> Disorders > Disease or Syndrome > Arteriosclerosis

Arteriosclerosis

Q: What is the difference between arteriosclerosis and atherosclerosis?

Arteriosclerosis is a general term that refers to the hardening and thickening of the arterial walls. Atherosclerosis is a specific type of arteriosclerosis where plaque, made up of cholesterol, fat, and other substances, builds up inside the arteries. While arteriosclerosis can lead to atherosclerosis, they are not exactly the same condition.

Q: What are the main risk factors for arteriosclerosis?

The primary risk factors for arteriosclerosis include high blood pressure, high cholesterol, diabetes, obesity, smoking, lack of exercise, and a diet high in saturated and trans fats. Identifying and managing these risk factors is crucial for preventing or slowing the progression of arteriosclerosis.

Q: How can PubCompare.ai help with arteriosclerosis research?

PubCompare.ai allows researchers to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform's AI-driven analysis can help identify the most effective protocols related to arteriosclerosis, enabling researchers to choose the best option for reproducibility and accuracy. This can enhance the quality and impact of arteriosclerosis studies.

Q: What are some common treatments for arteriosclerosis?

The main treatments for arteriosclerosis include lifestyle changes (e.g., diet, exercise, smoking cessation), medications (e.g., statins, blood pressure medications, aspirin), and in some cases, surgical interventions (e.g., angioplasty, stent placement, bypass surgery). The specific treatment plan will depend on the severity of the condition and the individual's overall health status.

Q: Can arteriosclerosis be reversed?

In some cases, early-stage arteriosclerosis can be slowed or even reversed through lifestyle changes and medical treatment. However, advanced arteriosclerosis is generally not reversible, and the focus shifts to managing symptoms and preventing further progression of the disease. Maintaining a healthy lifestyle and managing risk factors are key to reducing the impact of arteriosclerosis.

Arteriosclerosis is a general term for several diseases in which the arterial wall thickens and loses elasticty, commonly referred to as hardening of the arteries.
This condition can lead to decreased blood flow and increased risk of cardiovascular events like heart attack and stroke.
Researchers can optimize their Arteriosclerosis studies by utilizing PubCompare.ai to locate the best protocols from literature, preprints, and patents.
The AI-driven comparisons help identify the most effective protocols and prodcuts, enhancing reproducibility and accuracy.
Explore the power of PubCompare.ai today to take your Arteriosclerosis rearch to new hieghts.

Most cited protocols related to «Arteriosclerosis»

Blood Pressure Trajectories and Subclinical Atherosclerosis

Blood pressure trajectories were modeled among all 4,681 CARDIA participants with BP measured at 3 or more exams. Only 3,442 participants with CAC data available at year 25 were included in the models examining the association between blood pressure and CAC >100. We used latent class models to identify subgroups within the CARDIA cohort that share a similar underlying trajectory in BP. These models were fit using SAS Proc Traj.^{25 -27 (link)} See statistical appendix for more details on the trajectory modeling process. In order to estimate the association of trajectory group on subclinical atherosclerosis, trajectory group membership was included as an independent variable in a logistic regression model examining predictors of the presence of CAC Agatston score ≥ 100 at Exam Year 25. The adjusted model included baseline age, race, sex, highest level of education, antihypertensive medication use at each exam, mg/dL of total cholesterol per year, cumulative number of years with diabetes, cumulative number of years as a current smoker, and BMI at both baseline and Y25. As in other studies, in order to account for the uncertainty in BP trajectory group assignment the posterior probability of group membership we generated 20 multiple imputations of trajectory membership using the posterior probabilities.^{28 (link)} We then fit the logistic regression model for each of the 20 data sets and combined our results across the multiple imputations. Model calibration was examined using the Hosmer-Lemeshow goodness-of fit chi-square statistic. We compared the predictive utility of trajectory group as compared to other longitudinal BP measures (single baseline BP measurements, multiple BP measurements [baseline and Y25] and cumulative BP [mm Hg × years]) using the logistic C-statistic and the discrimination (D statistic)²⁹of the models for each of these BP measures individually and jointly. The D-statistic represents the difference in the average of event probabilities between the groups which experience the event and those who do not. The Wilcoxon test was used to detect significant location shifts and differences in the distributions of the predicted event probabilities. In order to quantify how the model reclassifies individuals with the addition of trajectory group, we calculated the Integrated Discrimination Improvement (IDI) index by calculating the difference in the D-statistics (discrimination slopes) between the models including only baseline BP or year 25 BP and those including trajectory group. All analyses were completed in SAS version 9.3. P-values < 0.05 were considered statistically significant.

