Log In Sign up
The largest database of trusted experimental protocols
> Disorders > Disease or Syndrome > Periodontitis

Periodontitis

Periodontitis is a chronic inflammatory disease that affects the supporting structures of the teeth, including the gums, periodontal ligament, and alveolar bone.
It is characterized by progressive destruction of these structures, leading to tooth loss if left untreated.
Periodontitis is caused by a complex interplay between oral bacteria, host immune response, and various risk factors such as smoking, diabetes, and poor oral hygiene.
Early detection and appropriate management are crucial to prevent the progression of this disease and maintain oral health.
Effective periodontal disease research is essential for developing new treatment strategies and improving patient outcomes.

Most cited protocols related to «Periodontitis»

1
Genome-Wide Meta-Analysis of Periodontal Traits
The contributing studies were (1) Atherosclerosis Risk in Communities (ARIC); (2) The Center for Oral Health in Appalachia cohort 1 (COHRA1), which is part of the GENEVA caries consortium; (3) the Dental Registry and DNA Repository of the University of Pittsburgh School of Dental Medicine, (DRDR), also part of the GENEVA caries consortium; (4) the Hispanic Community Health Study/Study of Latinos (HCHS/SOL); (5) the Malmö Diet and Cancer Study (MDC); 6) the Northern Finland Birth Cohort 1966 (NFBC 1966); (7) the Study of Health in Pomerania (SHIP), (8) the Study of Health in Pomerania Trend (SHIP Trend); (9) TWINGENE, which is a genotyped epidemiological study recruited from the Swedish Twin Registry (TWINGENE); (10) the Women’s Genome Health Study (WGHS); (11) Biobank Japan (BBJ) and (12) Tokyo Medical and Dental University Aggressive Periodontitis Study (TMDUAGP). A detailed description of each study is included in (Supplementary Data 1 and 2).
In nine studies, analysis was conducted in individuals of European ancestry (ARIC, COHRA1, DRDR, MDC, NFBC1966, SHIP, SHIP-TREND, TWINGENE and WGHS). In one study (HCHS/SOL), participants were recruited from Hispanic and Latino communities in the USA, who self-reported ancestry from six broad groups (Cuban, Dominican, Mexican, Puerto Rican, Central American and South American). To undertake analyses within this highly admixed population, a bespoke modelling approach was undertaken. Multi-dimensional clustering was used to generate genetic analysis groups containing participants of similar ancestry. These group allocations were then used as covariates in a linear mixed model (partitioned to only fit the proportion of genetic structure due to familial relatedness rather than ancestry) alongside the first five genetic principal components, study center and log-transformed sampling weights53 (link). Subsequently, the results from HCHS/SOL were treated as a study of European ancestry and included in the primary meta-analysis.
For periodontitis only, there were two studies with participants of East Asian ancestry (BBJ, TMDUAGP), totalling 17,287 participants. For periodontitis, separate meta-analyses were performed for studies of European ancestry and studies of East Asian ancestry.
Shungin D., Haworth S., Divaris K., Agler C.S., Kamatani Y., Keun Lee M., Grinde K., Hindy G., Alaraudanjoki V., Pesonen P., Teumer A., Holtfreter B., Sakaue S., Hirata J., Yu Y.H., Ridker P.M., Giulianini F., Chasman D.I., Magnusson P.K., Sudo T., Okada Y., Völker U., Kocher T., Anttonen V., Laitala M.L., Orho-Melander M., Sofer T., Shaffer J.R., Vieira A., Marazita M.L., Kubo M., Furuichi Y., North K.E., Offenbacher S., Ingelsson E., Franks P.W., Timpson N.J, & Johansson I. (2019). Genome-wide analysis of dental caries and periodontitis combining clinical and self-reported data. Nature Communications, 10, 2773.
Full text: Click here
Publication 2019
Aggressive Periodontitis Arteriosclerosis Asian Persons Birth Cohort Central American People Childbirth Dental Caries Dental Health Services Diet East Asian People Europeans Gene Components Genetic Structures Genome Hispanics Latinos Malignant Neoplasms Periodontitis Pharmaceutical Preparations Pharmaceutical Preparations, Dental Puerto Ricans South American People Twins Woman
2
Periodontal Health and Periodontitis Study
This clinical study was approved by the University of Michigan Health Sciences Institutional Review Board and registered with the clinical trials database of the National Institutes of Health, Bethesda, Maryland. Research subjects were recruited from September 2005 through June 2006. Upon receiving written consent, 100 human subjects aged 18 years and older were evaluated at the Michigan Center for Oral Health Research. All subjects possessed ≥20 teeth and had received no periodontal treatment or antibiotic therapy for medical or dental reasons 3 months prior to the investigation. In addition, the subjects did not previously undergo any long-term use of medications affecting periodontal status, such as anti-inflammatory drugs.
