Log In Sign up
The largest database of trusted experimental protocols
> Disorders > Disease or Syndrome > Huntington Disease

Huntington Disease

Huntington's Disease is a rare, inherited neurodegenerative disorder characterized by uncontrolled movements, emotional problems, and loss of thinking ability.
Caused by a defective gene, it leads to progressive brain damage and the breakdown of nerve cells.
Symtoms typically appear in mid-adulthood and worsen over time, significantly impacting quality of life.
PubCompare.ai's AI-powered platform can help optimize Huntington's research by locating the best protocols from literature, preprints, and patents, enhancing reproducibility and accuracy through seamless automated comparisons and recommendations.
Unlock your Huntington's Disease research potential today.

Most cited protocols related to «Huntington Disease»

1
Transcriptional Profiling of Chicken Hearts and Human Huntington's Brains
Thirty hearts of chicken embryos of 3 days of development were isolated and separated into the five different compartments, i.e. sinus venosus (SV), atrium (A), atrioventricular canal (AVC), ventricle (V) and outflow tract (OFT). Post-mortem cortical brain tissue of eight control persons and 10 Huntington disease patients was obtained from Prof Dr R.A.C. Roos (Leiden University, the Netherlands). Total RNA was isolated using RNAeasy columns (Qiagen) according to the manufacturer's instructions. The total RNA was treated with DNase RQ1 (Promega) and the integrity of the RNA was checked using the BioAnalyzer and the Agilent RNA 6000 Nano kit (II). A 1–0.5 µg total RNA was converted into cDNA using an anchored poly-dT primer and the Superscript II (human samples) or III (chicken samples) Reverse transcription kit (Invitrogen).
Ruijter J.M., Ramakers C., Hoogaars W.M., Karlen Y., Bakker O., van den Hoff M.J, & Moorman A.F. (2009). Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Research, 37(6), e45.
Publication 2009
Autopsy Brain Cerebral Ventricles Chickens Common atrioventricular canal Cortex, Cerebral Deoxyribonucleases DNA, Complementary Embryonic Development Heart Heart Atrium Homo sapiens Huntington Disease Oligonucleotide Primers Patients Poly T Promega Reverse Transcription Sinuses, Nasal Tissues
2
Huntington's Disease Progression Monitoring
The first analysis was based on N = 730 prodromal individuals with at least 1 year and up to 7 years of follow-up data. These were participants who tested positive for the HD mutation, but did not have motor features indicating onset of diagnosable HD at the time of enrollment. Participants were seen yearly by clinicians experienced in the evaluation of movement disorders and specifically trained in administration of the Unified Huntington’s Disease Rating Scale (UHDRS) for PREDICT-HD [Huntington Study Group, 1996 (link)]. Of the 730 prodromal individuals, 137 received a HD diagnosis over the course of the study.
All aspects of the study were approved by the Institutional Review Board at each participating institution, and all aspects of the study are in compliance with the Declaration of Helsinki.
In accordance with clinical practice, diagnosis was made on the basis of “an otherwise unexplained characteristic movement disorder,” operationally defined as a score of 4 on the HD Diagnostic Rating Scale of the UHDRS. A rating of 4 indicates that the clinician had ≥ 99% certainty that the participant showed “unequivocal presence of an otherwise unexplained extrapyramidal movement disorder.” This method of diagnosis is “standard” in the respect of being approved by authorities such the Huntington Study Group (HSG)[Huntington Study Group, 1996 (link)]. Participants were excluded from the analysis if they received a rating of 4 at baseline.
Portions of the second analysis added 233 control participants, for a total sample size of N = 963. The control participants were offspring of at least one HD-diagnosed parent, but tested negative for the HD mutation (CAG repeat length < 36). Additional information about the participants and the PREDICT-HD study can be found in [Duff et al., 2010a (link); Nopoulos et al., 2011 (link); Paulsen et al., 2010b (link); Stout et al., 2011 (link)].
Zhang Y., Long J.D., Mills J.A., Warner J.H., Lu W, & Paulsen J.S. (2011). Indexing Disease Progression at Study Entry with Individuals At-Risk for Huntington Disease. American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics, 156(7), 751-763.
Publication 2011
Ethics Committees, Research Huntington Disease Movement Disorders Mutation Parent Vision
3
Quantitative PCR in Diverse Cell Types
The samples of the ‘Huntington Disease’ and the ‘serial dilution’ data series were amplified in 96-well plates in an Applied BioSystems ABI7300. The qPCR reaction was done in 20 µl with primers for ATG5 (Forward: GGCCATCAATCGGAAACTCAT; Reverse: AGCCACAGGACGAAACAGCTT; product: 123bp), PSMB5 (Forward TGTCCCAGAAGAGCCAGGAAT; Reverse: GCAATGTAAGCACCCGCTGTA; product 116 bp) or EEF1A1 (Forward: AAGCTGGAAGATGGCCCTAAA; Reverse: AAGCGACCCAAAGGTGGAT; product: 54 bp), Q-PCR SYBR Green Mastermix (Applied Biosystems) in a concentration of 0.3 µM. The used protocol was identical for all primer sets: 10 min 95°C, 40× (15 s 95°C, 30 s 60°C, 30 s 72°C).