Allen N.B., Siddique J., Wilkins J., Shay C., Lewis C.E., Goff D.C., Jacobs DR J.r., Liu K, & Lloyd-Jones D. (2014). Blood Pressure Trajectories in Early Adulthood and Subclinical Atherosclerosis in Middle Age. JAMA : the journal of the American Medical Association, 311(5), 490-497.

Publication 2014

Antihypertensive Agents Arteriosclerosis Blood Pressure Cardia Cholesterol Diabetes Mellitus Discrimination, Psychology

Genome-Wide Meta-Analysis of Periodontal Traits

The contributing studies were (1) Atherosclerosis Risk in Communities (ARIC); (2) The Center for Oral Health in Appalachia cohort 1 (COHRA1), which is part of the GENEVA caries consortium; (3) the Dental Registry and DNA Repository of the University of Pittsburgh School of Dental Medicine, (DRDR), also part of the GENEVA caries consortium; (4) the Hispanic Community Health Study/Study of Latinos (HCHS/SOL); (5) the Malmö Diet and Cancer Study (MDC); 6) the Northern Finland Birth Cohort 1966 (NFBC 1966); (7) the Study of Health in Pomerania (SHIP), (8) the Study of Health in Pomerania Trend (SHIP Trend); (9) TWINGENE, which is a genotyped epidemiological study recruited from the Swedish Twin Registry (TWINGENE); (10) the Women’s Genome Health Study (WGHS); (11) Biobank Japan (BBJ) and (12) Tokyo Medical and Dental University Aggressive Periodontitis Study (TMDUAGP). A detailed description of each study is included in (Supplementary Data 1 and 2).
In nine studies, analysis was conducted in individuals of European ancestry (ARIC, COHRA1, DRDR, MDC, NFBC1966, SHIP, SHIP-TREND, TWINGENE and WGHS). In one study (HCHS/SOL), participants were recruited from Hispanic and Latino communities in the USA, who self-reported ancestry from six broad groups (Cuban, Dominican, Mexican, Puerto Rican, Central American and South American). To undertake analyses within this highly admixed population, a bespoke modelling approach was undertaken. Multi-dimensional clustering was used to generate genetic analysis groups containing participants of similar ancestry. These group allocations were then used as covariates in a linear mixed model (partitioned to only fit the proportion of genetic structure due to familial relatedness rather than ancestry) alongside the first five genetic principal components, study center and log-transformed sampling weights^{53 (link)}. Subsequently, the results from HCHS/SOL were treated as a study of European ancestry and included in the primary meta-analysis.
For periodontitis only, there were two studies with participants of East Asian ancestry (BBJ, TMDUAGP), totalling 17,287 participants. For periodontitis, separate meta-analyses were performed for studies of European ancestry and studies of East Asian ancestry.