Subjects were enrolled into a healthy/gingivitis population (n = 50) or a periodontitis population (n = 49; one patient dropped out at experimental baseline). Subjects from the healthy and gingivitis population exhibited <3 mm of attachment loss, no periodontal probing depth (PD) >4 mm, and no radiographic alveolar bone loss. Periodontitis subjects exhibited at least four sites with evidence of radiographic bone loss, at least four sites with attachment loss >3 mm, and at least four sites with PD >4 mm (Fig. 1).
Subjects were excluded if they possessed a history of metabolic bone diseases, autoimmune diseases, unstable diabetes, or postmenopausal osteoporosis. Women who were pregnant were also excluded from the study.
Ramseier C.A., Kinney J.S., Herr A.E., Braun T., Sugai J.V., Shelburne C.A., Rayburn L.A., Tran H.M., Singh A.K, & Giannobile W.V. (2009). Identification of Pathogen and Host-Response Markers Correlated With Periodontal Disease. Journal of periodontology, 80(3), 436-446.
Publication 2009
Alveolar Bone Loss Anti-Inflammatory Agents Antibiotics Autoimmune Diseases Dental Health Services Diabetes Mellitus Ethics Committees, Research Gingivitis Healthy Volunteers Metabolic Bone Disease Osteopenia Osteoporosis, Postmenopausal Patients Periodontitis Periodontium Pharmaceutical Preparations Population Health Therapeutics Tooth Woman X-Rays, Diagnostic
3
Quality Assessment of Toothbrushing Behavior
The videos were analyzed by two independent calibrated examiners (HB und SE) using the software Mangold Interact 14 (Mangold International GmbH, Arnstorf, Germany). Brushing hand was coded and the examiners watched the video multiple times (also in slow motion) in order to code further behavioral categories. Calibration was provided by five videos of individuals not involved in the present study.
In adulthood, caries manifests primarily at lateral and proximal surfaces [15 (link)–17 (link)]. The risk of developing gum disease and periodontitis increases and exceeds that of caries [2 , 5 (link)]. Therefore, special emphasis was given to brushing behavior at lateral surfaces. Analyses regarding brushing movements and precise localization of brushing (sextants) were confined to them. To ensure that these analyses were not contaminated by occlusal brushing, lateral brushing was only assumed if both raters agreed that it was not occlusal. Thus, both examiners coded tooth contact time (time while toothbrush touches the teeth, without rinsing, spitting, tongue cleaning or breaks) and surfaces (vestibular, palatinal and occlusal) for all participants. SE carried out all further ratings and confined these to the palatinal and vestibular surfaces. These were: brushing movements (horizontal i.e. scrubbing, vertical, circular, modified Bass technique) and sextants (sextant 1 to 6, and, at vestibular surfaces, also concurrent brushing of antagonistic sextants, i.e. 1 and 6, 2 and 5, 3 and 4, respectively). Concurrent brushing of antagonistic sextants was coded when participants closed the mandibles while brushing. For further analyses, the brushing time of two sextants brushed concurrently was distributed in equal parts to both sextants.
To assess whether codings of sextants and movements remained reliable over time, double codings of a random sample of films were performed by HB. SE did not know which films were double coded and HB did not know SE’s codings. Intraclass correlations of double codings of the various observational categories were all above 0.801.
In the former study [13 (link)], all behavioral parameters were assessed by two independent examiners. Their intraclass correlations regarding the different parameters exceeded ICC = 0.865. For the present analyses, we computed the mean values of these double codings, since aggregating double codings further increases their reliability.
It was also intended to assess interdental cleaning (i.e. any application of devices for interdental cleaning in interdental spaces). However, only 15 participants performed interdental cleaning. Furthermore, most of these applied them only in some interdental spaces. We therefore refrained from any further analysis of this behavior.
A main result of the former study was that participants neglected surfaces and sextants while brushing. In the present analysis, a scoring system was thus developed allowing further description and analysis of the quality of toothbrushing at palatinal and vestibular surfaces (Quality index of toothbrushing regarding brushing time in sextants: QIT-S; for details see Table 1).