The samples of the ‘developing chicken heart’ dataset were amplified in 384-well plates in a Roche LightCycler480. The qPCR reaction was done in 10 µl with a primer concentration of 1 µM and SYBR Green qPCR Master Mix (Roche). The primers used were NppB (Forward: GATGCCCAGGATGATGAGAG; Reverse: CCTTGGGAGGATCAGGTTCT; product 157 bp), NDUFB3 (Forward: CTCGAGGAGGTCCAAAGAAGGT; Reverse: GTGGCAGGTTTTGCATAGCC; product 101 bp). These samples were measured in three separated runs using the following protocol 5 min 96°C, 45× (10 s 95°C, 20 s 58°C, 20 s 72°C).
Ruijter J.M., Ramakers C., Hoogaars W.M., Karlen Y., Bakker O., van den Hoff M.J, & Moorman A.F. (2009). Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Research, 37(6), e45.
Publication 2009
5-nitro-2-(3-phenylpropylamino)benzoic acid Chickens EEF1A1 protein, human Heart Huntington Disease Oligonucleotide Primers PSMB5 protein, human SYBR Green I Technique, Dilution
4
Retrospective Study of Neurodegenerative Disorders
Retrospective data from 450 patients seen over 10 years in Cambridge, UK were
included. Neurological diagnoses included Parkinson’s disease (PD, n=215),
Huntington’s disease (HD, n=75), Alzheimer’s disease (AD, n=96) and behavioural
variant frontotemporal dementia (bv-FTD, n=64). All patients met internationally
recognised diagnostic criteria;12 (link)-14 (link) HD patients
had genetically confirmed disease. Patients with uncertain diagnoses were
excluded. Detailed methods of diagnostic criteria and data collection have been
described elsewhere.10 (link) All
patients had undergone the Mini-Mental State Examination (MMSE)15 (link) at the time of completing the
CBI. The study was approved by the Cambridge Local Research Ethics
Committee.
Wear H.J., Wedderburn C.J., Mioshi E., Williams-Gray C.H., Mason S.L., Barker R.A, & Hodges J.R. (2008). The Cambridge Behavioural Inventory revised. Dementia & Neuropsychologia, 2(2), 102-107.
Full text: Click here
Publication 2008
Diagnosis Huntington Disease Mini Mental State Examination Patients Pick Disease of the Brain Vision
5
Epigenetic Age Estimation Using 353 CpG Markers
We used an epigenetic biomarker of age based on 353 CpG markers as one measure of epigenetic age because: a) it is an accurate measurement of age across multiple tissues [3 (link)]; b) we previously showed that it is predictive of all-cause mortality [5 (link)]; c) it correlated with measures of cognitive/physical fitness and neuro-pathology in the elderly [19 (link),20 (link)]; and d) it was associated with conditions that are of interest in aging research including Down's syndrome [21 (link)], Huntington's disease [22 (link)], Parkinson's disease [23 (link)], obesity [24 (link)], HIV infection [25 (link)], menopause [26 (link)], centenarian status [27 (link)], ethnicity and sex [28 (link)], and cellular senescence [3 (link),29 (link)]. This epigenetic age estimator not only lends itself to measuring aging effects in elderly subjects; but also applies to prenatal brain samples [30 (link)] and blood samples from minors [31 (link)]. Epigenetic age is defined as the predicted value of age based on the DNA methylation levels of 353 CpGs. Mathematical details and software tutorials for estimating epigenetic age can be found in the additional files of [3 (link)]. All of the described epigenetic measures of aging and age acceleration are implemented in our freely available software (https://dnamage.genetics.ucla.edu) [3 (link)].
Chen B.H., Marioni R.E., Colicino E., Peters M.J., Ward-Caviness C.K., Tsai P.C., Roetker N.S., Just A.C., Demerath E.W., Guan W., Bressler J., Fornage M., Studenski S., Vandiver A.R., Moore A.Z., Tanaka T., Kiel D.P., Liang L., Vokonas P., Schwartz J., Lunetta K.L., Murabito J.M., Bandinelli S., Hernandez D.G., Melzer D., Nalls M., Pilling L.C., Price T.R., Singleton A.B., Gieger C., Holle R., Kretschmer A., Kronenberg F., Kunze S., Linseisen J., Meisinger C., Rathmann W., Waldenberger M., Visscher P.M., Shah S., Wray N.R., McRae A.F., Franco O.H., Hofman A., Uitterlinden A.G., Absher D., Assimes T., Levine M.E., Lu A.T., Tsao P.S., Hou L., Manson J.E., Carty C.L., LaCroix A.Z., Reiner A.P., Spector T.D., Feinberg A.P., Levy D., Baccarelli A., van Meurs J., Bell J.T., Peters A., Deary I.J., Pankow J.S., Ferrucci L, & Horvath S. (2016). DNA methylation-based measures of biological age: meta-analysis predicting time to death. Aging (Albany NY), 8(9), 1844-1859.
Full text: Click here
Publication 2016
Acceleration Aged associated conditions Biological Markers BLOOD Brain Cellular Senescence Centenarians Cognition cytidylyl-3'-5'-guanosine DNA Methylation Down Syndrome Ethnicity HIV Infections Huntington Disease Menopause Obesity Parkinson Disease Tissues

