> Disorders > Cell or Molecular Dysfunction > DNA Breaks, Double-Stranded

DNA Breaks, Double-Stranded

DNA Breaks, Double-Stranded: A type of DNA damage where both strands of the DNA helix are severed, often resulting in genetic instability and cell death if not properly repaired.
Studying these breaks is crucial for understanding cellular mechanisms, DNA repair pathways, and their role in various diseases.
PubCompare.ai's AI-driven comparison tool helps researchers locate the best protocols from literature, pre-prints, and patents, ensuring reproducible and accuarate results for their DNA break studies.

Most cited protocols related to «DNA Breaks, Double-Stranded»

Purification and Assays of DNA Repair Proteins

The proteins and protein complexes (i.e. Mre11-Rad50-Xrs2, Dna2, yeast and human RPA proteins, Sgs1, Top3-Rmi1, Srs2, Fen1) used in this study were expressed in insect, yeast, or E. coli cells and purified as detailed in the Supplementary Information. E. coli SSB protein was purchased (New England BioLabs). For the end resection reactions, linear DNA was 3′ or 5′ labeled with ³²P using standard methods, and the internally ³²P-labeled DNA was generated by PCR. Other ³²P-labeled DNA substrates for testing Sgs1 and Dna2 DNA helicase and Dna2 nuclease activities were prepared as described in the Supplementary Information. The supercoiled φX174 DNA was purchased (New England BioLabs) and its linearization was by digestion with the restriction enzyme StuI. The DNA resection reactions were analyzed in agarose or polyacrylamide gels under denaturing or non-denaturing conditions, followed by phosphorimaging analysis of the dried gel or ethidium bromide treatment of the gel to visualize DNA species. The pulldown experiments to test for protein-protein interactions made use of affinity tags on the indicated proteins. Visualization of proteins was by the staining of SDS polyacrylamide gels with Coomassie Blue or by immunoblotting. Experimental details for the Dna2 nuclease, double Holliday Junction dissolution, DNA helicase, and ATPase assays, and pre-resection of uniformly ³²P-labeled DNA can be found in the Methods section or Supplementary Information. Genetic assays to measure the distribution of recombinant products of the gene conversion and crossover types or the kinetics of the resection of a site-specific DNA double strand break were conducted as described6 (link),7 (link).

Niu H., Chung W.H., Zhu Z., Kwon Y., Zhao W., Chi P., Prakash R., Seong C., Liu D., Lu L., Ira G, & Sung P. (2010). Mechanism of the ATP-dependent DNA End Resection Machinery from S. cerevisiae. Nature, 467(7311), 108-111.

Publication 2010

Adenosinetriphosphatase Biological Assay Cells Coomassie blue Digestion DNA, Cruciform DNA, Superhelical DNA2 protein, human DNA Breaks, Double-Stranded DNA Helicases DNA Restriction Enzymes Escherichia coli Ethidium Bromide Insecta Kinetics NR4A2 protein, human polyacrylamide gels Proteins Rad50 protein, human Recombinant Proteins Reproduction Saccharomyces cerevisiae Sepharose SSB protein, E coli Topoisomerase, TOP3

Quantifying DNA Damage Response in Irradiated Pigs

Blood samples were taken from anesthetized pigs before (control) and 4 h, 24 h and 7 days post irradiation. Lymphocytes were isolated by Ficoll-paque (GE healthcare) density centrifugation followed by ethanol fixation and subjected to immunofluorescent staining to detect DNA damage-associated protein accumulation as microscopic foci at DNA double-strand break sites as described [48] (link). We applied primary antibodies against γ-H2AX, 53BP1 and MRE11 and detected them with secondary goat anti-mouse Alexa-488 (Table 4). 53BP1 and MRE11 primary antibodies were detected using donkey anti-rabbit Cy3-labeled antibodies (Table 4). The number of irradiation-induced DNA damage and repair protein foci was analyzed by an experienced investigator in lymphocyte nuclei (n>300 PBL/sample) by manual focus counting directly in a Zeiss Axioimager 2i fluorescence microscope. Cells which showed deformed nuclei or were overlapping were excluded from analysis. Minute foci scattered over the nucleus and the cytoplasm were considered as background and excluded from enumeration. Images were recorded using the ISIS fluorescence imaging system (MetaSystems). Fluorescence intensity profiles were obtained using the profile option of the ISIS imaging software. For each pig and time point 300 (in some cases 400) cells were analyzed by fluorescence microscopy from at least three independent staining experiments/sample. The average values of the different time points were derived from 5200 and 4800 (4 h, were one pig sample was lacking) evaluated cells per pig group.

