Log In Sign up
The largest database of trusted experimental protocols
> Disorders > Disease or Syndrome > Yersinia pseudotuberculosis Infections

Yersinia pseudotuberculosis Infections

Yersinia pseudotuberculosis Infections: A serious bacterial disease caused by the Yersinia pseudotuberculosis pathogen.
Infections can lead to a range of symptoms, including fever, abdominal pain, and diarrhea.
Effective research and treatment protocols are critical for managing this infectious disease.
Leverge PubCompare.ai's AI-driven tools to optimize your Yersinia pseudotuberculosis infection studies and drive your research forward.

Most cited protocols related to «Yersinia pseudotuberculosis Infections»

1
Filtering Metagenomic Reads for Phylogenetic Analysis
Metagenomic reads from ancient samples may contain a mixture of sequence reads from the species of interest as well as from genetically similar taxa that represent environmental contamination. To deal with this issue and remove such nonspecific reads after extraction with the EToKi prepare module, the EToKi assemble module can be used to align the extracted reads after comparisons with an ingroup of genomes related to the species of interest and with an outgroup of genomes from other species. In the case of Figure 5, the ingroup consisted of Y. pestis genomes CO92 (2001), Pestoides F, KIM10+ and 91001, and the outgroup consisted of Y. pseudotuberculosis genomes IP32953 and IP31758, Y. similis 228, and Y. enterocolitica 8081. Reads were excluded which had higher alignment scores to the outgroup genomes than to the ingroup genomes. Prior to mapping reads to the Y. pestis reference genome (CO92) (2001), a pseudogenome was created in which all nucleotides were masked to ensure that only nucleotides supported by metagenomic reads would be used for phylogenetic analysis. For the 13 ancient genomes whose publications included complete SNP lists, we unmasked the sites in the pseudogenomes that were included in the published SNP lists. For the other 43 genomes, EToKi was used as in Supplemental Figure S6 to map the filtered metagenomic reads onto the pseudogenome with minimap2 (Li 2018 (link)), evaluate them with Pilon (Walker et al. 2014 (link)), and unmask sites in the pseudogenome that were covered by three or more reads and had a consensus base that was supported by ≥80% of the mapped reads. All 56 pseudogenomes were uploaded to EnteroBase together with their associated metadata.
Zhou Z., Alikhan N.F., Mohamed K., Fan Y, & Achtman M. (2020). The EnteroBase user's guide, with case studies on Salmonella transmissions, Yersinia pestis phylogeny, and Escherichia core genomic diversity. Genome Research, 30(1), 138-152.
Full text: Click here
Publication 2020
Environmental Pollution Genome Metagenome Nucleotides Walkers Yersinia pestis Yersinia pseudotuberculosis Infections
2
Genetic Manipulation of Yersinia pseudotuberculosis
All Yersinia pseudotuberculosis (Yptb) strains used in this study were derived from YPIII [5] (link). Plasmid deficient Yptb has been previously described [5] (link). In frame deletions were generated using pCVD442 and 500–800 bps upstream and downstream of the DNA to be removed, as described [5] (link). Primer sequences used to generate the mrtAB knockout construct were the following: mrtAB FOR1: attaGCATGCTTGCTGGAAACGTTTAAAGCGTTTGG, mrtAB REV1: attaGAATTCTAATTGTGCAAACAATCTCACGCAGTTT, mrtAB FOR2: attaGAATTC AGGAGGTCGAAGC CGATGAATAAC, mrtAB REV2: attaGAGCTCTTGAAA TCAGCGCCATCCGCCAAT. For HA tagging of mrtA (YPK_3222), the HA sequence was inserted directly downstream of the ATG start codon of the operon. For the FLAG tagging of mrtB (YPK_3221), the FLAG sequence was inserted just upstream of the stop codon. The coding regions of the two genes are overlapping, which is why we avoided making any tags in