The Quality index of toothbrushing regarding brushing time in sextants (QIT-Sa)

QIT-S-00 sextants brushed by more than 1 s
QIT-S-11 sextants brushed by more than 1 s
QIT-S-22 sextants brushed by more than 1 s
QIT-S-33 sextants brushed by more than 1 s
QIT-S-44 sextants brushed by more than 1 s
QIT-S-55 sextants brushed by more than 1 s
QIT-S-6all sextants brushed by more than 1 s
QIT-S-7all sextants brushed by more than 3.5 s
QIT-S-8all sextants brushed by more than 5 s
QIT-S-9all sextants brushed by more than 7.5

aThe QIT-S index represents a rank-scaled measure allowing for the differential analysis of brushing time distribution at palatinal and vestibular sites, respectively. Brushing time of less than 1 s within a sextant is considered neglect of this sextant. QIT-S-0 ─ QIT-S-6 describe the expansion of this neglect. The highest score (QIT-S-9) is deduced from a recommended total brushing time of 2 min (e.g. 19 [19 ]; 18 [18 ]; 20 [20 ]) and an estimation of 30 s brushing time for occlusal surfaces as occlusal brushing is easier and can be done with greater movements than palatinal or vestibular brushing. Thereby, 45 s remain for the palatinal and vestibular surfaces, respectively. An even distribution of this time across sextants results in 7.5 s per sextant. As 3.5 represents roughly half of 7.5 this is taken as further step (QIT-S-7) and as 5 s per sextant might already be considered fair this was taken as another step (QIT-S-8)