Most recents protocols related to «Huntington Disease»

1
Resilience to Severe Alzheimer's Pathology

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2023
Amyotrophic Lateral Sclerosis Ataxia, Spinocerebellar Autopsy Cognition Demyelinating Diseases Diagnosis Disorders, Cognitive Frontotemporal Lobar Degeneration Huntington Disease Leukoencephalopathy Malformations of Cortical Development Multiple Sclerosis Neoplasms Patients Prion Diseases Respiratory Diaphragm Trinucleotide Repeats
2
Evaluating Neurological Disease Genes
We accessed 299 known haploinsufficient (HI) genes from Dang et al. (2008) (link). We retained 49 HI genes that are related to neurodegenerative and/or neurodevelopmental diseases (i.e., Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, SA, multiple system atrophy, epilepsy, autism spectrum disorder, and schizophrenia) (Supplementary Table 6). These 49 genes were used as a positive control for evaluating the strictness measure.
Liu H., Guan L., Deng M., Bolund L., Kristiansen K., Zhang J., Luo Y, & Zhang Z. (2023). Integrative genetic and single cell RNA sequencing analysis provides new clues to the amyotrophic lateral sclerosis neurodegeneration. Frontiers in Neuroscience, 17, 1116087.
Full text: Click here
Publication 2023
Autism Spectrum Disorders Epilepsy Genes Haploinsufficiency Huntington Disease Multiple System Atrophy Neurodevelopmental Disorders Schizophrenia
3
Curating Non-Neurodegeneration Genes
We accessed 1,189 genes related to non-mental-health diseases from Krishnan et al. (2016) (link). These genes were identified from OMIM and used as negative genes for autism spectrum disorder-related genes. We reviewed these 1,189 genes and then excluded the genes related to neurodegenerative and/or neurodevelopmental diseases, including Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, SA, multiple system atrophy, epilepsy, autism spectrum disorder, and schizophrenia. We retained 1,113 genes related to non-neurodegeneration-or-neurodevelopment diseases (NNN) as another negative control of HI genes (Supplementary Table 6).
Liu H., Guan L., Deng M., Bolund L., Kristiansen K., Zhang J., Luo Y, & Zhang Z. (2023). Integrative genetic and single cell RNA sequencing analysis provides new clues to the amyotrophic lateral sclerosis neurodegeneration. Frontiers in Neuroscience, 17, 1116087.
Full text: Click here
Publication 2023
Autism Spectrum Disorders Epilepsy Gene Expression Regulation Genes Huntington Disease Mental Disorders Multiple System Atrophy Neurodegenerative Disorders Neurodevelopmental Disorders Schizophrenia
4
Cognitive Screening in Subjective Cognitive Decline
Individuals who were diagnosed as SCD were eligible for the study. Subjects who visited the hospital due to persistent cognitive worsening and were diagnosed with SCD after dementia work-ups are consecutively recruited. The dementia work up included detailed neuropsychological test battery, MRI, and routine blood sampling for syphilis, thyroid function, vitamin B deficiencies, and apolipoprotein epsilon genotyping. The inclusion criteria were as follows (Table 2): Age ≥ 60 years of age; Existence of persistent self-reported cognitive complaints; Normal performance (above −1.0 standard deviation [SD] of norms) on all subtests of neuropsychological test battery named Seoul Neuropsychological Screening Battery (SNSB);[4 ] Clinical dementia rating (CDR) score of 0;[5 ] Agreement to participate in the study and could visit the hospital for annual evaluations. The exclusion criteria were the following: Mild cognitive impairment (MCI) or dementia; Brain lesions known to cause cognitive impairment (tumor, stroke, or subdural hematoma); Any neurological disorders such as Parkinson’s disease, Huntington’s disease, epilepsy, or normal pressure hydrocephalus; Major psychiatric disorders such as uncontrolled depression, schizophrenia, alcoholism, or drug dependency; Abnormal blood laboratory findings such as abnormal thyroid function, low vitamin B12 or low folate, or positive syphilis serology, and; Hearing loss that is impossible to perform phone-based cognitive tests.
