Log In Sign up
The largest database of trusted experimental protocols
> Disorders > Cell or Molecular Dysfunction > Point Mutation

Point Mutation

Point mutations, also known as single nucleotide polymorphisms (SNPs), are specific DNA sequence variations where a single nucleotide in the genome is altered.
These genetic changes can have important implications for human health, disease susceptibility, and drug response.
PubCompare.ai's AI-driven platform helps researchers easily locate and compare the best protocols from literature, preprints, and patents for point mutation analysis.
Our advanced algorithms identify the most reproducible and accurate methods, optimising the research process and improving overall quality.
Discover the power of data-driven decision making to enhance your point mutation studies.

Most cited protocols related to «Point Mutation»

1
Transcript Coding Potential Assessment
To assess a transcript's coding potential, we extract six features from the transcript's nucleotide sequence. A true protein-coding transcript is more likely to have a long and high-quality Open Reading Frame (ORF) compared with a non-coding transcript. Thus, our first three features assess the extent and quality of the ORF in a transcript. We use the framefinder software (14 ) to identify the longest reading frame in the three forward frames. Known for its error tolerance, framefinder can identify most correct ORFs even when the input transcripts contain sequencing errors such as point mutations, indels and truncations (14 ,15 (link)). We extract the LOG-ODDS SCORE and the COVERAGE OF THE PREDICTED ORF as the first two features by parsing the framefinder raw output with Perl scripts (available for download from the web site). The LOG-ODDS SCORE is an indicator of the quality of a predicted ORF and the higher the score, the higher the quality. A large COVERAGE OF THE PREDICTED ORF is also an indicator of good ORF quality (14 ). We add a third binary feature, the INTEGRITY OF THE PREDICTED ORF, that indicates whether an ORF begins with a start codon and ends with an in-frame stop codon.
The large and rapidly growing protein sequence databases provide a wealth of information for the identification of protein-coding transcript. We derive another three features from parsing the output of BLASTX (16 (link)) search (using the transcript as query, E-value cutoff 1e-10) against UniProt Reference Clusters (UniRef90) which was developed as a nonredundant protein database with a 90% sequence identity threshold (17 (link)). First, a true protein-coding transcript is likely to have more hits with known proteins than a non-coding transcript does. Thus we extract the NUMBER OF HITS as a feature. Second, for a true protein-coding transcript the hits are also likely to have higher quality; i.e. the HSPs (High-scoring Segment Pairs) overall tend to have lower E-value. Thus we define feature HIT SCORE as follows:

where Eij is the E-value of the j-th HSP in frame i, Si measures the average quality of the HSPs in frame i and HIT SCORE is the average of Si across three frames. The higher the HIT SCORE, the better the overall quality of the hits and the more likely the transcript is protein-coding. Thirdly, for a true protein-coding transcript most of the hits are likely to reside within one frame, whereas for a true non-coding transcript, even if it matches certain known protein sequence segments by chance, these chance hits are likely to scatter in any of the three frames. Thus, we define feature FRAME SCORE to measure the distribution of the HSPs among three reading frames:

The higher the FRAME SCORE, the more concentrated the hits are and the more likely the transcript is protein-coding.
We incorporate these six features into a support vector machine (SVM) machine learning classifier (18 ). Mapping the input features onto a high-dimensional feature space via a proper kernel function, SVM constructs a classification hyper-plane (maximum margin hyper-plane) to separate the transformed data (18 ). Known for its high accuracy and good performance, SVM is a widely used classification tool in bioinformatics analysis such as microarray-based cancer classification (19 (link),20 (link)), prediction of protein function (21 (link),22 (link)) and prediction of subcellular localization (23 (link),24 (link)). We employed the LIBSVM package (25 ) to train a SVM model using the standard radial basis function kernel (RBF kernel). The C and gamma parameters were determined by grid-search in the training dataset. We trained the SVM model using the same training data set as CONC used (13 (link)), containing 5610 protein-coding cDNAs and 2670 noncoding RNAs.
Kong L., Zhang Y., Ye Z.Q., Liu X.Q., Zhao S.Q., Wei L, & Gao G. (2007). CPC: assess the protein-coding potential of transcripts using sequence features and support vector machine. Nucleic Acids Research, 35(Web Server issue), W345-W349.
Publication 2007
Amino Acid Sequence Base Sequence Codon, Initiator Codon, Terminator DNA, Complementary Gamma Rays Immune Tolerance INDEL Mutation Malignant Neoplasms Microarray Analysis Point Mutation Proteins Reading Frames RNA, Untranslated Staphylococcal Protein A
2
Genomic Insights into Antibiotic Resistance Profiles
In total, 150 isolates covering three species were included in the study: E. coli (n = 50) and Salmonella (n = 50) isolates from the in-house strain collection at the National Food Institute and C. jejuni (n = 50) isolates from the in-house strain collection at Statens Serum Institut. The isolates were selected on the basis of having both WGS data and phenotypes available. The Salmonella isolates included strains from 10 different serovars (Tables S1 to S3, available as Supplementary data at JAC Online). All bacterial isolates were sequenced using the Miseq platform (Illumina) to obtain paired-end sequences and assembled de novo using Velvet (reference software). Bacterial strains were screened for phenotypic resistance using MIC determinations interpreted according to EUCAST (www.eucast.org). Only the susceptibility tests relevant for antimicrobial resistance associated with chromosomal point mutations for each species were analysed (Table 2). As resistance to some of the antimicrobial agents can be caused by either acquired genes or chromosomal point mutations, ResFinder-2.1 (www.genomicepidemiology.org)31 (link) was used to detect known acquired resistance genes in the WGS data, using a threshold of 98% identity (%ID) and 60% length (minimum percentage length of the resistance gene to be covered). All isolates with disagreement between the phenotypic and predicted susceptibility were re-tested.

Antimicrobial agents used for susceptibility tests for each species

SpeciesAntimicrobial agents
E. coliciprofloxacin, nalidixic acid, colistin, sulphonamide, tetracycline, spectinomycin
Salmonellaciprofloxacin, nalidixic acid, colistin, spectinomycin
C. jejuniciprofloxacin, nalidixic acid, erythromycin, spectinomycin

Acquired resistance genes, chromosomal point mutations or both can cause resistance to antimicrobial agents.