Lamkowski A., Forcheron F., Agay D., Ahmed E.A., Drouet M., Meineke V, & Scherthan H. (2014). DNA Damage Focus Analysis in Blood Samples of Minipigs Reveals Acute Partial Body Irradiation. PLoS ONE, 9(2), e87458.

Publication 2014

Anti-Antibodies Antibodies BLOOD Cell Nucleus Cells Centrifugation Cytoplasm DNA Breaks, Double-Stranded DNA Damage Equus asinus Ethanol Ficoll Fluorescence Fluorescent Antibody Technique Goat HSP40 Heat-Shock Proteins Lymphocyte Mice, House Microscopy Microscopy, Fluorescence Pigs Proteins Rabbits Radiotherapy TP53BP1 protein, human

Radiation-Augmented Glioma Growth Model

We investigate an extension of the PI model (Equation 1) for untreated glioma growth to include the effects of XRT using the classic linear-quadratic model for radiation efficacy. Equation 2a is the well known linear-quadratic model for radiation efficacy (Hall, 1994 ) that relates the radiation Dose, defined in both space and time in units Gy (Gy = 1 J/kg), to a unitless effective dose E. The coefficients α (Gy⁻¹) and β (Gy⁻²) are the radiobiology parameters and determine the relative contribution of each term in the sum toward the total radiation effect and are sometimes interpreted biologically as repairable single and lethal double strand breaks to the cell’s DNA respectively (Hall, 1994 ). The linear-quadratic model is based on empirical dose-response data and is widely used in clinical applications. The ratio of the parameters α/β represents the tissue response: for early effects the ratio α/β is large and α dominates for small doses, for late effects, the ratio α/β is small and β dominates at small doses. In our model simulations the ratio α/β is held constant throughout the tumor, with α and the dose distribution determined by the individual patient data. Equation 2b is the probability of survival of glioma cells after the administration of radiation Dose such that the larger the dose, the smaller the probability of survival.
For each point in space and time, an effective dose and probability of cell survival can be calculated that corresponds uniquely to the individual patient’s treatment plan and radiobiology parameter (α). Increasing α decreases the probability of cells surviving, S, and therefore increases the probability of external beam radiation therapy (XRT) induced cell death.

\overset{\begin{matrix} rate of change of \\ glioma cell concentration \end{matrix}}{\overset{︷}{\frac{\partial c}{\partial t}}} = \overset{\begin{matrix} net dispersal \\ of glioma cells \end{matrix}}{\overset{︷}{\nabla \cdot (D \nabla c)}} + \overset{\begin{matrix} net proliferation \\ of glioma cells \end{matrix}}{\overset{︷}{ρ c (1 - \frac{c}{k})}} - \overset{\begin{matrix} loss due to \\ radiation therapy \end{matrix}}{\overset{︷}{R (x, t, Dose) c (1 - \frac{c}{k})}}

where

R (x, t, Dose (x, t)) \equiv {\begin{cases} 0 & for & t \notin therapy \\ (1 - S (α, β, Dose (x, t))) & for & t \in therapy \end{cases}

Equation 3 is a straight-forward extension of the PI model (Equation 1) to include the effects of XRT, represented by the coefficient R in the loss term. The effect of XRT is incorporated into model Equation 1 by considering the loss of cells due to XRT in terms of a death probability from Equation 2b. R represents the effect of XRT on the tumor cell population at a location x and time t where the effect is given by the probability of death (one minus the probability of survival) from the linear-quadratic model of radiation efficacy. Methodology and structure are detailed in Rockne et al (Rockne et al., 2009 (link)) and summarized in the supplementary material. The death probability is a function of the linear-quadratic model parameters α (Gy⁻¹) and β (Gy⁻²) and the radiation dose distribution (Dose(x, t) ) and is only applied during therapy. Similar to Equation 1, the model for radiation effect R is a net measure and considers the random damage, repair, and delivery of radiation to be upstream from the net deterministic measure of survival probability, although the linear-quadratic model can be derived from stochastic principles (Sachs et al., 2001 ).

Rockne R., Rockhill J., Mrugala M., Spence A., Kalet I., Hendrickson K., Lai A., Cloughesy T., Alvord E J.r, & Swanson K. (2010). Predicting efficacy of radiotherapy in individual glioblastoma patients in vivo: a mathematical modeling approach. Physics in medicine and biology, 55(12), 3271-3285.