the C terminus of MrtA or the N terminus of MrtB. Yptb were tagged with GFP by driving expression of GFP off the constitutive Tet promoter on pACYC184. The tetA::GFP promoter-gene fusion from pDW5 [52] (link) was PCR-amplified with SphI end sites and moved it into pACYC184 cut with SphI. Forward primer: 5′ gatcgcatgcgaattctcatgtttgacagcttat 3′ Reverse primer: 5′ gccgccgcaaggaatggtgcatgc. This plasmid is very stable in vivo. For the construction of the mrtAB complementation plasmid (pmrtAB), pACYC184 was digested with EcoRV and SalI, and the mrtAB operon was PCR-amplified with EcoRV and SalI end sites. The entire intergenic sequence in between YPK_3223 and YPK_3222 (101 bps) was included upstream of the mrtA start codon, and the mrtB terminator was included after the gene. The primers used for the complementation vector were: CompFor: attaTCTAGAATAATTCACTAAAAAATCTGTTTATCAATGGT, and CompRev: attaGTCGACAAGTGA GTGAGTGAGTGAGTGAGT. A YopE reporter strain was constructed with a FLAG-mCherry sequence immediately following the yopE stop codon. An isogenic, unmarked T3SS reporter strain was constructed that contains FLAG-mCherry sequence immediately after the yopE stop codon (see Fig. S1, panel A). A DNA fragment containing the FLAG-mCherry sequence, flanked by ∼1 kb of genomic sequence on each side of yopE stop codon was constructed by PCR and cloned into the SacI and BamHI sites of pSR47s. The resulting plasmid (pSR47s-yopE-FLAG-mCherry) was introduced into E. coli DH5α λpir and integrated onto the Y. pseudotuberculosis virulence plasmid via triparental mating using the helper strain HB101(RK600).
Crimmins G.T., Mohammadi S., Green E.R., Bergman M.A., Isberg R.R, & Mecsas J. (2012). Identification of MrtAB, an ABC Transporter Specifically Required for Yersinia pseudotuberculosis to Colonize the Mesenteric Lymph Nodes. PLoS Pathogens, 8(8), e1002828.
Full text: Click here
Publication 2012
Cloning Vectors Codon, Initiator Codon, Terminator DNA, A-Form Escherichia coli Gene Deletion Gene Fusion Genes Genome Intergenic Sequence Oligonucleotide Primers Operon Plasmids Reading Frames Strains Trientine Virulence Yersinia pseudotuberculosis Yersinia pseudotuberculosis Infections
3
Identifying Robust Yersinia SNPs
Chromosomal genomic sequences of Y. pestis (16 sequences) and Y. pseudotuberculosis IP32953 (1 sequence; outgroup) (Supplementary Table 1) were aligned against the well-annotated genome of strain CO92 33 (link) using Kodon (Applied Maths, Belgium) in order to identify non-repetitive SNPs. We used the alignments to identify and exclude all repetitive regions because these can lead to pseudo-SNPs due to faulty alignments or to gene conversion by recombination, resulting in homoplasies43 (link),44 (link). We excluded microsatellites (VNTRs), IS elements, bacteriophages, homo- and hetero-polymeric repeats, and duplications (the largest of which, DR1/DR2, was 12.1 kb). Additional potential repetitive regions and/or regions that might be under strong diversifying selection were identified by examining 31 bp flanking each potential SNP for three or more polymorphic sites across the 17 Y. pestis genomes. Additional repetitive regions were identified by reversed best hit Fasta searches for duplicated regions containing putative SNPs. These procedures excluded388 kb (8.3%) from the ~4.65 Mb CO92 genome (Supplementary Table 9).
We also excluded all SNPs that were exclusive to the FV-1 genome, because that genome was suspected to contain many sequencing errors, and from strain Angola. Angola contains >708 genome-specific SNPs, which is extraordinarily high for a strain of Y. pestis, and no other isolate was closely related to Angola according to dHPLC. Finally, we excluded SNPs in 1,000 regions spanning ~600 kb that were lacking in one or more major branches in the tree.