Shungin D., Haworth S., Divaris K., Agler C.S., Kamatani Y., Keun Lee M., Grinde K., Hindy G., Alaraudanjoki V., Pesonen P., Teumer A., Holtfreter B., Sakaue S., Hirata J., Yu Y.H., Ridker P.M., Giulianini F., Chasman D.I., Magnusson P.K., Sudo T., Okada Y., Völker U., Kocher T., Anttonen V., Laitala M.L., Orho-Melander M., Sofer T., Shaffer J.R., Vieira A., Marazita M.L., Kubo M., Furuichi Y., North K.E., Offenbacher S., Ingelsson E., Franks P.W., Timpson N.J, & Johansson I. (2019). Genome-wide analysis of dental caries and periodontitis combining clinical and self-reported data. Nature Communications, 10, 2773.

Publication 2019

Aggressive Periodontitis Arteriosclerosis Asian Persons Birth Cohort Central American People Childbirth Dental Caries Dental Health Services Diet East Asian People Europeans Gene Components Genetic Structures Genome Hispanics Latinos Malignant Neoplasms Periodontitis Pharmaceutical Preparations Pharmaceutical Preparations, Dental Puerto Ricans South American People Twins Woman

Atherosclerosis Susceptibility in LDLr-Deficient Mice

Male apolipoprotein B100-only, low density lipoprotein receptor (LDLr) deficient (LDLr^-/-Apob^100/100) mice were used in this study. These mice were chosen based on previous reports documenting their “human-like” lipoprotein profile,20 (link) atherosclerosis susceptibility,20 (link) and responsiveness to dietary fatty acids.21 (link) All mice were on a mixed background (∼75% C57BL/6 and ∼25% 129Sv/Jae). At 6 weeks of age, the mice were switched from a diet of rodent chow to one of two synthetic diets containing 12% of energy as saturated fatty acid (SFA)-enriched fat (palm oil) or monounsaturated fatty acid (MUFA)-enriched fat (oleinate-enriched safflower oil) with 0.1% (w/w) cholesterol added. Please refer to Supplemental Table 1 (online) for complete analysis of dietary fatty acid composition. In conjunction with diet, mice were injected biweekly with either saline, 25 mg/kg of a non-targeting ASO (control ASO; 5 ′- TCCCATTTCAGGAGACCTGG -3′), or 25 mg/kg of an ASO targeting the knockdown of SCD1 (SCD1 ASO; 5′-GCTCTAATCACCTCAGAACT -3′). These phosphorothioate modified ASO compounds were generously provided by ISIS Pharmaceuticals, Inc. (Carlsbad, CA). Body weight was measured weekly, and food intake was measured at four weeks and eight weeks of diet/ASO treatment. All experimental animals were sacrificed after 20 weeks of parallel dietary and ASO treatment. All mice were maintained in a pathogen-free animal facility, and experimental protocols were approved by the institutional animal care and use committee at the Wake Forest University School of Medicine.

Brown J.M., Chung S., Sawyer J.K., Degirolamo C., Alger H.M., Nguyen T., Zhu X., Duong M.N., Wibley A.L., Shah R., Davis M.A., Kelley K., Wilson M.D., Kent C., Parks J.S, & Rudel L.L. (2008). Inhibition of Stearoyl-CoA Desaturase 1 (SCD1) Dissociates Insulin Resistance and Obesity From Atherosclerosis. Circulation, 118(14), 1467-1475.

Publication 2008

Animals Animals, Laboratory Apolipoprotein B-100 Arteriosclerosis Body Weight Cholesterol Diet Eating Fatty Acids Fatty Acids, Monounsaturated Forests Homo sapiens Institutional Animal Care and Use Committees LDLR protein, human Lipoproteins Low Density Lipoprotein Receptor Males Mice, House Palm Oil pathogenesis Pharmaceutical Preparations Rodent Safflower oil Saline Solution Saturated Fatty Acid Susceptibility, Disease Synthetic Diet Therapy, Diet