Zankari E., Allesøe R., Joensen K.G., Cavaco L.M., Lund O, & Aarestrup F.M. (2017). PointFinder: a novel web tool for WGS-based detection of antimicrobial resistance associated with chromosomal point mutations in bacterial pathogens. Journal of Antimicrobial Chemotherapy, 72(10), 2764-2768.
Publication 2017
Bacteria Chromosomes Colistin Drug Resistance, Microbial Erythromycin Escherichia coli Food Genes Microbicides Nalidixic Acid Phenotype Point Mutation Salmonella Serum Strains Sulfonamides Susceptibility, Disease Tetracycline
3
Site-Directed Mutagenesis Using Recombineering
Oligos used to replace the galK-targeting cassette were obtained from Invitrogen. dsDNA was used and the oligos (sense and antisense) annealed in vitro: 10 μg of each oligo (sense and antisense) was mixed in an eppendorf tube in a total volume of 100 μl of 1× PCR buffer (Expand High Fidelity PCR kit, Roche Applied Science) and boiled for 5 min, allowed to cool to room temperature for 30 min, ethanol precipitated and resuspended in 100 μl ddH2O to a final concentration of 200 ng/μl double-stranded oligo. An aliquot of 1 μl (200 ng) was used in the recombineering experiments. To introduce the G12D (G<>A) point mutation in the Nras BAC CITB 50J2, the following oligos were used for the second step (the introduced adenosine/thymidine base pair is underlined, the flanking sequences are homologous to the Nras BAC sequence): G12D S: 5′-TTTTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGATGGTGTTGGGAAAAGCGCCTTGACGATCCAGCTAATCCAGAACCACTTT-3′; G12D AS: 5′-AAAGTGGTTCTGGATTAGCTGGATCGTCAAGGCGCTTTTCCCAACACCATCTGCTCCAACCACCACCAGTTTGTACTCAGTCATTTCACACCAGCAAAAA-3′. To introduce a loxP511 site in the RP23-341F12 BAC, the following oligos were used for the second step (loxP511 is underlined, the flanking sequences are homologous to the BAC sequence around position 95 kb): 95 kb loxP511 S: 5′-ACGTGTGAGCTCCGTGGACAACTCTCCCCGAAGATAACTTCGTATAGTATACATTATACGAAGTTATGTGACTCAGGGACCCTCTCAAGTGAGGCTCAGC-3′; 95 kb loxP511 AS: 5′-GCTGAGCCTCACTTGAGAGGGTCCCTGAGTCACATAACTTCGTATAATGTATACTATACGAAGTTATCTTCGGGGAGAGTTGTCCACGGAGCTCACACGT-3′.
Warming S., Costantino N., Court D.L., Jenkins N.A, & Copeland N.G. (2005). Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Research, 33(4), e36.
Publication 2005
2',5'-oligoadenylate Adenosine Base Pairing Buffers DNA, Double-Stranded Ethanol Homologous Sequences NRAS protein, human Oligonucleotides Point Mutation Thymidine
4
Whole-Genome Sequencing of Multiple Myeloma
Informed consent from MM patients was obtained in line with the Declaration of Helsinki. DNA was extracted from bone marrow aspirate (tumor) and blood (normal). WGS libraries (370-410 bp inserts) and WES libraries (200-350 bp inserts) were constructed and sequenced on an Illumina GA-II sequencer using 101 and 76 bp paired-end reads, respectively. Sequencing reads were procesed with the Firehose pipeline, identifying somatic point mutations, indels, and other structural chromosomal rearrangements. Structural rearrangements affecting protein-coding regions were then subjected to manual review to exclude alignment artifacts. True positive mutation rates were estimated by Sequenom mass spectrometry genotyping of randomly selected mutations. HOXA9 shRNAs were introduced into MM cell lines using lentiviral infection using standard methods.
A complete description of the materials and methods are provided in the Supplementary Information.
Chapman M.A., Lawrence M.S., Keats J.J., Cibulskis K., Sougnez C., Schinzel A.C., Harview C.L., Brunet J.P., Ahmann G.J., Adli M., Anderson K.C., Ardlie K.G., Auclair D., Baker A., Bergsagel P.L., Bernstein B.E., Drier Y., Fonseca R., Gabriel S.B., Hofmeister C.C., Jagannath S., Jakubowiak A.J., Krishnan A., Levy J., Liefeld T., Lonial S., Mahan S., Mfuko B., Monti S., Perkins L.M., Onofrio R., Pugh T.J., Vincent Rajkumar S., Ramos A.H., Siegel D.S., Sivachenko A., Trudel S., Vij R., Voet D., Winckler W., Zimmerman T., Carpten J., Trent J., Hahn W.C., Garraway L.A., Meyerson M., Lander E.S., Getz G, & Golub T.R. (2011). Initial genome sequencing and analysis of multiple myeloma. Nature, 471(7339), 467-472.
Publication 2011
BLOOD Bone Marrow Cell Lines Chromosomes Diploid Cell Gene Rearrangement HOXA9 protein, human INDEL Mutation Infection Mass Spectrometry Multiple Acyl Coenzyme A Dehydrogenase Deficiency Mutation Neoplasms Open Reading Frames Patients Point Mutation Short Hairpin RNA
5
Whole-Genome Sequencing of Multiple Myeloma
Informed consent from MM patients was obtained in line with the Declaration of Helsinki. DNA was extracted from bone marrow aspirate (tumor) and blood (normal). WGS libraries (370-410 bp inserts) and WES libraries (200-350 bp inserts) were constructed and sequenced on an Illumina GA-II sequencer using 101 and 76 bp paired-end reads, respectively. Sequencing reads were procesed with the Firehose pipeline, identifying somatic point mutations, indels, and other structural chromosomal rearrangements. Structural rearrangements affecting protein-coding regions were then subjected to manual review to exclude alignment artifacts. True positive mutation rates were estimated by Sequenom mass spectrometry genotyping of randomly selected mutations. HOXA9 shRNAs were introduced into MM cell lines using lentiviral infection using standard methods.
A complete description of the materials and methods are provided in the Supplementary Information.
Chapman M.A., Lawrence M.S., Keats J.J., Cibulskis K., Sougnez C., Schinzel A.C., Harview C.L., Brunet J.P., Ahmann G.J., Adli M., Anderson K.C., Ardlie K.G., Auclair D., Baker A., Bergsagel P.L., Bernstein B.E., Drier Y., Fonseca R., Gabriel S.B., Hofmeister C.C., Jagannath S., Jakubowiak A.J., Krishnan A., Levy J., Liefeld T., Lonial S., Mahan S., Mfuko B., Monti S., Perkins L.M., Onofrio R., Pugh T.J., Vincent Rajkumar S., Ramos A.H., Siegel D.S., Sivachenko A., Trudel S., Vij R., Voet D., Winckler W., Zimmerman T., Carpten J., Trent J., Hahn W.C., Garraway L.A., Meyerson M., Lander E.S., Getz G, & Golub T.R. (2011). Initial genome sequencing and analysis of multiple myeloma. Nature, 471(7339), 467-472.
Publication 2011
BLOOD Bone Marrow Cell Lines Chromosomes Diploid Cell Gene Rearrangement HOXA9 protein, human INDEL Mutation Infection Mass Spectrometry Multiple Acyl Coenzyme A Dehydrogenase Deficiency Mutation Neoplasms Open Reading Frames Patients Point Mutation Short Hairpin RNA