Independent lists of SNPs in non-repetitive regions were also generated with the nucmer module of MUMmer45 (link) from pair-wise alignments to CO92 of 16 Y. pestis genomes (excluding FV-1). Differences between the Kodon and MUMmer results were resolved by manual inspection. The remaining SNPs were combined with SNPs detected by dHPLC mutation discovery, resulting in a total of 1,232 biallelic SNPs that were considered suitable for genotyping analyses (Supplementary Fig. 1). For each SNP, the ancestral state was assigned to the nucleotide present within Y. pseudotuberculosis IP32953 and the derived state was assigned to the alternative nucleotide found in Y. pestis.
Morelli G., Song Y., Mazzoni C.J., Eppinger M., Roumagnac P., Wagner D.M., Feldkamp M., Kusecek B., Vogler A.J., Li Y., Cui Y., Thomson N.R., Jombart T., Leblois R., Lichtner P., Rahalison L., Petersen J.M., Balloux F., Keim P., Wirth T., Ravel J., Yang R., Carniel E, & Achtman M. (2010). Phylogenetic diversity and historical patterns of pandemic spread of Yersinia pestis. Nature genetics, 42(12), 1140-1143.
Publication 2010
Bacteriophages Chromosomes Gene Conversion Genome Homo Mutation Neutrophil Nucleotides Polymers Recombination, Genetic Repetitive Region Short Tandem Repeat Strains Trees Yersinia pestis Yersinia pseudotuberculosis Infections
4
Automated Identification of Pseudogenes
Pseudogenes within each genome were identified by comparing its genome contents with that of each of the other sequenced strains within the particular taxonomic group. For each genome, we first retrieved the set of the annotated proteins from GenBank, which were used to query the nucleotide sequence of the other genomes within the particular group using TBLASTN (23 (link)). For example, the proteins of Y.pseudotuberculosis were used to query the genome sequences of Y.pestis CO92, Y.pestis KIM and Y.pestis 91001. We then applied the program Ψ–Φ (5 (link)) on the BLAST outputs to recover candidate pseudogenes in each genome. This program allows the specification of any BLAST score and % identity cut-offs, and for our comparisons, proteins from two genomes were considered to be homologous if their BLAST score reached an E-value <10−15 and their level of protein identity was >79%. In the case of Vibrio, the strains/species examined were not as closely related, so we applied different thresholds (E-values <10−10 and a minimal percentage of protein identity of 49%) in order to identify homologous sequences. This program retrieves pseudogenes that result from nonsense mutations, frameshifts generated by small insertions or deletions, large insertions (such as those resulting from transposable elements) and truncations of any specified length as well as any incorrectly annotated spacers that resulted from degradation of a gene. Lists of candidate pseudogenes were curated manually, and the disrupting mutations were determined by aligning the nucleotide sequences of putative pseudogenes with their functional counterparts using CLUSTALW 1.8 (24 (link)).
Lerat E, & Ochman H. (2005). Recognizing the pseudogenes in bacterial genomes. Nucleic Acids Research, 33(10), 3125-3132.
Publication 2005
Base Sequence DNA Transposable Elements Frameshift Mutation Gene Deletion Genes Genome Homologous Sequences Insertion Mutation Mutation Mutation, Nonsense Proteins Pseudogenes SET protein, human Staphylococcal Protein A Strains Vibrio Yersinia pestis Yersinia pseudotuberculosis Infections
5
Evaluating Microbiome Profiling Protocols
We downloaded raw sequencing reads for the Phase III experiment from European Nucleotide Archive study accession PRJEB14847 and generated taxonomic profiles using MetaPhlAn2 version 2.7.6 (Truong et al., 2015 (link)) with the command-line options --min_cu_len 0 --stat avg_g. These options were chosen to increase sensitivity and accuracy for the rarest spike-in taxa and resulted in the detection of all spike-in taxa in every sample. Taxonomic profiles generated by MetaPhlAn2 provide estimated proportions of taxa at various taxonomic levels. We restricted our analysis to species-level abundances and the kingdom Bacteria, which constituted over 99% of non-viral abundance in each sample.