Kidney Biopsy Analysis Protocols

A needle-core biopsy sample of the kidney cortex was obtained during the transplantation surgery. The tissue specimen was fixed in formalin and embedded in paraffin. Two consecutive 3-μm sections were stained (one with periodic acid–Schiff and one with Masson’s trichrome) and scanned into high-resolution digital images (Aperio XT System scanner). The inclusion criteria for all the biopsy sections were that they could not contain an artifact that severely distorted microstructures, they had to have an area with at least 2 mm² of cortex, and they had to have at least four glomeruli.
Specific measurements of nephron size were the mean nonsclerotic glomerular volume and the mean cross-sectional tubular area (Fig. 1). Specific measurements of nephrosclerosis were glomerulosclerosis (globally sclerosed glomeruli in ≥10% of all glomeruli), interstitial fibrosis (fibrosis and tubular atrophy of >5% of the cortex), and arteriosclerosis (intimal thickening of >50% of an artery lumen within the biopsy sample) (Fig. 1). The total number of nephrons was calculated as the density of nonsclerotic glomeruli in the biopsy sample times the cortical volume of both kidneys and rounded to the nearest 10,000 nephrons. The single-nephron GFR was then calculated as the total GFR divided by the calculated total number of nephrons (see the Detailed Methods section in the Supplementary Appendix, available with the full text of this article at NEJM.org).

Denic A., Mathew J., Lerman L.O., Lieske J.C., Larson J.J., Alexander M.P., Poggio E., Glassock R.J, & Rule A.D. (2017). Single-Nephron Glomerular Filtration Rate in Healthy Adults. The New England journal of medicine, 376(24), 2349-2357.

Publication 2017

Arteries Arteriosclerosis Atrophy Biopsy Core Needle Biopsy Cortex, Cerebral Fibrosis Formalin Kidney Cortex Kidney Glomerulus Nephrons Nephrosclerosis Paraffin Embedding Periodic Acid Tissues Transplantation Tunica Intima

Comprehensive Physical Activity Assessment

The physical activity questionnaire developed for the Japan Arteriosclerosis Longitudinal Study (JALSPAQ) was used in this study.⁶^,^{7 (link)} This questionnaire comprises 14 questions on occupation, locomotion, housework, sleep time, and leisure-time physical activities. In this questionnaire, occupational work was assessed as duration of sitting, standing, walking, and heavy work. Heavy work was defined as lifting more than 10 kg or manual labor of similar intensity. Leisure-time physical activity was assessed by type, duration, and frequency. Questionnaire data were converted to the intensity of each physical activity expressed in metabolic equivalents (METs), according to the Compendium by Ainsworth et al, and summarized as METs·h/day and energy expenditure.^{14 (link)} In the present study, we used TEE per day, METs·h/day, and PAL as indices of physical activity level from JALSPAQ. Duration of light (<3 METs), moderate (3–5.9 METs), and vigorous (≥6 METs) physical activities was calculated for all physical activities (including occupational activity, housework, and leisure-time physical activity), as well as for leisure-time physical activity only. Working time, including occupational and housework time, was divided into the duration of sitting (<2 METs), standing (2 to <3 METs), walking (3 to <6 METs), and heavy work (≥6 METs), including housework. We calculated the durations of occupational activity and housework together because their frequencies and durations were quite complicated.

Ishikawa-Takata K., Naito Y., Tanaka S., Ebine N, & Tabata I. (2011). Use of Doubly Labeled Water to Validate a Physical Activity Questionnaire Developed for the Japanese Population. Journal of Epidemiology, 21(2), 114-121.

Publication 2011

Arteriosclerosis Energy Metabolism Light Locomotion Metabolic Equivalent Obstetric Labor Physical Examination Sleep

Most recents protocols related to «Arteriosclerosis»

Bifidobacterium breve M-16V Probiotic Composition

Not available on PMC !