Most recents protocols related to «Point Mutation»

1
Expression and Purification of Polymerase Variants
Not available on PMC !

Example 1

Expression strain generation. The TdT mouse gene may be generated from the pET28 plasmid described in [Boulé et al., 1998, Mol. Biotechnol. 10, 199-208]. For example, the gene may be amplified by using the following primers:

T7-pro:
(SEQ ID No. 33)
TAATACGACTCACTATAGGG
T7-ter:
(SEQ ID No. 34)
GCTAGTTATTGCTCAGCGG
through standard molecular biology techniques. The sequence is then cloned into plasmid pET32 backbone to give the new pCTdT plasmid. After sequencing pCTdT is transformed into commercial E. coli cells, BL21 (DE3, from Novagen). Growing colonies on plate with kanamycin are isolated and named Ec-CTdT.Polymerase variants generation. The pCTdT vector is used as starting vector. Specific primers comprising one or several point mutations have been generated from Agilent online software (http://www.genomics.agilent.com:80/primerDesignProgram.jsp). The commercially available kit QuickChange II (Agilent) may be used to generate the desired modified polymerase comprising the targeted mutations. Experimental procedure follows the supplier's protocol. After generation of the different vectors, each of them is sequenced. Vectors with the correct sequence are transformed in E. coli producer strains. Clones able to grow on kanamycin LB-agar plates are isolated.

Expression. The Ec-CTdT and Ec-DSi or Ec-DSi′ strains may be used for inoculating 250 mL erlens with 50 mL of LB media supplemented with appropriate amount of kanamycin. After overnight growth at 37° C., appropriate volumes of these pre-cultures are used to inoculate 5 L erlens with 2 L LB media with kanamycin. The initial OD for the 5 L cultures is chosen to be 0.01. The erlens are put at 37° C. under strong agitation and the OD of the different cultures are regularly checked. After reaching an OD comprised between 0.6 and 0.9 each erlen is supplemented by the addition of 1 mL of 1M IPTG (Isopropyl β-D-1-thiogalactopyranoside, Sigma). The erlens are put back to agitation under a controlled temperature of 37° C. After overnight expression, the cells are harvested in several pellets. Pellets expressing the same variants are pooled and stored at −20° C., eventually for several months.

Extraction. Previously prepared pellets are thawed in 30 to 37° C. water bath. Once fully thawed, pellets are resuspended in lysis buffer composed of 50 mM tris-HCL (Sigma) pH 7.5, 150 mM NaCl (Sigma), 0.5 mM mercaptoethanol (Sigma), 5% glycerol (Sigma), 20 mM imidazole (Sigma) and 1 tab for 100 mL of protease cocktail inhibitor (Thermofisher). Careful resuspension is carried out in order to avoid premature lysis and remaining of aggregates. Resuspended cells are lysed through several cycles of French press, until full color homogeneity is obtained. Usual pressure used is 14,000 psi. Lysate is then centrifuged for 1 h to 1h30 at 10,000 rpm. Centrifugate is pass through a 0.2 μm filter to remove any debris before column purification.