Costea et al. (2017) (link) reported Escherichia coli as a likely spike-in contaminant due to its presence in sequence data from the mock-only samples. Consistent with this report, the MetaPhlAn2 profiles showed a substantial presence of Shigella flexneri in the mock-only samples and we identified this species as the ‘Contaminant’ in our subsequent analyses and in all figures and tables.
We estimated the true mock-community composition using the flow cytometry (FACS) measurements reported in Costea et al. (2017) (link). We used the arithmetic mean of two replicate measurements where available and ignored any measurement error in the resulting actual mock composition for our analysis. The FACS measurements provided by Costea et al. (2017) (link) disagree with those shown in their Figure 6 for three taxa (V. cholerae, C. saccharolyticum, and Y. pseudotuberculosis). Analysis of our MetaPhlAn2 profiles indicates that these taxa are most likely mislabeled in the figure and not in the FACS measurements. A mislabeling in the FACS measurements would change the specific bias values we estimate for these taxa but not our main results or conclusions.
We estimated the bias of each protocol and the differential bias between protocols as described in ‘Bias estimation’. We estimated standard errors using the Dirichlet-weighted bootstrap method described in Appendix 2. To determine how precision in the bias estimate for Protocol H varies with the number of control samples (Figure 4—figure supplement 1), we computed standard errors using the multinomial-weighted bootstrap method with the number of trials in the multinomial distribution equal to the specified number of control samples (Appendix 2).
To demonstrate calibration, we randomly chose three fecal specimens to use as the ‘estimation set’ to estimate bias, and then calibrated all samples using Equation 9. We excluded the mock-only specimen from the estimation set since its atypical values for a few taxa resulted in an unrepresentative picture of the success of calibration; however, we included it when evaluating the effect of noise on bias estimation in Figure 4—figure supplement 1.
McLaren M.R., Willis A.D, & Callahan B.J. (2019). Consistent and correctable bias in metagenomic sequencing experiments. eLife, 8, e46923.
Full text: Click here
Publication 2019
Bacteria Dietary Supplements DNA Replication Escherichia coli Europeans Feces Flow Cytometry Hypersensitivity Nucleotides Shigella flexneri Vibrio cholerae Yersinia pseudotuberculosis Infections

Most recents protocols related to «Yersinia pseudotuberculosis Infections»

1
Generation of EBV-positive 293 cell lines
293/EBV ΔBVLF1 and 293/EBV ΔBcRF1 were generated using BM2710 Escherichia coli carrying the invasin gene from Yersinia pseudotuberculosis and the hly gene encoding listeriolysin O from Listeria monocytogenes, which allow gene transfer of intact BACmids to some mammalian cells in vitro. BACmids EBV ΔBVLF1 (MI-383) and EBV ΔBcRF1 (MI-27) have been previously described as a part of a comprehensive EBV mutant library (26 (link)). BM2710 E. coli stably transformed with EBV ΔBVLF1 or EBV ΔBcRF1 was obtained from Eric Johannsen (University of Wisconsin—Madison, USA). These EBV-positive BM2710 E. coli cells were grown overnight at 32°C in brain heart infusion media (37 g/L [wt/vol]) supplemented with 0.5 mM 2,6-diaminopimelic acid (DAP) (Alfa Aesar) and 25 μg/μL spectinomycin (Alfa Aesar) and selected with 50 μg/mL kanamycin. One milliliter of BM2710 E. coli overnight culture was added to 293 cells at 80 to 90% confluence in a 60-mm cell culture plate, in 1× DMEM supplemented with 0.5 mM DAP and 25 μg/μL spectinomycin, and incubated for 2 h. Following incubation, the medium was removed, the cells were washed with 1× DMEM to remove as many bacteria as possible, and fresh 1× DMEM plus 10% FBS medium was added, supplemented with 50 μg/mL gentamicin (Gibco). The following day, the medium was replaced with 1× DMEM plus 10% FBS. EBV-positive 293 cells were selected and maintained with 200 μg/mL hygromycin B.