Example 4

Bifidobacterium breve M-16V (NITE BP-02622) is added to 3 mL of an MRS liquid medium and is anaerobically cultured at 37° C. for 16 hours, and the culture liquid is concentrated, followed by lyophilization, to obtain a lyophilized powder of the bacterium (bacterial powder). The bacterial powder and a prebiotic (lactulose, raffinose, and galactooligosaccharide) are uniformly mixed to obtain a composition. The composition is provided to elderly persons as a liquid food for the aged. The composition is daily provided at breakfast for one week such an amount that the intake of the Bifidobacterium breve M-16V (NITE BP-02622) is 1×108⁸to 1×101¹⁰CFU/kg body/day. When Bifidobacterium breve M-16V (NITE BP-02622) is killed cells, CFU/kg body/day can be replaced by (individual cells)/kg body/day. Note that the composition may be mixed with a food or drink, such as a fermented milk. By orally administering the composition, modulation of palatability, maintenance of body temperature, and protection of a blood vessel can be expected. Furthermore, the composition can be used for preventing or treating unbalanced diet, sensitivity to cold, hypothermia, myocardial infarction, ischemia-reperfusion injury, cardiac hypertrophy, diabetic cardiomyopathy, arteriosclerosis, or vascular plaque formation.

US11857579B2. Composition for promoting the secretion of FGF21 (2024-01-02). MORINAGA MILK INDUSTRY CO., LTD. [JP]. Inventors: Tatsuya Ehara [JP], Hirohisa Izumi [JP], Takashi Shimizu [JP].

Patent 2024

Arteriosclerosis Bacteria Bifidobacterium breve Blood Vessel Body Temperature Cardiac Hypertrophy Cells Cold Temperature Dental Plaque Diabetic Cardiomyopathies Diet fibroblast growth factor 21 Food Freeze Drying Human Body Hypersensitivity Lactulose Milk, Cow's Myocardial Infarction Powder Prebiotics Raffinose Reperfusion Injury secretion

Production of Bifidobacterium breve Powder

Not available on PMC !

Example 3

Bifidobacterium breve M-16V (NITE BP-02622) is added to 3 mL of an MRS liquid medium and is anaerobically cultured at 37° C. for 16 hours, and the culture liquid is concentrated, followed by lyophilization, to obtain a lyophilized powder of the bacterium (bacterial powder). Next, crystalline cellulose is put in an agitation granulator and mixed. Then, purified water was added, followed by granulation. The granulated product is dried to obtain granules that contain an extracted component of the bacterium and an excipient. By administering the composition, modulation of palatability, maintenance of body temperature, and protection of a blood vessel can be expected. Furthermore, the composition can be used for preventing or treating unbalanced diet, sensitivity to cold, hypothermia, myocardial infarction, ischemia-reperfusion injury, cardiac hypertrophy, diabetic cardiomyopathy, arteriosclerosis, or vascular plaque formation.

US11857579B2. Composition for promoting the secretion of FGF21 (2024-01-02). MORINAGA MILK INDUSTRY CO., LTD. [JP]. Inventors: Tatsuya Ehara [JP], Hirohisa Izumi [JP], Takashi Shimizu [JP].

Patent 2024

Arteriosclerosis Bacteria Bifidobacterium breve Blood Vessel Body Temperature Cardiac Hypertrophy Cellulose Cold Temperature Cytoplasmic Granules Diabetic Cardiomyopathies Diet Excipients fibroblast growth factor 21 Freeze Drying Hypersensitivity Myocardial Infarction Powder Reperfusion Injury secretion Senile Plaques

Probiotic-Milk Protein Composition for FGF21 Secretion

Not available on PMC !

Example 2

Bifidobacterium breve M-16V (NITE BP-02622) is added to 3 mL of an MRS liquid medium and is anaerobically cultured at 37° C. for 16 hours and the culture liquid is concentrated, followed by lyophilization, to obtain a lyophilized powder of the bacterium (bacterial powder). The bacterial powder and a dry powder of a milk protein concentrate (MPC480, manufactured by Fonterra, protein content: 80% by mass, casein: whey protein=about 8:2) are uniformly mixed to obtain a composition. 20 g of the composition is diluted in 200 g of water to obtain a composition for promoting the secretion of FGF21. By administering the composition, modulation of palatability, maintenance of body temperature, and protection of a blood vessel can be expected. Furthermore, the composition can be used for preventing or treating unbalanced diet, sensitivity to cold, hypothermia, myocardial infarction, ischemia-reperfusion injury, cardiac hypertrophy, diabetic cardiomyopathy, arteriosclerosis, or vascular plaque formation.