Purification. A one-step affinity procedure is used to purify the produced and extracted polymerase enzymes. A Ni-NTA affinity column (GE Healthcare) is used to bind the polymerases. Initially the column has been washed and equilibrated with 15 column volumes of 50 mM tris-HCL (Sigma) pH 7.5, 150 mM NaCl (Sigma) and 20 mM imidazole (Sigma). Polymerases are bound to the column after equilibration. Then a washing buffer, composed of 50 mM tris-HCL (Sigma) pH 7.5, 500 mM NaCl (Sigma) and 20 mM imidazole (Sigma), is applied to the column for 15 column volumes. After wash the polymerases are eluted with 50 mM tris-HCL (Sigma) pH 7.5, 500 mM NaCl (Sigma) and 0.5M imidazole (Sigma). Fractions corresponding to the highest concentration of polymerases of interest are collected and pooled in a single sample. The pooled fractions are dialyzed against the dialysis buffer (20 mM Tris-HCl, pH 6.8, 200 mM Na Cl, 50 mM MgOAc, 100 mM [NH4]2SO4). The dialysate is subsequently concentrated with the help of concentration filters (Amicon Ultra-30, Merk Millipore). Concentrated enzyme is distributed in small aliquots, 50% glycerol final is added, and those aliquots are then frozen at −20° C. and stored for long term. 5 μL of various fraction of the purified enzymes are analyzed in SDS-PAGE gels.

US11859217B2. Terminal deoxynucleotidyl transferase variants and uses thereof (2024-01-02). DNA Script [FR]. Inventors: Elise Champion [FR], Jéröme Loc'h [FR], Mikhael Soskine [FR], Elodie Sune [FR].
Full text: Click here
Patent 2024
2-Mercaptoethanol Agar Bath Buffers Cells Clone Cells Cloning Vectors Dialysis Dialysis Solutions Enzymes Escherichia coli Freezing Gels Genes Glycerin imidazole Isopropyl Thiogalactoside Kanamycin Mus Mutagenesis, Site-Directed Oligonucleotide Primers Pellets, Drug Plasmids Point Mutation Premature Birth Pressure SDS-PAGE SERPINA1 protein, human Sodium Chloride Tromethamine Vertebral Column
2
Urinary exRNA Identifies Dystrophinopathy
Not available on PMC !

Example 5

We also examined exRNA from a BMD patient with a normal DMD coding sequence, but a point mutation in intron 67 (c9807+6 T>G substitution). The normal coding sequence presumably produces a full-length dystrophin protein, suggesting the mutation in this patient causes dystrophinopathy by an overall reduction of dystrophin protein expression. RT-PCR analysis identified a splice product corresponding to the normal DMD exon 67-68 sequence in urine and serum from this patient and a UA subject, identical to muscle tissue (FIG. 6C). In addition, a second larger product unique to the BMD samples was evident. DNA sequencing confirmed the larger band was a heteroduplex containing the normal product identical to that in the lower band, as well as one with inclusion of the 1st five nucleotides of intron 67, indicating a cryptic splice site (FIG. 6D) created by the mutation. The result is a frame shift and premature termination codon in exon 68, reducing functional dystrophin protein expression (FIG. 6E). Thus, urine exRNA also can be used to identify this molecular disease mechanism. The expression in the kidney of DMD transcripts spanning the deletions and point mutation (FIG. 12D) is consistent with the urinary tract as the primary source of exRNA in urine.