Publication 2010

Aftercare ARID1A protein, human Cell Death Cells Cell Survival DNA Breaks, Double-Stranded Electromagnetic Radiation Glioma Neoplasms Neoplasms by Site Obstetric Delivery Patients Radiation Radiation Effects Radiotherapy Therapeutics Tissues

CRISPR-Cas9 Knockout of HOIP in GM12878 Cells

GM12878 LCLs with stable S. pyogenes Cas9 expression were established by infection by lentiviral transduction and blasticidin selection, using pLentiCas9-Blast (Addgene plasmid # 52962). We verified that Cas9 was highly active in the selected LCL pool by transduction with a lentivirus that encodes GFP, and a sgRNA against GFP [68 (link)]. The PXPR-011 plasmid was kindly provided by John Doench, Broad Institute, and encodes GFP, as well as an sgRNA against GFP. PXPR-011 is therefore a convenient way to monitor Cas9 activity in cell lines. GM12878 cells transduced with PXPR-011 based lentivirus and selected with puromycin initially expressed GPF, but were then found to lose GFP expression in >85% of transduced cells (the residual 15% of cells that continue to express GFP despite sgRNA against GFP may be cells where the non-homologous end-joining pathway correctly repaired the Cas9-induced DNA double strand break) [68 (link)]. By contrast, nearly 100% of Cas9 negative GM12878 cells were GFP positive after transduction with the same lentivirus and puromycin selection. CRISPR single guide RNAs (sgRNA) targeting human RNF31 (which encodes HOIP) were designed using the online program CRISPRdirect (http://crispr.dbcls.jp/)[69 (link)], and the oligo GCCCTCAGCGGCCTCGGTAC was Synthesized by Life Technologies, cloned into the lentiGuide-Puro vector (Addgene plasmid # 52963), according to the protocol from the Zhang laboratory website (http://genome-engineering.org/)[70 (link)], and sequence verified. Lentiviruses encoding the HOIP sgRNA were constructed and used to transduce GM12878 Cas9+ cells. Transduced cells were selected by purmoycin. HOIP depletion efficiency was validated by western blot.

Greenfeld H., Takasaki K., Walsh M.J., Ersing I., Bernhardt K., Ma Y., Fu B., Ashbaugh C.W., Cabo J., Mollo S.B., Zhou H., Li S, & Gewurz B.E. (2015). TRAF1 Coordinates Polyubiquitin Signaling to Enhance Epstein-Barr Virus LMP1-Mediated Growth and Survival Pathway Activation. PLoS Pathogens, 11(5), e1004890.

Publication 2015

Cell Lines Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats DNA Breaks, Double-Stranded Genome Homo sapiens Infection Lentivirus Oligonucleotides Plasmids Puromycin RNA, CRISPR Guide RNA, Single Guide Streptococcus pyogenes Western Blot

Comprehensive Analysis of Sperm DNA Methylation

WGBS and targeted bisulfite sequencing were performed as previously described (Allum et al. 2015 (link); Cheung et al. 2017 (link)). To examine the variability in human sperm DNA methylation, a subset of the men (total 30 participants; Table 1) was chosen in order to produce a single WGBS library pool (WGBS-Pool). A subset of the total of 39 men was chosen in order to ensure sufficient depth of sequencing from all participants in the single WGBS library. More specifically, samples (total

n = 30

) were chosen to reflect differing MTHFR genotypes and smoking status from the Toronto cohort (

n = 21

); MTHFR 677TT genotype, idiopathic infertility and folic acid supplementation use from the Montreal cohort (

n = 6

); and advanced aged from the Ottawa cohort (

n = 3

). Equal amounts of sperm DNA from these 30 participants were combined in order to make the pooled sperm DNA sample used. The WGBS-Pool library was constructed using the KAPA® High Throughput Library Preparation kit (Roche/KAPA® Biosystems). Briefly,

1 μ g

of the sperm DNA was spiked with 0.1% (w/w) unmethylated

λ

and pUC19 DNA (Promega). DNA was sonicated (S220 Focused-ultrasonicator, Covaris) and fragment sizes of

300 - 400 bp

were controlled on a Bioanalyzer DNA 1000 LabChip® (Agilent). Following fragmentation, DNA-end repair of double-stranded DNA breaks, 3′-end adenylation, adaptor ligation, and clean-up steps were conducted according to KAPA® Biosystems’ protocols. The sample was then bisulfite converted using the EpiTect® Fast DNA bisulfite kit (Qiagen) following the manufacturer’s protocol. The resulting bisulfite DNA was quantified with OliGreen® (Life Technology) and amplified with 9–12 PCR cycles using the KAPA® HiFi HotStart