Hong Y.J., Lee S.B., Kim S.H., Lee M.A., Park J.W, & Yang D.W. (2023). Development of a home-based cognitive test for cognitive monitoring in subjective cognitive decline with high risk of Alzheimer’s disease. Medicine, 102(9), e33096.
Full text: Click here
Publication 2023
Alcoholic Intoxication, Chronic Apolipoproteins BLOOD Brain Cerebrovascular Accident Cobalamins Cognition Cognitive Impairments, Mild Cognitive Testing Dementia Disorders, Cognitive Drug Dependence Epilepsy Folate Hearing Impairment Hematoma, Subdural Huntington Disease Hydrocephalus, Normal Pressure Major Depressive Disorder Neoplasms Nervous System Disorder Neuropsychological Tests Parkinson Disease Schizophrenia Syphilis Syphilis Serodiagnosis Thyroid Diseases Thyroid Gland Vitamin B Deficiency
5
Alzheimer's Disease Comorbidities in China
Research approval was obtained from the People's Hospital of China Three Gorges University's Ethics Committee (approval No: PJ-KY2021-26). Patients were retrospectively screened from the China Three Gorges University affiliated People's Hospital from January 2015 to December 2020 and were collected from a hospital-based electronic database. We included subjects who were diagnosed with AD and had comorbidities on admission, a primary diagnosis on admission, and a main diagnoses based on the International Classification of Diseases (9th edition), Clinical modification (ICD-9-CM; WHO 1999) codes (290.0–290.3, 294.1–294.2, and 331.0) and the International Classification of Diseases (10th edition) codes (G30.0–G30.1 and G30.8–G30.9). The enrolled patients had visited in the emergency department or outpatient department due to various clinical manifestations (including fever, cough, chest tightness, chest pain, palpitation, fatigue, edema, abdominal pain, diarrhea, loss of appetite, dizziness, headache, etc.) and were admitted to general wards by the outpatient department or emergency department. The inclusion criteria were as follows: (1) an AD discharge diagnosis and hospitalization for at least 24 h and (2) aged 60 years and over. The exclusion criteria were as follows: (1) basic information could not be obtained (2) vascular dementia, frontotemporal lobar degeneration, Lewy bodies dementia, Huntington's disease and mixed dementia (3) patients admitted to the intensive care unit, and (4) previous medical history information was missing. Demographic, patient comorbidities, and outcome information were collected from electronic medical records.
Yao K., Wang J., Ma B., He L., Zhao T., Zou X., Weng Z, & Yao R. (2023). A nomogram for predicting risk of death during hospitalization in elderly patients with Alzheimer's disease at the time of admission. Frontiers in Neurology, 14, 1093154.
Full text: Click here
Publication 2023
Abdominal Pain Anorexia Chest Chest Pain Cough Dementia, Vascular Diagnosis Diarrhea Edema Ethics Committees, Clinical Fatigue Fever Frontotemporal Lobar Degeneration Headache Hospitalization Huntington Disease Lewy Body Disease Mixed Dementias Outpatients Patient Discharge Patients

Top products related to «Huntington Disease»