US11866783B2. Extracellular mRNA markers of muscular dystrophies in human urine (2024-01-09). The General Hospital Corporation [US]. Inventors: Thurman Wheeler [US], Xandra O. Breakefield [US], Leonora Balaj [US].
Full text: Click here
Patent 2024
Codon, Nonsense Cryptic Splice Sites Exons Gene Deletion Hereditary Diseases Introns Kidney Muscle Tissue Mutation Nucleotides Open Reading Frames Patients Point Mutation Proteins Reading Frames Reverse Transcriptase Polymerase Chain Reaction Serum Urinary Tract Urine
3
Engineered NFAT and AP-1 Transcription Factor Constructs
The pMIGR1 vector (Pear et al., 1998 (link)) was modified to encode either Thy1.1 or ZsGreen (Matz et al., 1999 (link)) downstream of the IRES site instead of GFP. Constructs encoding NFAT1, NFAT2, cJun, cFos, or their mutants were cloned into the multiple cloning site using the In-Fusion HD Cloning Kit (Clontech Laboratories). Vectors encoding NFAT1 (gift from Anjana Rao, ID 11791; Addgene), NFAT1-CA (gift from Anjana Rao, ID 11792; Addgene), NFAT2 (gift from Anjana Rao, ID 11101; Addgene; Monticelli and Rao, 2002 (link)), NFAT2-CA (gift from Anjana Rao, ID 11793; Addgene), cJun (gift from Axel Behrens, ID 47443; Addgene; Aguilera et al., 2011 (link)), and cFos (MC203181; Origene) were used as cDNA templates. Based on the sequence alignment of NFAT1 and NFAT2, the R471A/L472A/T538G point mutations, designed to mimic the R468A/I469A/T535G point mutations in NFAT1-CARIT that impair AP-1 binding (Macián et al., 2000 (link)), were introduced into NFAT2 and NFAT2-CA using PCR-directed site mutagenesis to create NFAT2-RIT and NFAT2-CARIT, respectively. TAM67, a dominant negative mutant of cJun lacking residues 3–122 (Brown et al., 1993 (link)), was cloned from the cJun vector.
Seth A., Yokokura Y., Choi J.Y., Shyer J.A., Vidyarthi A, & Craft J. (2023). AP-1–independent NFAT signaling maintains follicular T cell function in infection and autoimmunity. The Journal of Experimental Medicine, 220(5), e20211110.
Publication 2023
Cloning Vectors DNA, Complementary Internal Ribosome Entry Sites Mutagenesis Pears Point Mutation Sequence Alignment
4
Antibiotic Resistance Gene Identification
The identification of putative determinants conferring resistance to quinolones, erythromycin, aminoglycosides and tetracycline was performed as previously described [35 (link)]. Briefly, assembled contigs were screened for AMR-associated genes with ABRicate (version 0.8.10; https://github.com/tseemann/abricate) using the National Center for Biotechnology Information (NCBI) database [36 (link)], ResFinder 3.0 [37 (link)] and the Comprehensive Antibiotic Resistance Database (CARD) v3.1.0 [38 (link)], with a threshold for the identification of acquired genes of 90 % identity and 60 % minimum length. Chromosomal resistance-mediating point mutations were identified using the PointFinder database embedded in ResFinder 4.0 [39 (link)].
Ghielmetti G., Seth-Smith H.M., Roloff T., Cernela N., Biggel M., Stephan R, & Egli A. (2023). Whole-genome-based characterization of Campylobacter jejuni from human patients with gastroenteritis collected over an 18 year period reveals increasing prevalence of antimicrobial resistance. Microbial Genomics, 9(2), mgen000941.
Full text: Click here
Publication 2023
Aminoglycosides Antibiotic Resistance, Microbial Chromosomes Erythromycin Genes Point Mutation Quinolones Tetracycline
5
Modeling F42V Point Mutation in HL2-KOA1
Fastdesign was used (input PDB 2ERJ) to model the F42V point mutation in designed construct HL2-KOA1. Native rotamers were preserved. Rosetta modeling was used to compute Rosetta energy units and to visualize contacts and clashes. Structures were visualized in PyMOL.
Tursi N.J., Xu Z., Helble M., Walker S., Liaw K., Chokkalingam N., Kannan T., Wu Y., Tello-Ruiz E., Park D.H., Zhu X., Wise M.C., Smith T.R., Majumdar S., Kossenkov A., Kulp D.W, & Weiner D.B. (2023). Engineered antibody cytokine chimera synergizes with DNA-launched nanoparticle vaccines to potentiate melanoma suppression in vivo. Frontiers in Immunology, 14, 1072810.
Full text: Click here
Publication 2023
Point Mutation

Top products related to «Point Mutation»