Uracil +

DNA Polymerase kit (Roche/KAPA® Biosystems) according to suggested protocols. The final WGBS library was purified using Agencout® AMPure® Beads (Beckman Coulter), validated on Bioanalyzer High Sensitivity DNA LabChip® kits (Agilent) and quantified by PicoGreen® (ThermoFisher).
Targeted bisulfite sequencing was performed on the same 30-participant pooled sperm DNA sample used for WGBS (Capture-Pool) to compare the technique as well as on 45 individual samples (Table 2). These samples were chosen in order to examine the effect of MTHFR genotype alone from the Toronto cohort (MTHFR 677CC

n = 13

, 677TT

n = 8

), and to examine the effect of folic acid supplementation and MTHFR genotype on a cohort of idiopathic infertile men from Montreal (

n = 6

per genotype, before and after supplementation; i.e., 24 total samples). Following WGBS library preparations for all individual samples (as described above), the MCC-Seq protocol developed and optimized by Roche NimbleGen® was applied. Briefly, the SeqCap® Epi Enrichment System protocol (Roche NimbleGen®) was used to capture the regions of interest. Equal amounts of multiplexed libraries (

84 ng

of each, 12 samples per capture) were combined to obtain

1 μ g

of total input library, which was hybridized to the capture panel at 47°C for 72 h. Washing, recovery, and PCR amplification of the captured libraries, as well as final purification were conducted as recommended by the manufacturer. Bioanalyzer High Sensitivity DNA LabChip® kits (Agilent) were used to determine quality, concentration, and size distribution of the final captured libraries.
The single WGBS-pool library was sequenced over four lanes using the Illumina® HiSeq2000 system, whereas the capture libraries were sequenced over eight lanes on the Illumina® HiSeq4000 system. All sequencing used

100 - bp

paired-end sequencing.

Chan D., Shao X., Dumargne M.C., Aarabi M., Simon M.M., Kwan T., Bailey J.L., Robaire B., Kimmins S., San Gabriel M.C., Zini A., Librach C., Moskovtsev S., Grundberg E., Bourque G., Pastinen T, & Trasler J.M. (2019). Customized MethylC-Capture Sequencing to Evaluate Variation in the Human Sperm DNA Methylome Representative of Altered Folate Metabolism. Environmental Health Perspectives, 127(8), 087002.

Publication 2019

BP 400 DNA-Directed DNA Polymerase DNA Breaks, Double-Stranded DNA Library DNA Methylation DNA Repair EPI protocol Folic Acid Genotype Homo sapiens hydrogen sulfite Hypersensitivity Ligation MCC protocol Methylenetetrahydrofolate Reductase PicoGreen Promega Sperm Sterility, Reproductive Uracil

Most recents protocols related to «DNA Breaks, Double-Stranded»

CRISPR-Cas9 Foxp3 Domain Swap Mice

The Foxp3 domain-swap mutant mice were generated by CRISPR/Cas9-based genome editing⁴⁰. Briefly, two sgRNAs containing the target sequences gRNA1(TGAAAGGGGGTCGCATATTG) and gRNA2 (AAACCACCCCGCCACCTGGA) and Cas9 protein were used to introduce double-strand DNA breaks; a 1340 base pair (bp) single-strand DNA (ssDNA) containing the sequence encoding the three amino acids mutations (W348Q, M370T, A372P) was used to introduce Foxp3 domain-swap mutations via homology-directed DNA repair mechanism. The gRNAs-Cas9 RNP together with ssDNA were injected into fertilized eggs derived from the Foxp3^Thy1.1 reporter mice, and then transplanted into pseudo-prepregnant recipient mice. The genomic region surrounding the target sites was amplified from genomic DNA of resultant founder progeny by PCR using the following primers: 5’-TCTGAGGAGCCCCAAGATGT 3’, 5’-CCACTCGCACAAAGCACTTG-3’. After verifying the Foxp3 domain-swap mutations by sequencing, Foxp3 DSM mice were bred with Foxp3^Thy1.1 mice and analyzed to determine the outcomes of the Foxp3 domain-swap mutation. Details of the ssDNA sequence are listed in Supplementary Table 1.

Liu Z., Lee D.S., Liang Y., Zheng Y, & Dixon J.R. (2023). Foxp3 Orchestrates Reorganization of Chromatin Architecture to Establish Regulatory T Cell Identity. bioRxiv.