Deinzer R., Ebel S., Blättermann H., Weik U, & Margraf-Stiksrud J. (2018). Toothbrushing: to the best of one’s abilities is possibly not good enough. BMC Oral Health, 18, 167.
Full text: Click here
Publication 2018
antagonists Bass Dental Caries Gingival Diseases Mandible Medical Devices Movement Periodontitis Tongue Tooth Touch Vestibular Labyrinth
4
Longitudinal Association of Periodontitis and Glucose Abnormalities
The SOALS was initiated in 2011 to evaluate the bi-directional, longitudinal association between periodontitis and glucose abnormalities over a three-year period. Detailed descriptions of the study have been published elsewhere (Andriankaja et al., 2015 (link), Rivera et al., 2016 (link)). Briefly, we recruited individuals aged 40-65 years who were overweight or obese (body mass index (BMI)≥25 kg/m2) and free of clinically diagnosed diabetes from the San Juan municipality area. People were excluded if they had less than four natural teeth, a history of conditions that increase the risk of systemic complications during a periodontal exam, or inability to complete study procedures. Participants were also excluded if they met any of the American Diabetes Association criteria for diabetes (2011) (link).
Of 2,626 adults screened to determine eligibility, 695 were excluded based on the criteria described above. Once the screening process concluded, 1,931 adults were deemed eligible, 1,610 agreed to be scheduled for the baseline visit, and 1,451 adults attended the visit. During the baseline visit, additional eligibility criteria were further assessed and an additional 245 participants were excluded. Of the remaining 1,206 participants, 15 were excluded due to missing data on key variables for analyses; thus, the final sample size comprised 1,191 diabetes-free participants. The University of Puerto Rico Institutional Review Board approved the study, and all participants gave written consent prior to completing the study procedures. For the current study, a completed STROBE checklist is provided as a supplementary file (see Additional File 1).
Pérez C.M., Muñoz F., Andriankaja O.M., Ritchie C.S., Martínez S., Vergara J., Vivaldi J., López L., Campos M, & Joshipura K.J. (2017). Cross-sectional associations of impaired glucose metabolism measures with bleeding on probing and periodontitis. Journal of clinical periodontology, 44(2), 142-149.
Publication 2017
Adult Congenital Abnormality Diabetes Mellitus Eligibility Determination Ethics Committees, Research Glucose Index, Body Mass Obesity Periodontitis Periodontium
5
Gingival Transcriptome Analysis in Periodontitis
A buccal gingival sample from either healthy or periodontitis-affected tissue from the premolar/molar maxillary region of each animal was taken using a standard gingivectomy technique, and maintained frozen in RNAlater solution. Total RNA was isolated from each gingival tissue using a standard procedure as we have described and tissue RNA samples submitted to the microarray core to assess RNA quality analyze the transcriptome using the GeneChip® Rhesus Macaque Genome Array (Affymetrix) (Meka, Bakthavatchalu, Sathishkumar, Lopez, Verma, Wallet, Bhattacharyya, Boyce, Handfield, Lamont, Baker, Ebersole and Kesavalu, Gonzalez, Stromberg, Huggins, Gonzalez-Martinez, Novak and Ebersole, 2011 (link)). Individual samples were used for gene expression analyses. Table 1 provides an overview of the genes whose expression was evaluated in the gingival tissues as related to M1/2, M1, and M2 phenotype macrophages. These include an array of cytokine/chemokine responses, as well as various cell surface molecules that provide some discrimination among these phenotypes.
Based upon the microarray outcomes we selected 5 genes and performed a qPCR analysis using a standard technique in our laboratory employing a Roche 480 LightCycler (Gonzalez, John Novak, Kirakodu, Stromberg, Shen, Orraca, Gonzalez-Martinez and Ebersole, 2013 (link)). Primers were prepared for IL6 (forward - CCTGAACCAACCACAAATGC; reverse – GGACTGCAGGAACTCCTTAAA; amplicon 114 bp), CXCL13 (forward – AGTCT GGAAGAAGAACAAGTCAG; reverse – GGAACTGGTGGAGTTGAAGAA; amplicon 108 bp), CCL19 (forward - GCTACCTTCTCATCAAGGATGG; reverse – GTTCTACCCAG GACTGGTCT; amplicon 102 bp), CD14 (forward - GCCCTAAACTCCCTCAATCTG; reverse – CAGTCTGTTGCAGCTGAGAT; amplicon 99 bp) and IL1R2 (forward – TTTCAGACACTACGCACCAC; reverse – ACCGTCTGTGCATCCATATTC; amplicon 118 bp) and GAPDH (forward – GGTGTGAACCATGAGAAGTATGA; reverse – GAGTCCTTCCACGATACCAAAG; amplicon 123 bp) genes, designed using software PrimerQuest at Integrated DNA Technologies website (www.idtdna.com) and were synthesized by Integrated DNA Technologies, Inc (Coralville, IA). The level of message was determined (Gonzalez, John Novak, Kirakodu, Stromberg, Shen, Orraca, Gonzalez-Martinez and Ebersole, 2013 (link), Gonzalez, Novak, Kirakodu, Orraca, Chen, Stromberg, Gonzalez-Martinez and Ebersole, 2014 (link), Ebersole, Kirakodu, Novak, Stromberg, Shen, Orraca, Gonzalez-Martinez, Burgos and Gonzalez, 2014 ) and those levels compared across the RNA samples prepared from each of the healthy groups and the 2 periodontitis groups.
Gonzalez O.A., Novak M.J., Kirakodu S., Stromberg A., Nagarajan R., Huang C.B., Chen K.C., Orraca L., Martinez-Gonzalez J, & Ebersole J.L. (2015). Differential Gene Expression Profiles Reflecting Macrophage Polarization in Aging and Periodontitis Gingival Tissues. Immunological investigations, 44(7), 643-664.
Publication 2015
Animals Bicuspid CCL19 protein, human Cells Chemokine CXCL13 protein, human Cytokine Discrimination, Psychology Freezing GAPDH protein, human Gene Chips Gene Expression Profiling Genes Genome Gingiva Gingivectomy Macaca mulatta Macrophage Maxilla Microarray Analysis Molar Oligonucleotide Primers Periodontitis Phenotype Tissues Transcriptome