1
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
2
Q5 site directed mutagenesis kit by New England Biolabs
Sourced in United States, United Kingdom, Germany, China, Canada, Singapore, Japan, Morocco, France
The Q5 Site-Directed Mutagenesis Kit is a laboratory tool designed for introducing precise mutations into DNA sequences. It provides a streamlined workflow for generating site-specific changes in plasmid or linear DNA templates.
3
Quikchange 2 site directed mutagenesis kit by Agilent Technologies
Sourced in United States, United Kingdom, Canada, Italy, Germany, France, Sweden
The QuikChange II Site-Directed Mutagenesis Kit is a laboratory equipment product used for introducing site-specific mutations into double-stranded plasmid DNA. The kit provides a rapid and efficient method for performing these mutations.
4
Quikchange site directed mutagenesis kit by Agilent Technologies
Sourced in United States, Germany, United Kingdom, Canada, Japan, Belgium, France, China
The QuikChange site-directed mutagenesis kit is a tool used in molecular biology for introducing specific mutations into double-stranded plasmid or linear DNA templates. The kit provides a fast and efficient method for generating site-specific mutations, insertions, or deletions without the need for subcloning, library construction, or other specialized techniques.
5
Dual luciferase reporter assay system by Promega
Sourced in United States, China, Germany, United Kingdom, Switzerland, Japan, France, Italy, Spain, Austria, Australia, Hong Kong, Finland
The Dual-Luciferase Reporter Assay System is a laboratory tool designed to measure and compare the activity of two different luciferase reporter genes simultaneously. The system provides a quantitative method for analyzing gene expression and regulation in transfected or transduced cells.
6
Quikchange 2 xl site directed mutagenesis kit by Agilent Technologies
Sourced in United States, Germany, Canada, United Kingdom, France
The QuikChange II XL Site-Directed Mutagenesis Kit is a lab equipment product designed for introducing site-specific mutations in double-stranded plasmid DNA. It utilizes a proprietary DNA polymerase enzyme and specialized reaction components to efficiently generate desired mutations.
7
Quikchange lightning site directed mutagenesis kit by Agilent Technologies
Sourced in United States, Germany, Canada, United Kingdom, France, China
The QuikChange Lightning Site-Directed Mutagenesis Kit is a laboratory tool used to perform rapid and efficient site-specific mutations in double-stranded plasmid DNA. The kit provides a reliable and straightforward method for introducing desired sequence changes without the need for subcloning.
8
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.
9
Pcdna3 by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Japan, Canada, France, Sweden, Netherlands, Italy, Portugal, Spain, Australia, Denmark
The PcDNA3.1 is a plasmid vector used for the expression of recombinant proteins in mammalian cells. It contains a powerful human cytomegalovirus (CMV) promoter, which drives high-level expression of the inserted gene. The vector also includes a neomycin resistance gene for selection of stable transfectants.
10
Quickchange site directed mutagenesis kit by Agilent Technologies
Sourced in United States, Canada, France, United Kingdom, Japan, Germany
The QuickChange site-directed mutagenesis kit is a tool used to introduce specific mutations into double-stranded plasmid DNA. It allows for the rapid and efficient creation of site-specific mutations, insertions, or deletions within a DNA sequence.

More about "Point Mutation"

Point mutations, also known as single nucleotide polymorphisms (SNPs), are specific DNA sequence variations where a single nucleotide in the genome is altered.
These genetic changes, which can be studied using techniques like the Lipofectamine 2000 transfection reagent, the Q5 Site-Directed Mutagenesis Kit, the QuikChange II Site-Directed Mutagenesis Kit, and the Dual-Luciferase Reporter Assay System, can have important implications for human health, disease susceptibility, and drug response.
PubCompare.ai's AI-driven platform helps researchers easily locate and compare the best protocols from literature, preprints, and patents for point mutation analysis, including methods like the QuikChange II XL Site-Directed Mutagenesis Kit and the QuikChange Lightning Site-Directed Mutagenesis Kit.
Our advanced algorithms, which can be used with plasmids like pcDNA3.1, identify the most reproducible and accurate methods, optimizing the research process and improving overall quality.
Discover the power of data-driven decision making to enhance your point mutation studies and unlock new insights into genetic variations, disease mechanisms, and personalized medicine.
Whether you're working with single nucleotide polymorphisms, point mutations, or other genetic alterations, PubCompare.ai's AI-powered platform can help you streamline your research and uncover the most effective protocols.