Publication Preprint 2023

Amino Acids Base Pairing Clustered Regularly Interspaced Short Palindromic Repeats CRISPR-Associated Protein 9 DNA, Single-Stranded DNA Breaks, Double-Stranded Genome Mice, House Mutation Oligonucleotide Primers Recombinational Repair of DNA Transplant Recipients Zygote

Cytotoxicity and Genotoxicity of PM2.5 Exposure

In this study, cell viability, cellular ROS levels and DNA damage levels of GC-2spd(ts) cells were measured after exposure to PM_2.5. Cell viability was detected using the CCK-8 kit (Beyotime Biotechnology, Shanghai, China). First, 10 μL of CCK-8 reagent was added to each sample. After incubation at 37 °C in the dark for 2 h, the optical density (OD) of the samples was measured at the wavelength of 450 nm by a microplate reader (Molecular Devices, San Jose, CA, USA). Cell viability is expressed as the ratio of (OD_sample-OD_blank) to (OD_control-OD_blank). Cellular ROS levels were detected using the DCFH-DA probe. The DCFH-DA powder (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in dimethyl sulfoxide (DMSO, Purity > 99.9%, Beyotime Biotechnology, Shanghai, China) to prepare a 10 mM stock solution. It was then diluted with serum-free DMEM to 10 µM DCFH-DA solution (0.1% DMSO) and added to each sample. After incubation at 37 °C in the dark for 25 min, the cells were washed three times with phosphate-buffered saline (PBS) and collected. The collected cells were measured for fluorescence intensity by flow cytometry (Beckman, Brea, CA, USA) at the excitation wavelength of 488 nm and emission wavelength of 525 nm. The cellular ROS level was expressed as the ratio of fluorescence intensity of the sample group to the control group. For the DNA damage assay, DNA double strand break staining kit by γ-H2AX immunofluorescence (Beyotime Biotechnology, Shanghai, China) was used. When cellular DNA double strand breaks, H2AX will undergo phosphorylation modification to produce γ-H2AX. Therefore, γ-H2AX is often used as a marker of DNA damage, whose content level can reflect the degree of cellular DNA damage. After staining with the kit, the cells were observed and captured under a fluorescence microscope (Jiangnan Yongxin Optics, Nanjing, China). γ-H2AX exhibited green fluorescence at the excitation wavelength of 488 nm. The fluorescence intensity was calculated by the captured images and ImageJ software (v1.52, National Institutes of Health, Bethesda, MD, USA). The DNA damage level was expressed as the ratio of the fluorescence intensity of the sample group to the control group. All experiments were performed in three replicates to ensure the accuracy of the results.

Ge P., Liu Z., Chen M., Cui Y., Cao M, & Liu X. (2023). Chemical Characteristics and Cytotoxicity to GC-2spd(ts) Cells of PM2.5 in Nanjing Jiangbei New Area from 2015 to 2019. Toxics, 11(2), 92.

Publication 2023

Biological Assay Cells Cell Survival diacetyldichlorofluorescein DNA Breaks, Double-Stranded DNA Damage Eye Flow Cytometry Fluorescence Fluorescent Antibody Technique Markers, DNA Medical Devices Microscopy, Fluorescence Phosphates Phosphorylation Powder Saline Solution Serum Sincalide Sulfoxide, Dimethyl Vision

Evaluating γH2AX as a DNA Damage Marker

γH2AX was evaluated as a marker for DNA double-strand breaks (DDS). The phosphorylation of the histone H2AX is in fact related to the formation of DDS in response to several toxicant, oxidative stress and after cell cycle arrest [27 (link),28 (link)] and γH2AX has been proposed as the most informative marker of double-strand breaks [29 ]. A549 cells were seeded (2.5 × 10⁵ cells/well) in a 6-well cell culture plate and incubated overnight. Cells were treated with 20 or 50 µg/mL of silver NPs for 24 h or with etoposide (1.65 µM) as a positive control. At the end of the treatment, cells were washed with PBS, collected by centrifugation, fixed using 4% PFA for 15 min and permeabilized with ice-cold 90/10% methanol/PBS for 10 min. The samples were stained using Phospho-Histone H2A.X (Ser139) (20E3) Rabbit mAb (Alexa Fluor^® 488 Conjugate) (Cell Signaling Technology, Danvers, MA, USA) following the manufacturer instructions. γH2AX fluorescence intensity was measured using flow cytometry (CytoFlex, Beckman Coulter, Cassina de Pecchi, Italy). Fluorescence was measured immediately using an excitation wavelength of 488 nm and an emission wavelength of 525 nm and measuring 10,000 events for each sample.