Most recents protocols related to «Periodontitis»

1
Silicic Acid and Micronutrients for Health
Not available on PMC !

Example 5

    • Daily oral administration of 5 mg of bioavailable silicic acid in the form of choline-stabilized orthosilicic acid (ch-OSA®), wherein silicic acid is stabilized with choline chloride, for instance in the form of a capsule.
    • Daily administration of a tablet containing 200 mg vitamin C, 150 microgram selenium, 10 mg zinc, 1 mg copper.

US11878031B2. Silicic acids for use in the treatment of periodontitis (2024-01-23). Bio Minerals N.V. [BE]. Inventors: Mario Remi Yvonne Calomme [BE], Kathleen Jozef Ingrid Suzanne Van Hoof [BE].
Full text: Click here
Patent 2024
Acids Administration, Oral Ascorbic Acid Capsule Choline Choline Chloride Copper Periodontitis Selenium Silicic acid Tablet Zinc
2
BioSil® Liquid Improves Peri-Implantitis Bone Loss
Not available on PMC !

Example 4

A female peri-implantitis patient, 66 years old and non-smoker, had severe bone loss at two implant sites (as shown in FIG. 4A). The patient took during one year 5 drops of BioSil® liquid twice daily. This formulation contains choline-stabilized orthosilicic acid (ch-OSA®), wherein silicic acid is stabilized with choline chloride. The formulation furthermore contains glycerol as a diluent. After one year the bone level was significantly increased at the implant site (see FIG. 4B).

A second peri-implantitis patient, 73 years and non-smoker, with severe bone loss at the implant sites and damaged gingiva (FIG. 5a) took during one year 5 drops of BioSil® liquid twice daily. After one year the bone level was also significantly increased at the implant site (FIG. 5b, after 6 months, FIG. 5c, after 12 months). FIG. 6 shows that the gingiva regained its normal appearance with good color indicating improved vascularization in the course of the 1 year treatment.

The following treatment examples can be used as an adjunct to good mouth hygiene, scaling and root planing:

US11878031B2. Silicic acids for use in the treatment of periodontitis (2024-01-23). Bio Minerals N.V. [BE]. Inventors: Mario Remi Yvonne Calomme [BE], Kathleen Jozef Ingrid Suzanne Van Hoof [BE].
Full text: Click here
Patent 2024
Acids Biosil Bones Choline Choline Chloride Gingiva Glycerin Non-Smokers Osteopenia Pathologic Neovascularization Patients Peri-Implantitis Periodontitis Silicic acid Woman
3
Periodontitis Adjunct Therapy Protocol
Not available on PMC !

Example 7

    • Initial full mouth one-stage disinfection by rinsing for 2 minutes with a 0.12% chlorhexidine solution.
    • 6 months oral administration of 10 mg of bioavailable silicic acid in the form of choline-stabilized orthosilicic acid (ch-OSA®), wherein silicic acid is stabilized with choline chloride, suitably in the form of two dosage units each containing 5 mg bioavailable silicic acid;
    • Daily administration of two probiotic lozenges, each containing 2 viable strains of Lactobacillus reuteri (1 108 CFU), for instance DSM17938 and ATCC PTA5289, during 6 months.

It is herein preferable, that the administration of the bioavailable silicic acid and the administration of the probiotic lozenges start simultaneously. Alternatively, the administration of the bioavailable silicic acid may precede the administration of the probiotic lozenges during a preparatory period of for instance 3 days up to 14 days, for instance 1 week.