US11857579B2. Composition for promoting the secretion of FGF21 (2024-01-02). MORINAGA MILK INDUSTRY CO., LTD. [JP]. Inventors: Tatsuya Ehara [JP], Hirohisa Izumi [JP], Takashi Shimizu [JP].

Patent 2024

Arteriosclerosis Bacteria Bifidobacterium breve Blood Vessel Body Temperature Cardiac Hypertrophy Caseins Cold Temperature Diabetic Cardiomyopathies Diet fibroblast growth factor 21 Freeze Drying Hypersensitivity Milk, Cow's Myocardial Infarction Powder Proteins Reperfusion Injury secretion Senile Plaques Staphylococcal Protein A Whey Proteins

Minimally Invasive Raynaud's Management

A total of 72 patients who were diagnosed with Raynaud’s disease and underwent CT-guided radiofrequency thermocoagulation or chemical disruption of the thoracic sympathetic chain under local anesthesia between March 2012 and March 2021 were retrospectively included. Among these patients, 44 were in the radiofrequency group (Group R) and 28 were in the alcohol group (Group A). All patients were informed of the risks and possible complications of the procedure and signed an informed consent form before treatment.
Inclusion criteria were the following: (1) those who met the diagnostic criteria related to Raynaud’s disease11 (link); (2) did not obtain significant improvement after conservative measures, drugs, and acupuncture treatment, or could not tolerate adverse drug reactions; (3) those who were able to actively cooperate to complete treatment, review and follow up.
Exclusion criteria were: (1) diagnosis of combined hypothyroidism, anemia, diabetic peripheral neuropathy, peripheral arteriosclerosis, or hypothalamic dysfunction; (2) lack of effective contact information to achieve follow-up; (3) refusal to participate in follow-up or withdrawal from the study.
This study was approved by the Ethics Committee of the First Affiliated Hospital of Jiaxing University, located in Jiaxing City, Zhejiang Province, China.

Xin B., Xie K., Huang B, & Yao M. (2023). Efficacy of Radiofrequency Thermocoagulation of the Thoracic Sympathetic Nerve versus Chemical Excision in Pain Caused by Raynaud’s Disease. Journal of Pain Research, 16, 649-658.

Publication 2023

Anemia Arteriosclerosis Diabetic Neuropathies Diagnosis Drug Reaction, Adverse Electrocoagulation Ethanol Ethics Committees, Clinical Hypothalamic Dysfunction Syndromes Hypothyroidism Local Anesthesia Patients Pharmaceutical Preparations Raynaud Disease Therapy, Acupuncture