Motta G., Gualtieri M., Saibene M., Bengalli R., Brigliadori A., Carrière M, & Mantecca P. (2023). Preliminary Toxicological Analysis in a Safe-by-Design and Adverse Outcome Pathway-Driven Approach on Different Silver Nanoparticles: Assessment of Acute Responses in A549 Cells. Toxics, 11(2), 195.

Publication 2023

A549 Cells alexa fluor 488 Cell Culture Techniques Cell Cycle Arrest Cells Centrifugation Cold Temperature DNA Breaks, Double-Stranded Etoposide Flow Cytometry Fluorescence H2AX protein, human Methanol Oxidative Stress Phosphorylation Rabbits Silver

Detecting DNA Double-Strand Breaks

The ROS inhibitors N-actetyl cysteine (NAC) (Cat: ab143032, Abcam, Cambridge, UK) and MG132 (Cat: ab141003, Abcam, Cambridge, UK) were used at concentrations of 5 mM and 300 nM, respectively, and an incubation time of 24 h. DNA double-strand breaks (DSBs) were measured by using the rabbit polyclonal to gamma H2A.X (phospho S139) antibody (Cat: ab11174, Abcam, Cambridge, UK).

Wu Z., Stangl S., Hernandez-Schnelzer A., Wang F., Hasanzadeh Kafshgari M., Bashiri Dezfouli A, & Multhoff G. (2023). Functionalized Hybrid Iron Oxide–Gold Nanoparticles Targeting Membrane Hsp70 Radiosensitize Triple-Negative Breast Cancer Cells by ROS-Mediated Apoptosis. Cancers, 15(4), 1167.

Publication 2023

Cysteine DNA Breaks, Double-Stranded Gamma Rays H2AX protein, human Immunoglobulins inhibitors MG 132 Rabbits

Generation of Endogenous Fusion Proteins using CRISPR-Cas9

CRISPR-Cas9 tagging technology was used for generation of all lines (Supplementary Data 1) that contain endogenous fusions at the C-terminus of proteins, and at the N-terminus of proteins in the parental lines of the RHku80^KO or TIR1 line^{46 (link)}. In brief, the CRISPR/Cas9 sgRNA 3’ plasmids (Supplementary Data 2) and CRISPR/Cas9 sgRNA 5’ plasmids (Supplementary Data 2) can efficiently produce Cas9 and sgRNA to create DNA double strand breaks (DSB) in parasites, and facilitates the integration of a tagging amplicon. The amplicon for the C-terminal tagging was generated from a generic plasmid (with the name pLinker-) containing a tag (6HA, AID-3xHA, AID-3Ty, 6Ty or TurboID-3Ty, etc.) as described above, using a pair of primers L and T (Supplementary Data 3). The amplicon for the N-terminal tagging was generated from a generic tagging plasmid (with the name pN-) containing a tag (Ty-TurboID, Ty-AID, HA-AID, myc-AID) using a pair of primers M and NL. The amplicon was then combined with the corresponding CRISPR/Cas9 sgRNA 3’ or 5’ plasmid (Supplementary Data 2) and transfected into recipient lines. The drug selection was followed on the second day based on the resistance marker used in the amplicons. The resistance markers with LoxP sites were excised by transfection with pmini-Cre^{96 (link)}. The cpl gene in the TIR1- AID lines was deleted using a similar CRISPR-Cas9 strategy^{94 (link)}. The complementation lines were generated by direct transfection with the plasmids containing the wild type gene (Supplementary Data 2). Transfection and drug selection were performed with 25 μg/ml mycophenolic acid (M5255, Sigma-Aldrich) and 25 μg/ml 6-xanthine (X4002, Sigma-Aldrich), 200 μg/ml 6-thioxanthine (S96242, Shanghai Yuanye Biotech), or 3 μM pyrimethamine (46706, Sigma-Aldrich)^{40 (link),46 (link)}. The lines were confirmed by IFA and diagnostic PCR, as illustrated in Supplementary Fig. 3a, b, and the PCR was designed for testing the integration site and the endogenous region with primers listed in Supplementary Data 3.

Wan W., Dong H., Lai D.H., Yang J., He K., Tang X., Liu Q., Hide G., Zhu X.Q., Sibley L.D., Lun Z.R, & Long S. (2023). The Toxoplasma micropore mediates endocytosis for selective nutrient salvage from host cell compartments. Nature Communications, 14, 977.