Rosemarie Q., Kirschstein E, & Sugden B. (2023). How Epstein-Barr Virus Induces the Reorganization of Cellular Chromatin. mBio, 14(1), e02686-22.
Full text: Click here
Publication 2023
Bacteria Brain Cell Culture Techniques Cells Diaminopimelic Acid DNA Library Escherichia coli Genes Gene Transfer, Horizontal Gentamicin Heart hlyA protein, Listeria monocytogenes Hyaluronidase Hygromycin B invasin, Yersinia Kanamycin Listeria monocytogenes Mammals Spectinomycin Yersinia pseudotuberculosis Yersinia pseudotuberculosis Infections
2
Comparative Structural Analysis of Yersinia Ail Proteins
Y. pestis and Y. pseudotuberculosis Ail sequences in GenBank (National Health Institute, NIH) as of October 2021 were analyzed with ClustalW for multiple sequence alignment. The deep learning-based modeling method, RoseTTAFold, was used to generate Ail structural models that were superimposed and compared with UCSF Chimera plug-in, MatchMaker (69 (link), 70 (link)).
Kolodziejek A.M., Bearden S.W., Maes S., Montenieri J.M., Gage K.L., Hovde C.J, & Minnich S.A. (2023). Yersinia pestis Δail Mutants Are Not Susceptible to Human Complement Bactericidal Activity in the Flea. Applied and Environmental Microbiology, 89(2), e01244-22.
Full text: Click here
Publication 2023
Chimera Sequence Alignment Yersinia pestis Yersinia pseudotuberculosis Infections
3
Infection of Mice with Y. pseudotuberculosis
Y. pseudotuberculosis strains 32777 and 32777 ΔyopM were revived from freezer stocks on MacConkey agar. Individual colonies were cultured overnight in 2× YT at 25 °C with shaking. Mice were fasted for at least 12 h prior to gavage with 1 × 107 colony forming units in 200 μL phosphate buffered saline (PBS).
De Siqueira M.K., Andrade-Oliveira V., Stacy A., Pedro Tôrres Guimarães J., Wesley Alberca-Custodio R., Castoldi A., Marques Santos J., Davoli-Ferreira M., Menezes-Silva L., Miguel Turato W., Han S.J., Glatman Zaretsky A., Hand T.W., Olsen Saraiva Câmara N., Russo M., Jancar S., Morais da Fonseca D, & Belkaid Y. (2023). Infection-elicited microbiota promotes host adaptation to nutrient restriction. Proceedings of the National Academy of Sciences of the United States of America, 120(4), e2214484120.
Publication 2023
Agar Mus Phosphates Saline Solution Strains Tube Feeding Yersinia pseudotuberculosis Infections
4
Identification of Corynebacterium pseudotuberculosis
Biochemical identification of C. pseudotuberculosis [8 (link)] by colonial characteristics, microscopic examination, biochemical identification (catalase test, urease test, Nitrate reduction test, gelatin liquefaction, and negative in lactose, trehalose, and motility test [20 (link)]), and measurement of hemolytic activity by modified the Christie–Atkins–Munch-Peterson (CAMP) test [21 (link)].
Pathogenicity testing was performed by injecting male Guinea pigs intraperitoneally and isolating organisms from orchitis lesions and other internal lesions [22 ].
Genotypic identification of C. pseudotuberculosis was performed by PCR for detection of the 16s RNA. Primers and PCR conditions to confirm the identification of C. pseudotuberculosis isolates [23 (link)] are shown in Table 1.
