture liquid is concentrated, followed by lyophilization, to obtain a lyophilized powder of the bacterium (bacterial powder). The bacterial powder and a dry powder of a milk protein concentrate (MPC480, manufactured by Fonterra, protein content: 80% by mass, casein: whey protein=about 8:2) are uniformly mixed to obtain a composition. 20 g of the composition is diluted in 200 g of water to obtain a composition for promoting the secretion of FGF21. By administering the composition, modulation of palatability, maintenance of body temperature, and protection of a blood vessel can be expected. Furthermore, the composition can be used for preventing or treating unbalanced diet, sensitivity to cold, hypothermia, myocardial infarction, ischemia-reperfusion injury, cardiac hypertrophy, diabetic cardiomyopathy, arteriosclerosis, or vascular plaque formation.

US11857579B2. Composition for promoting the secretion of FGF21 (2024-01-02). MORINAGA MILK INDUSTRY CO., LTD. [JP]. Inventors: Tatsuya Ehara [JP], Hirohisa Izumi [JP], Takashi Shimizu [JP].
Patent 2024
Arteriosclerosis Bacteria Bifidobacterium breve Blood Vessel Body Temperature Cardiac Hypertrophy Caseins Cold Temperature Diabetic Cardiomyopathies Diet fibroblast growth factor 21 Freeze Drying Hypersensitivity Milk, Cow's Myocardial Infarction Powder Proteins Reperfusion Injury secretion Senile Plaques Staphylococcal Protein A Whey Proteins
5
Carotid Atherosclerosis and Diabetes SNPs
The study used a case–control design to explore the relationships between DM SNPs and carotid atherosclerosis. The study performed stratified random sampling procedure to select study subjects from a community-based cohort, which enrolled middle-aged adults and elders from 3 townships in the northern coastal area of Taiwan [23 (link)]. From September 2010 to May 2013, a total of 1607 residents aged 40-to-74 years voluntarily provided informed consent and were enrolled. Twenty-seven subjects who lack good quality of recorded carotid ultrasound images and another 1 individual who lack blood pressure data were excluded. Another 40 subjects who had a positive history of physician-diagnosed myocardial infarction or had ever received a cardiac catheter or stent were excluded, leaving a total of 1539 subjects in the cohort.
Of the cohort members, 409 of them had detectable extracranial carotid plaques (CP). The study randomly selected 309 CP-positive individuals as the case group. The control group was a random sample of 439 individuals who had no detectable extracranial carotid plaque. The study complied with the 1975 Helsinki Declaration on ethics in medical research and were reviewed and approved by the institutional review boards of MacKay Medical College (No. P990001) and MacKay Memorial Hospital (No. 14MMHIS075).
Wu T.W., Chou C.L., Cheng C.F., Lu S.X., Wu Y.J, & Wang L.Y. (2023). Associations of genetic markers of diabetes mellitus with carotid atherosclerosis: a community-based case–control study. Cardiovascular Diabetology, 22, 51.
Publication 2023
Adult Blood Pressure Cardiac Catheters Carotid Arteries Carotid Atherosclerosis Dental Plaque elder flower Ethics Committees, Research Myocardial Infarction Physicians Senile Plaques Single Nucleotide Polymorphism Stents Ultrasonography, Carotid Arteries

Top products related to «Senile Plaques»