Publication 2023

6-thioxanthine Clustered Regularly Interspaced Short Palindromic Repeats Diagnosis DNA Breaks, Double-Stranded Generic Drugs Genes Mycophenolic Acid nucleoprotein, Measles virus Oligonucleotide Primers Parasites Parent Pharmaceutical Preparations Plasmids Protein C Pyrimethamine Transfection Xanthine

Top products related to «DNA Breaks, Double-Stranded»

Comet assay kit by Bio-Techne

Sourced in United States

The Comet Assay Kit is a laboratory tool used to assess DNA damage and repair at the single-cell level. It measures the extent of DNA fragmentation by evaluating the 'comet-like' tail formed during electrophoresis, which is proportional to the amount of DNA damage present in the cell.

In situ cell death detection kit by Roche

Sourced in Germany, United States, Switzerland, China, United Kingdom, France, Canada, Belgium, Japan, Italy, Spain, Hungary, Australia

The In Situ Cell Death Detection Kit is a laboratory product designed for the detection of programmed cell death, or apoptosis, in cell samples. The kit utilizes a terminal deoxynucleotidyl transferase (TdT) to label DNA strand breaks, allowing for the visualization and quantification of cell death. The core function of this product is to provide researchers with a tool to study and analyze cell death processes.

4 6 diamidino 2 phenylindole (dapi) by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Japan, China, Canada, Italy, Australia, France, Switzerland, Spain, Belgium, Denmark, Panama, Poland, Singapore, Austria, Morocco, Netherlands, Sweden, Argentina, India, Finland, Pakistan, Cameroon, New Zealand

DAPI is a fluorescent dye used in microscopy and flow cytometry to stain cell nuclei. It binds strongly to the minor groove of double-stranded DNA, emitting blue fluorescence when excited by ultraviolet light.

Lipofectamine 2000 by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco

Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.

4 6 diamidino 2 phenylindole (dapi) by Merck Group

Sourced in United States, Germany, Japan, United Kingdom, China, Italy, Sao Tome and Principe, France, Macao, Canada, Switzerland, Spain, Australia, Denmark, India, Poland, Israel, Belgium, Sweden, Ireland, Netherlands, Panama, Brazil, Portugal, Czechia, Puerto Rico, Austria, Hong Kong, Singapore

DAPI is a fluorescent dye that binds strongly to adenine-thymine (A-T) rich regions in DNA. It is commonly used as a nuclear counterstain in fluorescence microscopy to visualize and locate cell nuclei.

Click it plus tunel assay by Thermo Fisher Scientific

Sourced in United States, France, Germany, United Kingdom

The Click-iT Plus TUNEL Assay is a fluorescence-based method for detecting DNA fragmentation, a hallmark of apoptosis. The assay utilizes a modified nucleotide, EdUTP, which is incorporated into the DNA breaks. The incorporated EdUTP is then detected using a fluorescent azide dye, providing a quantitative measure of DNA fragmentation.

Etoposide by Merck Group

Sourced in United States, Germany, United Kingdom, Japan, France, China, Italy, Canada, Switzerland, Belgium, Macao, Portugal, Poland

Etoposide is a chemotherapeutic agent used in the treatment of various types of cancer. It is a topoisomerase inhibitor that disrupts the process of DNA replication, leading to cell death. Etoposide is available as a solution for intravenous administration.

Oxiselect dna double strand break staining kit by Cell Biolabs

Sourced in United States

The OxiSelect DNA Double-Strand Break Staining Kit is a laboratory equipment designed to detect and quantify DNA double-strand breaks. It provides a fluorescent-based method to visualize and analyze DNA damage in cells.

Bovine serum albumin (bsa) by Merck Group

Sourced in United States, Germany, United Kingdom, China, Italy, Japan, France, Sao Tome and Principe, Canada, Macao, Spain, Switzerland, Australia, India, Israel, Belgium, Poland, Sweden, Denmark, Ireland, Hungary, Netherlands, Czechia, Brazil, Austria, Singapore, Portugal, Panama, Chile, Senegal, Morocco, Slovenia, New Zealand, Finland, Thailand, Uruguay, Argentina, Saudi Arabia, Romania, Greece, Mexico

Bovine serum albumin (BSA) is a common laboratory reagent derived from bovine blood plasma. It is a protein that serves as a stabilizer and blocking agent in various biochemical and immunological applications. BSA is widely used to maintain the activity and solubility of enzymes, proteins, and other biomolecules in experimental settings.