Torky H.A., Saad H.M., Khaliel S.A., Kassih A.T., Sabatier J.M., Batiha G.E., Hetta H.F., Elghazaly E.M, & De Waard M. (2023). Isolation and Molecular Characterization of Corynebacterium pseudotuberculosis: Association with Proinflammatory Cytokines in Caseous Lymphadenitis Pyogranulomas. Animals : an Open Access Journal from MDPI, 13(2), 296.
Full text: Click here
Publication 2023
Catalase Cavia Gelatins Genotype Hemolysis Lactose Males Microscopy Motility, Cell Nitrates Oligonucleotide Primers Orchitis Pathogenicity Trehalose Urease Yersinia pseudotuberculosis Infections
5
Rapid Diphtheria Identification Protocol
We cultured collected swab specimens on tellurite-containing agar medium in a 35°C incubator for 24‒48 hours (3 ). If black colonies grew, we initially tested them by Gram stain to identify gram-positive bacilli (3 ). We used the API Coryne Test (bioMérieux, https://www.biomerieux.com) to identify species and biovars for each subculture (3 ). We tested subcultures for expression of the diphtheria toxin by using the modified Elek test (24 (link)).
We conducted quadruplex, real-time, reverse transcription PCR (qRT-PCR) directly on throat swab specimens and aliquots of skim milk, tryptone, glucose, and glycerin medium to identify C.diphtheriae, C.ulcerans, or C. pseudotuberculosis and the diphtheria toxin gene according to published methods (3 ,25 (link)). DNA was extracted by using the QIAmp DNA Extraction Kit (QIAGEN, https://www.qiagen.com) (26 (link)). Primers and probes targeted 2 rpoB genes, the tox gene, and the green fluorescent protein gene (gfp), which we used as internal positive controls.
Kitamura N., Hoan T.T., Do H.M., Dao T.A., Le L.T., Le T.T., Doan T.T., Chau T.N., Dinh H.T., Iwaki M., Senoh M., Efstraciou A., Ho N.M., Pham D.M., Dang D.A., Toizumi M., Fine P., Do H.T, & Yoshida L.M. (2023). Seroepidemiology and Carriage of Diphtheria in Epidemic-Prone Area and Implications for Vaccination Policy, Vietnam. Emerging Infectious Diseases, 29(1), 70-80.
Full text: Click here
Publication 2023
Agar Corynebacterium diphtheriae Diphtheria Toxin Genes Glucose Glycerin Gram's stain Gram-Positive Rods Milk, Cow's Oligonucleotide Primers Pharynx Reverse Transcription tellurite Yersinia pseudotuberculosis Infections

Top products related to «Yersinia pseudotuberculosis Infections»

1
Kanamycin by Merck Group
Sourced in United States, Germany, United Kingdom, France, Spain, China, Israel, India, Canada, Macao, Australia, Sao Tome and Principe, Belgium, Sweden, Poland, Japan, Switzerland, Brazil, Italy, Ireland
Kanamycin is a broad-spectrum antibiotic derived from the bacterium Streptomyces kanamyceticus. It is commonly used as a selective agent in molecular biology and microbiology laboratories for the growth and selection of bacteria that have been genetically modified to express a gene of interest.
2
Api coryne by bioMérieux
Sourced in France
The API Coryne is a biochemical identification system designed for the identification of Corynebacterium species and related organisms. It provides a standardized procedure for the biochemical characterization of these bacteria based on a series of enzymatic and metabolic tests.
3
Pcr2.1 topo by Thermo Fisher Scientific
Sourced in United States, Germany, Japan, United Kingdom
The PCR2.1-TOPO is a cloning vector designed for the direct cloning of Taq polymerase-amplified PCR products. It provides a quick and efficient method for the cloning of PCR fragments without the need for restrictive enzyme digestion or ligation.
4
Image lab software by Bio-Rad
Sourced in United States, China, Germany, United Kingdom, Italy, France, Canada, Australia, Belgium, Japan, Portugal, Sweden, Czechia, Switzerland, Spain
Image Lab software is a data analysis tool designed for use with Bio-Rad's gel and blot imaging systems. The software provides a user-friendly interface for capturing, analyzing, and processing images of gels, blots, and other samples.