US11878031B2. Silicic acids for use in the treatment of periodontitis (2024-01-23). Bio Minerals N.V. [BE]. Inventors: Mario Remi Yvonne Calomme [BE], Kathleen Jozef Ingrid Suzanne Van Hoof [BE].
Full text: Click here
Patent 2024
Acids Administration, Oral Chlorhexidine Choline Choline Chloride Disinfection Dosage Forms Lactobacillus reuteri Periodontitis Probiotics Silicic acid Strains
4
Silicic Acid and Mineral Supplementation Protocol
Not available on PMC !

Example 6

    • Daily oral administration of 5 mg of bioavailable silicic acid in the form of choline-stabilized orthosilicic acid (ch-OSA®), wherein silicic acid is stabilized with choline chloride, for instance in the form of a capsule;
    • Daily administration of 1000 mg calcium, 6 microgram vitamin D, 50 microgram vitamin K, preferably in two formulations, such as tablets;
    • Daily administration of 200 mg vitamin C, 100 microgram selenium, 10 mg zinc, 1 mg copper, 0.5 mg boron, 200 mg magnesium, for instance in the form of a single formulation, such as a tablet.

    • 6 months oral administration of 10 mg of a bioavailable silicon compound per day, which bioavailable silicon compound is in the form of choline-stabilized orthosilicic acid (ch-OSA®), wherein silicic acid is stabilized with choline chloride; 10 mg bioavailable silicon is preferably administered as two dosage units, each containing 5 mg bioavailable silicon, for instance as a tablet;
    • mouth rinsing with chlorhexidine 1% solution twice daily during 4 weeks.

It is herein preferable, that the administration of the bioavailable silicic acid and the mouth rinsing start simultaneously.

US11878031B2. Silicic acids for use in the treatment of periodontitis (2024-01-23). Bio Minerals N.V. [BE]. Inventors: Mario Remi Yvonne Calomme [BE], Kathleen Jozef Ingrid Suzanne Van Hoof [BE].
Full text: Click here
Patent 2024
Acids Administration, Oral Ascorbic Acid Boron Calcium, Dietary Capsule Chlorhexidine Choline Choline Chloride Copper Magnesium Periodontitis Selenium Silicic acid Silicon Tablet Vitamin D Vitamin K Zinc
5
Bioavailable Silicic Acid Reduces Chronic Periodontitis
Not available on PMC !

Example 3

Two individual patients with chronic periodontitis were administrated bioavailable silicic acid in the form of choline-stabilized orthosilicic acid (ch-OSA®), wherein silicic acid is stabilized with choline chloride. The first patient was a non-smoking male patient of 56 years old. The second patient was a non-smoking female patient of 36 years old. The results are shown in FIGS. 3A and 3B, wherein the color provides an indication of the pocket depth. The actual depth is also indicated for each tooth. The data were obtained by measuring the pocket depth around each tooth in the mouth 6 times. In both cases, the periodontitis reduced significantly. Before the treatment, patients had very deep pockets. After the treatment, this was reduced to low depth (less than 3 mm).

US11878031B2. Silicic acids for use in the treatment of periodontitis (2024-01-23). Bio Minerals N.V. [BE]. Inventors: Mario Remi Yvonne Calomme [BE], Kathleen Jozef Ingrid Suzanne Van Hoof [BE].
Full text: Click here
Patent 2024
Choline Choline Chloride Chronic Periodontitis Figs Males Oral Cavity Patients Periodontitis Silicic acid Tooth Woman

Top products related to «Periodontitis»