Bx51 fluorescence microscope by Olympus

Sourced in Japan, United States, Germany, France, Italy, United Kingdom, Sweden, Canada

The BX51 is a fluorescence microscope manufactured by Olympus. It is designed to visualize and analyze fluorescently labeled samples. The microscope features advanced optics and illumination systems to provide high-quality fluorescence imaging.

What are the main causes and effects of DNA double-stranded breaks?

DNA double-stranded breaks can occur due to various factors, such as ionizing radiation, chemotherapeutic drugs, and endogenous cellular processes. These breaks in both strands of the DNA helix can lead to genetic instability, chromosomal aberrations, and cell death if not properly repaired. Understanding the mechanisms behind DNA double-stranded breaks is crucial for studying cellular repair pathways and their role in diseases like cancer.

How can researchers effectively compare DNA double-stranded break protocols from different sources?

PubCompare.ai's AI-driven comparison tool can help researchers efficiently screen and compare DNA double-stranded break protocols from literature, pre-prints, and patents. The platform's typo-free analysis can pinpoint critical insights, enabling researchers to identify the most effective protocols for their specific research goals and ensure reproducibility and accuracy of their DNA break studies.

What are the different types of DNA double-stranded breaks, and how do they affect cellular processes?

DNA double-stranded breaks can occur in different forms, such as clean breaks with compatible ends, overhanging ends, or blunt ends. These variations can impact the cellular repair mechanisms involved, which include non-homologous end joining and homologous recombination. Understating the nuances of these break types is essential for devising targeted strategies to address DNA damage and its consequences in various disease contexts.

How can PubCompare.ai assist researchers in optimizing their DNA double-stranded break studies?

PubCompare.ai's AI-driven comparison tool can help researchers screen protocol literature more efficiently and leverage artificial intelligence to pinpoint critical insights. By highlighting key differences in protocol effectiveness, the platform can enable researchers to choose the best options for their DNA double-stranded break studies, ensuring reproducibility and accuracy of their results. This can be especially helpful for researchers looking to identify the leading techniques and products for their specific research goals.

What are some common applications of DNA double-stranded break research?

DNA double-stranded break research has a wide range of applications, including studying cellular repair mechnaisms, investigating the role of DNA damage in diseases like cancer, developing new therapuetic strategies targeting DNA repair pathways, and optimizing genome editing techniques. Researchers can leverage PubCompare.ai's typo-free analysis to ensure they are using the most effective protocols and products for their DNA double-stranded break studies, ultimately contributing to advancements in these important fields.

More about "DNA Breaks, Double-Stranded"

Double-Stranded DNA Breaks (DSBs) are a critical type of DNA damage where both strands of the DNA helix are severed, often resulting in genetic instability and cell death if not properly repaired.
Understanding these DNA breaks is crucial for unraveling cellular mechanisms, DNA repair pathways, and their role in various diseases like cancer, neurodegeneration, and aging.
Researchers studying DSBs can utilize a variety of tools and techniques to investigate this phenomenon.
The Comet Assay Kit, also known as the Single Cell Gel Electrophoresis (SCGE) Assay, is a widely used method for detecting and quantifying DNA damage at the single-cell level.
The In Situ Cell Death Detection Kit, which incorporates the TUNEL (Terminal deoxynucleotidyl transferase dUTP Nick End Labeling) technique, can be employed to identify and visualize cells undergoing apoptosis or programmed cell death due to DSBs.
Fluorescent dyes like DAPI (4',6-diamidino-2-phenylindole) are often utilized to stain the cell nuclei and facilitate the visualization of DNA breaks under a fluorescence microscope, such as the BX51 system.
Transfection reagents like Lipofectamine 2000 can be used to introduce plasmids or siRNAs into cells, enabling the study of gene expression and signaling pathways involved in DSB repair.
The Click-iT Plus TUNEL Assay provides a sensitive and specific method for detecting and quantifying DSBs, while the OxiSelect DNA Double-Strand Break Staining Kit can be employed to visualize and analyze the formation of γ-H2AX, a well-established marker of DSBs.
Pharmacological agents like the topoisomerase II inhibitor etoposide can be used to induce DSBs and study the cellular responses.
Bovine serum albumin (BSA) is commonly used as a blocking agent and stabilizer in various experimental setups related to DSB research, helping to minimize non-specific binding and preserve the integrity of biomolecules.
By leveraging these tools and techniques, researchers can gain valuable insights into the mechanisms of DNA break formation, repair, and their implications in human health and disease.
PubCompare.ai's AI-driven comparison tool can assist scientists in locating the best protocols from literature, preprints, and patents, ensuring reproducible and accurate results for their DNA break studies.