1
Crystal violet by Merck Group
Sourced in United States, Germany, China, Japan, United Kingdom, France, Sao Tome and Principe, Italy, Australia, Macao, Spain, Switzerland, Canada, Belgium, Poland, Brazil, Portugal, India, Denmark, Israel, Austria, Argentina, Sweden, Ireland, Hungary
Crystal violet is a synthetic dye commonly used in laboratory settings. It is a dark purple crystalline solid that is soluble in water and alcohol. Crystal violet has a variety of applications in the field of microbiology and histology, including as a staining agent for microscopy and in the gram staining technique.
2
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
3
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
4
Methylcellulose by Merck Group
Sourced in United States, Germany, United Kingdom, Japan, Belgium, Switzerland, Italy, Australia, Canada, China, Sao Tome and Principe, Poland, Israel, France, Spain, Austria
Methylcellulose is a water-soluble, synthetic polymer derived from cellulose. It is a white, odorless, and tasteless powder that is commonly used as a thickening, stabilizing, and emulsifying agent in various industries, including pharmaceutical, food, and personal care products.
5
Vero e6 cell by American Type Culture Collection
Sourced in United States, Germany, France, Italy, Japan, India, Brazil, United Kingdom, Hong Kong, Australia
Vero E6 cells are a continuous cell line derived from the kidney of the African green monkey (Cercopithecus aethiops). They are widely used in various applications, including virus propagation, cytotoxicity assays, and vaccine development.
6
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
7
Seaplaque agarose by Lonza
Sourced in United States, Switzerland, Japan
SeaPlaque agarose is a low-melting temperature agarose used for the preparation of soft agar overlays for plaque assays. It has a gelling temperature of approximately 30-35°C and a melting temperature of approximately 60-65°C.
8
Neutral red by Merck Group
Sourced in United States, Germany, Italy, United Kingdom, China, Spain, India, Czechia, Sao Tome and Principe
Neutral red is a synthetic dye commonly used in biological research and laboratory applications. It is a water-soluble, reddish-orange compound that can be used as a pH indicator, a staining agent, and a cell viability assay. The core function of neutral red is to provide a simple and reliable method for visualizing and quantifying living cells in various experimental settings.
9
Minimum essential medium (mem) by Thermo Fisher Scientific
Sourced in United States, United Kingdom, China, Germany, Japan, France, Italy, Belgium, Australia, Canada, Spain, Austria, Netherlands, Ireland, Argentina, Switzerland, Denmark, Morocco, Brazil, New Zealand, Moldova, Republic of, Poland
MEM is a cell culture medium designed for the growth and maintenance of a variety of cell types in vitro. It provides a balanced salt solution, amino acids, vitamins, and other essential nutrients required for cell proliferation and survival.
10
Carboxymethylcellulose by Merck Group
Sourced in United States, Germany, India, United Kingdom, Sao Tome and Principe, France, Italy, Singapore, Ireland, Spain, Canada, China, Malaysia, Australia
Carboxymethylcellulose is a water-soluble cellulose derivative used as a thickening agent, stabilizer, and emulsifier in various laboratory applications. It is a white to off-white, odorless, and tasteless powder that can be easily dispersed in water to form a clear, viscous solution.

More about "Senile Plaques"

Senile Plaques, also known as amyloid-beta (Aβ) plaques, are a hallmark pathological feature of Alzheimer's disease.
These extracellular deposits of amyloid-beta peptide accumulate in the brains of individuals with the neurodegenerative disorder.
Understanding and treating Senile Plaques is a key focus of Alzheimer's research.
PubCompare.ai's AI-powered platform provides researchers with the most effective protocols and insights to optimize their studies on Senile Plaques.
By leveraging the latest literature, preprints, and patents, the platform helps identify the best methods and products for investigating these amyloid deposits.
Streamlining your Senile Plaques research is made possible with PubCompare.ai's user-friendly, data-driven tools.
These can assist in locating and comparing protocols from various sources, including scientific publications, preprint servers, and patent databases.
This allows researchers to discover new avenues for investigation and enhance their experimental design.
Beyond Senile Plaques, PubCompare.ai's insights can also be applied to other related topics, such as Crystal violet staining, fetal bovine serum (FBS), Dulbecco's Modified Eagle Medium (DMEM), Methylcellulose, Vero E6 cells, Penicillin/streptomycin, SeaPlaque agarose, Neutral red, Minimum Essential Medium (MEM), and Carboxymethylcellulose.
By leveraging these complementary techniques and materials, researchers can gain a more comprehensive understanding of the underlying mechanisms and potential treatments for Alzheimer's disease.