Coagulation Dysfunction Predicts Acute Kidney Injury

All the data were divided into two categories: continuous variables and categorical data. The measurement data are expressed as the mean ± SD or median [interquartile range (IQR)]. Categorical data are expressed as the number (percentage). Continuous variables were analyzed using Student t test, and categorical variables were analyzed using chi-squared or Fisher exact test. To estimate the coagulation dysfunction of AKI and malignant events, odds ratios (ORs) and 95% CIs were calculated with univariable analysis and multivariable adjustments in the following models to reduce the effect of known possible confounders: model 1—adjusted for age, gender, acute aortic dissention (Stanford classification), smoking history, drinking history, systolic blood pressure (SBP), diastolic blood pressure (DBP), and comorbidities (including hypertension, Marfan syndrome, heart surgery history, arteriosclerosis, coronary heart disease, aortic valve disease, and diabetes mellitus type 2); model 2—adjusted model 1 + murmur in the aortic valve auscultation area, organ or limb ischemia, hypotensive shock, number of renal arteries involved, aneurysm on imaging, ulcer of the aorta, and aortic intermural hematoma; and model 3—adjusted model 2 + white blood cell count.
In addition, propensity score matching (PSM), using nearest-neighbor matching (1:1) within a caliper width of 0.02 SD without replacement, was performed between the coagulation dysfunction groups based on the estimated propensity scores. Furthermore, to confirm the robustness of the results, PSM was performed on the same results as a sensitivity analysis.
To further clarify the contribution rate of each coagulation indicator, chi-squared or Fisher exact test was used to compare the dysfunction of each coagulation indicator across the different prognosis groups. Receiver operating characteristic (ROC) curve analysis was then used to evaluate the value of each coagulative indicator and ACS for predicting the in-hospital AKI and malignant events.
Statistical analyses were performed with SPSS version 27.0 and PASS version 15. A two-sided P value of <0.05 was considered to denote the presence of a statistically significant difference.

Jiang S., Li Y., Li C., Shu Z., Wu S., Lu X., Liu Y., Deng Y., Chen Y., Cai P, & Wang B. (2023). The association of coagulation indicators with in-hospital acute kidney injury and malignant events of patients with acute aortic dissection: a retrospective cohort study. Journal of Thoracic Disease, 15(2), 658-667.

Publication 2023

Aorta Aortic Aneurysm Arteriosclerosis Auscultation Coagulation, Blood Diabetes Mellitus, Non-Insulin-Dependent Gender Heart Disease, Coronary Hematoma High Blood Pressures Hypersensitivity Ischemia Leukocyte Count Marfan Syndrome Pressure, Diastolic Prognosis Renal Artery Shock Student Surgical Procedure, Cardiac Systolic Pressure Ulcer Valve Disorder, Aortic Valves, Aortic

Top products related to «Arteriosclerosis»

Bp 203rpe 3 by Omron

Sourced in Japan, China

The BP-203RPE III is a digital blood pressure monitor designed for clinical use. It features an automatic inflation and deflation system and can measure blood pressure and pulse rate. The device is intended for professional medical use.

Fetal bovine serum (fbs) by Thermo Fisher Scientific

Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal

Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.

Penicillin by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco

Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.

Streptomycin by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama

Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.

Sas version 9 by SAS Institute

Sourced in United States, Austria, Japan, Cameroon, Germany, United Kingdom, Canada, Belgium, Israel, Denmark, Australia, New Caledonia, France, Argentina, Sweden, Ireland, India

SAS version 9.4 is a statistical software package. It provides tools for data management, analysis, and reporting. The software is designed to help users extract insights from data and make informed decisions.

Rpmi 1640 medium by Thermo Fisher Scientific

Sourced in United States, China, Germany, United Kingdom, Japan, France, Canada, Australia, Italy, Switzerland, Belgium, New Zealand, Spain, Israel, Sweden, Denmark, Macao, Brazil, Ireland, India, Austria, Netherlands, Holy See (Vatican City State), Poland, Norway, Cameroon, Hong Kong, Morocco, Singapore, Thailand, Argentina, Taiwan, Province of China, Palestine, State of, Finland, Colombia, United Arab Emirates

RPMI 1640 medium is a commonly used cell culture medium developed at Roswell Park Memorial Institute. It is a balanced salt solution that provides essential nutrients, vitamins, and amino acids to support the growth and maintenance of a variety of cell types in vitro.

Tamoxifen by Merck Group

Sourced in United States, Germany, Sao Tome and Principe, United Kingdom, Switzerland, Macao, China, Australia, Canada, Japan, Spain, Belgium, France, Italy, New Zealand, Denmark

Tamoxifen is a drug used in the treatment of certain types of cancer, primarily breast cancer. It is a selective estrogen receptor modulator (SERM) that can act as both an agonist and antagonist of the estrogen receptor. Tamoxifen is used to treat and prevent breast cancer in both men and women.