1
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
2
Pcp unc 15 by Hu-Friedy
Sourced in United States, Germany
The PCP-UNC 15 is a dental lab instrument designed for ultrasonic scaling and root debridement procedures. It features a slim, angled design and a standard UNC 15 tip size for clinical versatility.
3
Lipopolysaccharides (lps) by Merck Group
Sourced in United States, Germany, China, United Kingdom, Sao Tome and Principe, Macao, Italy, Japan, Canada, France, Switzerland, Israel, Australia, Spain, India, Ireland, Brazil, Poland, Netherlands, Sweden, Denmark, Hungary, Austria, Mongolia
The LPS laboratory equipment is a high-precision device used for various applications in scientific research and laboratory settings. It is designed to accurately measure and monitor specific parameters essential for various experimental procedures. The core function of the LPS is to provide reliable and consistent data collection, ensuring the integrity of research results. No further details or interpretations can be provided while maintaining an unbiased and factual approach.
4
Unc 15 by Hu-Friedy
Sourced in United States
The UNC-15 is a dental laboratory instrument designed for scaling and root planing procedures. It features a double-ended tip with a flat edge and a pointed tip, allowing for versatility in performing various dental procedures. The UNC-15 is made with high-quality materials to ensure durability and precise performance.
5
Unc 15 periodontal probe by Hu-Friedy
Sourced in United States, Germany
The UNC-15 periodontal probe is a dental instrument designed for clinical examination and measurement of periodontal pockets. It features a slim, tapered tip and markings in millimeters to accurately assess the depth of the gingival sulcus or periodontal pocket.
6
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
7
Rompun by Bayer
Sourced in Germany, France, United States, United Kingdom, Canada, Italy, Brazil, Belgium, Cameroon, Switzerland, Spain, Australia, Ireland, Sweden, Portugal, Netherlands, Austria, Denmark, New Zealand
Rompun is a veterinary drug used as a sedative and analgesic for animals. It contains the active ingredient xylazine hydrochloride. Rompun is designed to induce a state of sedation and pain relief in animals during medical procedures or transportation.
8
Sas version 9 by SAS Institute
Sourced in United States, Austria, Japan, Cameroon, Germany, United Kingdom, Canada, Belgium, Israel, Denmark, Australia, New Caledonia, France, Argentina, Sweden, Ireland, India
SAS version 9.4 is a statistical software package. It provides tools for data management, analysis, and reporting. The software is designed to help users extract insights from data and make informed decisions.
9
Carboxymethylcellulose by Merck Group
Sourced in United States, Germany, India, United Kingdom, Sao Tome and Principe, France, Italy, Singapore, Ireland, Spain, Canada, China, Malaysia, Australia
Carboxymethylcellulose is a water-soluble cellulose derivative used as a thickening agent, stabilizer, and emulsifier in various laboratory applications. It is a white to off-white, odorless, and tasteless powder that can be easily dispersed in water to form a clear, viscous solution.
10
Spss statistic by IBM
Sourced in United States, Japan, United Kingdom, Germany, Belgium, Austria, Italy, Poland, India, Canada, Switzerland, Spain, China, Sweden, Brazil, Australia, Hong Kong
SPSS Statistics is a software package used for interactive or batched statistical analysis. It provides data access and management, analytical reporting, graphics, and modeling capabilities.

More about "Periodontitis"

Periodontitis, also known as gum disease or periodontal disease, is a chronic inflammatory condition that affects the supporting structures of the teeth, including the gums (gingivae), periodontal ligament, and alveolar bone.
This complex disease is characterized by the progressive destruction of these vital components, ultimately leading to tooth loss if left untreated.
The development of periodontitis is driven by a multifaceted interplay between oral bacteria, the host's immune response, and various risk factors such as smoking, diabetes, and poor oral hygiene.
Early detection and appropriate management are crucial to prevent the progression of this disease and maintain optimal oral health.
Effective periodontal disease research is essential for developing new and improved treatment strategies, as well as enhancing patient outcomes.
Researchers often utilize a range of tools and techniques to study this condition, including periodontal probes like the UNC-15, TRIzol reagent for RNA extraction, and statistical software such as SAS version 9.4 and SPSS Statistics.
Furthermore, substances like Carboxymethylcellulose and Rompun may be employed in various experimental settings related to periodontitis.
By understanding the complexities of this disease and the research methodologies involved, scientists can drive advancements in the field of periodontal health and contribute to the well-being of patients suffering from this debilitating condition.