1
44k microarray by Agilent Technologies
The 4 × 44K microarrays are a type of lab equipment manufactured by Agilent Technologies. They are designed to facilitate high-throughput analysis of gene expression patterns. The core function of these microarrays is to provide a platform for the simultaneous measurement of thousands of gene transcripts in a single experiment.
2
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
3
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
4
Human genome u133 plus 2.0 array by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom
The Human Genome U133 Plus 2.0 Array is a high-density oligonucleotide microarray designed to analyze the expression of over 47,000 transcripts and variants from the human genome. It provides comprehensive coverage of the human transcriptome and is suitable for a wide range of gene expression studies.
5
Stata 15 by StataCorp
Sourced in United States, United Kingdom, Austria, Denmark
Stata 15 is a comprehensive, integrated statistical software package that provides a wide range of tools for data analysis, management, and visualization. It is designed to facilitate efficient and effective statistical analysis, catering to the needs of researchers, analysts, and professionals across various fields.
6
Genelute mammalian genomic dna miniprep kit by Merck Group
Sourced in United States, Germany, Sao Tome and Principe, Ireland, United Kingdom, France
The GenElute Mammalian Genomic DNA Miniprep Kit is a product from Merck Group that enables the efficient extraction and purification of genomic DNA from mammalian cells and tissues. It provides a simple and fast method for isolating high-quality DNA samples suitable for various downstream applications.
7
High capacity cdna reverse transcription kit by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Lithuania, France, Italy, China, Spain, Canada, Switzerland, Poland, Australia, Belgium, Denmark, Sweden, Hungary, Austria, Ireland, Netherlands, Brazil, Macao, Israel, Singapore, Egypt, Morocco, Palestine, State of, Slovakia
The High-Capacity cDNA Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides a reliable and efficient method for performing reverse transcription, a fundamental step in various molecular biology applications.
8
Smart seq v4 ultra low input rna kit for sequencing by Takara Bio
Sourced in United States, Japan, United Kingdom
The SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing is a laboratory equipment product designed for preparing samples for RNA sequencing. The kit enables the generation of high-quality cDNA from ultra-low input RNA samples, such as those obtained from single cells or limited tissue samples. The kit utilizes Switching Mechanism at 5' end of RNA Template (SMART) technology to amplify and reverse transcribe RNA into cDNA, which can then be used for subsequent sequencing applications.
9
Bafilomycin by Merck Group
Sourced in United States, Germany, United Kingdom
Bafilomycin is a laboratory compound used as a research tool. It functions as a selective inhibitor of vacuolar-type H+-ATPases (V-ATPases), which are proton pumps involved in the acidification of cellular compartments.
10
Prisma by Siemens
Sourced in Germany, United States
The Prisma is a versatile laboratory equipment designed for a wide range of scientific applications. It serves as a reliable tool for various analytical and research processes. The core function of the Prisma is to provide accurate and consistent results through its advanced technology and precise measurements.

More about "Huntington Disease"

Huntington's disease (HD) is a rare, genetic neurodegenerative disorder characterized by uncontrolled movements, emotional disturbances, and cognitive decline.
This devastating condition is caused by a defective gene that leads to the progressive degeneration of nerve cells in the brain.
Symptoms of HD typically manifest in mid-adulthood and worsen over time, significantly impacting the quality of life for those affected.
The disorder is inherited in an autosomal dominant pattern, meaning that if one parent has the defective gene, their children have a 50% chance of inheriting it.
Researchers have utilized advanced techniques, such as 4 × 44K microarrays, to study gene expression patterns in HD.
These high-throughput platforms have provided valuable insights into the molecular mechanisms underlying the disease.
Additionally, researchers have explored the use of compounds like Penicillin/streptomycin, Bafilomycin, and Prisma to investigate potential therapeutic interventions.
The Human Genome U133 Plus 2.0 Array has also been a valuable tool in HD research, allowing scientists to analyze the expression of thousands of genes simultaneously.
Complementary techniques, such as the GenElute Mammalian Genomic DNA Miniprep Kit and the High-Capacity cDNA Reverse Transcription Kit, have facilitated the isolation and analysis of genetic material from HD samples.
To enhance the reproducibility and accuracy of their findings, researchers in the field of HD have turned to AI-powered platforms like PubCompare.ai.
These innovative tools leverage machine learning algorithms to scour the vast landscape of literature, preprints, and patents, helping investigators locate the best protocols and optimizing their research efforts.
By harnessing the power of Stata 15, a statistical software package, and the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing, researchers can delve deeper into the molecular underpinnings of HD, uncovering new avenues for treatment and potential cures.
With the aid of these advanced technologies and AI-driven platforms, the research community is poised to unlock new insights and accelerate the progress in understanding and managing this debilitating condition.