C57bl 6j by Jackson ImmunoResearch

Sourced in United States, Montenegro, Germany, United Kingdom, Japan, China, Canada, Australia, France, Colombia, Netherlands, Spain

C57BL/6J is a mouse strain commonly used in biomedical research. It is a common inbred mouse strain that has been extensively characterized.

Sas 9 by SAS Institute

Sourced in United States, Austria, Japan, Belgium, United Kingdom, Cameroon, China, Denmark, Canada, Israel, New Caledonia, Germany, Poland, India, France, Ireland, Australia

SAS 9.4 is an integrated software suite for advanced analytics, data management, and business intelligence. It provides a comprehensive platform for data analysis, modeling, and reporting. SAS 9.4 offers a wide range of capabilities, including data manipulation, statistical analysis, predictive modeling, and visual data exploration.

C57bl 6 by Jackson ImmunoResearch

Sourced in United States, Montenegro, United Kingdom, Germany, Australia, China, Canada

C57BL/6 is a widely used inbred mouse strain. It is a robust, readily available laboratory mouse model.

What is the difference between arteriosclerosis and atherosclerosis?

What are the main risk factors for arteriosclerosis?

How can PubCompare.ai help with arteriosclerosis research?

PubCompare.ai allows researchers to screen protocol literature more efficiently and leverage AI to pinpoint critical insights. The platform's AI-driven analysis can help identify the most effective protocols related to arteriosclerosis, enabling researchers to choose the best option for reproducibility and accuracy. This can enhance the quality and impact of arteriosclerosis studies.

What are some common treatments for arteriosclerosis?

The main treatments for arteriosclerosis include lifestyle changes (e.g., diet, exercise, smoking cessation), medications (e.g., statins, blood pressure medications, aspirin), and in some cases, surgical interventions (e.g., angioplasty, stent placement, bypass surgery). The specific treatment plan will depend on the severity of the condition and the individual's overall health status.

Can arteriosclerosis be reversed?

In some cases, early-stage arteriosclerosis can be slowed or even reversed through lifestyle changes and medical treatment. However, advanced arteriosclerosis is generally not reversible, and the focus shifts to managing symptoms and preventing further progression of the disease. Maintaining a healthy lifestyle and managing risk factors are key to reducing the impact of arteriosclerosis.

More about "Arteriosclerosis"

Arteriosclerosis, also known as hardening of the arteries, is a cardiovascular condition characterized by the thickening and loss of elasticity in the arterial walls.
This pathological process can lead to decreased blood flow and an increased risk of cardiovascular events such as heart attacks and strokes.
Researchers studying arteriosclerosis can optimize their research by utilizing the powerful AI-driven comparisons provided by PubCompare.ai.
This innovative platform helps researchers identify the most effective protocols, products, and techniques from the vast body of literature, preprints, and patents available.
By leveraging the insights from PubCompare.ai, researchers can enhance the reproducibility and accuracy of their arteriosclerosis studies.
This is particularly important when working with key research tools and materials, such as BP-203RPE III, FBS, Penicillin, Streptomycin, RPMI 1640 medium, Tamoxifen, and the C57BL/6J mouse model.
PubCompare.ai's AI-driven comparisons can help researchers navigate the complexities of arteriosclerosis research, ensuring that they are utilizing the most effective protocols and products.
This can lead to significant advancements in our understanding of this prevalent cardiovascular condition and ultimately improve patient outcomes.
Explore the power of PubCompare.ai today and take your arteriosclerosis research to new heights.
With its seamless integration of the latest scientific data and cutting-edge AI technology, PubCompare.ai is a valuable tool for researchers working to unravel the mysteries of arteriosclerosis and develop more effective treatments.