5
Hiseq 2000 by Illumina
Sourced in United States, China, Germany, United Kingdom, Hong Kong, Canada, Switzerland, Australia, France, Japan, Italy, Sweden, Denmark, Cameroon, Spain, India, Netherlands, Belgium, Norway, Singapore, Brazil
The HiSeq 2000 is a high-throughput DNA sequencing system designed by Illumina. It utilizes sequencing-by-synthesis technology to generate large volumes of sequence data. The HiSeq 2000 is capable of producing up to 600 gigabases of sequence data per run.
6
Prism 9 by GraphPad
Sourced in United States, Austria, Germany, Poland, United Kingdom, Canada, Japan, Belgium, China, Lao People's Democratic Republic, France
Prism 9 is a powerful data analysis and graphing software developed by GraphPad. It provides a suite of tools for organizing, analyzing, and visualizing scientific data. Prism 9 offers a range of analysis methods, including curve fitting, statistical tests, and data transformation, to help researchers and scientists interpret their data effectively.
7
Irgasan by Merck Group
Sourced in United States, United Kingdom
Irgasan is a chemical compound used as a preservative and disinfectant in various products. It has antimicrobial properties and is commonly used in personal care and cleaning products.
8
Anti il 12p40 clone c17.8 by BioLegend
Anti-IL-12p40 (clone C17.8) is a mouse monoclonal antibody that binds to the p40 subunit of interleukin-12 (IL-12). It is commonly used in research applications as a tool to study the functions and signaling pathways of IL-12.
9
Ingenuity pathway analysis software by Qiagen
Sourced in United States, Germany, Italy, Netherlands, Japan, Spain, China, Denmark
Ingenuity Pathway Analysis (IPA) is a software tool that enables users to analyze, integrate, and understand data from -omics experiments. The core function of IPA is to provide a comprehensive database and analysis platform for identifying and visualizing biological pathways, networks, and functions relevant to experimental data.
10
Live dead baclight bacterial viability assay by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The Live/Dead BacLight bacterial viability assay is a fluorescence-based kit used to assess the viability of bacterial cells. It utilizes two nucleic acid stains, SYTO 9 and propidium iodide, to differentiate between live (intact cell membrane) and dead (compromised cell membrane) bacteria. The assay provides a simple and rapid method to quantify bacterial populations.

More about "Yersinia pseudotuberculosis Infections"

Yersinia pseudotuberculosis is a serious bacterial pathogen that causes a range of infectious diseases, collectively known as Yersiniosis or Yersinia pseudotuberculosis Infections.
This zoonotic illness can lead to symptoms such as fever, abdominal pain, and diarrhea.
Effective research and treatment protocols are crucial for managing this infectious disease.
Researchers can leverage powerful AI-driven tools like those offered by PubCompare.ai to optimize their Yersinia pseudotuberculosis infection studies.
These tools can help locate the best protocols from literature, preprints, and patents, using advanced comparison features.
Leveraging AI, researchers can identify the most effective methods and products for their research needs, driving their studies forward.
Key related terms and subtopics include Kanamycin (an antibiotic used in research), API Coryne (a biochemical identification system for corynebacteria), PCR2.1-TOPO (a cloning vector), Image Lab software (for gel and blot analysis), HiSeq 2000 (a high-throughput DNA sequencing platform), Prism 9 (a data analysis and visualization software), Irgasan (an antibacterial agent), Anti-IL-12p40 (a cytokine-targeting antibody), Ingenuity Pathway Analysis (IPA) software (for biological pathway analysis), and Live/Dead BacLight bacterial viability assay (for assessing bacterial cell viability).
By incorporating these related terms and tools, researchers can enhance their Yersinia pseudotuberculosis infection studies and drive their research forward with the help of PubCompare.ai's AI-powered solutions.
Typo: 'Leverge' should be 'Leverage'.