Log In Sign up
The largest database of trusted experimental protocols
> Disorders > Neoplastic Process > Acute Monocytic Leukemia

Acute Monocytic Leukemia

Acute Monocytic Leukemia: A rare and aggressive form of acute myeloid leukemia characterized by the proliferation of immature monocytic cells.
Patients may experience fever, fatigue, and increased susceptibility to infections.
Early diagnosis and appropriate treatment are crucial for managing this condition.
PubCompare.ai's AI-driven platform can optimize your research by providing access to relevant protocols, pre-prints, and patents, along with intelligent comparisons to identify the best strategies for your study.
Streamline your research process and make informed decisions with PubCompare.ai's cutting-edge techology.

Most cited protocols related to «Acute Monocytic Leukemia»

1
Validating Pregnancy Distress Questionnaire
This descriptive-analytic cross-sectional study of the tool assessment type was implemented in public health centers of Babol University of Medical Sciences from June to October 2018. The research tool was a revised pregnancy distress questionnaire (NuPDQ). This self-reporting questionnaire included 17 items evaluating pregnancy distress in women in each trimester of pregnancy. Specifically, 9 questions were dedicated to the first trimester, 12 questions concerned the second trimester, and 17 questions evaluated the third trimester in pregnant women. The respondents would mark each item with zero (not at all), 1 (somewhat), and 2 (very much). Thus, NUPDQ questionnaire for the second trimester contained 12 questions, and NuPDQ for the third trimester consisted of 17 questions. Note that 12 questions of NuPDQ for the third trimester were the same questions of the second-trimester NuPDQ, with 5 questions specifically for the distresses of the third trimester added to them.
After receiving permission from Dr. Lobel, the questionnaire was translated to Persian using the forward-backward method. Initially, two native Persian language translators, expert in the translation of English texts, translated the English questionnaire into Persian. The two translations were then reviewed by the researchers of the project, and a final version was prepared. In the next stage, two other translators, expert in English and Persian, were asked to translate the Persian version back into English. Then, the English translated paper was compared with the original English version by two experts of English language. Finally, the final Persian version the pregnancy distress questionnaire was approved. After verifying the correctness of the concepts, the 17-item questionnaire was qualitatively given to 10 pregnant women who met the criteria for entering the study. Then, the simplicity, clearance, and understandability of the terms used in the questionnaire were evaluated. In addition, in order to assess the content validity, 5 experts in the field of pregnancy and psychology provided the necessary feedback qualitatively. The results were: Content Validity Index (CVI) 0.91 and Content Validity Ratio (CVR) 0.94.
In order to assess the concurrent validity of the NuPDQ, a simultaneous assessment was performed via the Spielberger state-anxiety. The Spielberger State-Trait anxiety questionnaire is a tool widely used in studies to measure general anxiety. The questionnaire consists of 40 questions, 20 of which concern state anxiety, and 20 other questions evaluate trait anxiety.[14 (link)] In this study, the 20 questions capturing state anxiety were used.
In order to use this questionnaire in pregnant women, 2 rural and urban health centers, as well as one university hospital in Babol and Amol cities were randomly selected. Of the 2 teaching hospitals of Babol city which had an obstetrics clinic, one hospital was selected randomly. Further, of all of the 15 rural health centers in Baol city, one center was included randomly in the study. One center out of 17 urban health centers of Amol city was selected randomly. The inclusion criteria were pregnant women with a gestational age of 14 weeks and more, willingness to participate in the study, and age of 18 years or more. Women with less than elementary school education level, as well as mentally retarded people, and patients with severe physical or mental illnesses were excluded from the study. In each health center, a midwife assessed the participants in terms of meeting the criteria for entering the study, recorded the demographic data, and distributed questionnaires among participants. The sample size was calculated as 15 samples per question of NuPDQ. Thus, with the sample drop of 5%, 269 pregnant women entered the study through available sampling method. Of that number, 122 pregnant women in the second trimester (13 to 26 weeks), and 147 pregnant women in the third trimester (27 to 41 weeks) completed the NuPDQ and Spielberger state anxiety questionnaires. The distribution of samples in the second and third trimesters was based on the number of items in each questionnaire – the second trimester (NuPDQ-12) had 12 questions and the third trimester had 17 questions (NuPDQ-17).
All stages of confirming the validity and reliability for the NuPDQ questionnaire were performed separately for the second trimester (12-item NuPDQ) and the third trimester (17-item NuPDQ). In order to assess the reliability of these questionnaires in terms of internal consistency, Cronbach's alpha coefficient was used. The concurrent validity was assessed based on the correlation between NuPDQ tool and Spielberger state-anxiety inventory. In the next step, exploratory factor analysis was used to determine the areas of the pregnancy distress-specific questionnaires. Statistical analysis was performed using SPSS software (version 24.0, IBM, Chicago, IL, USA).
Esfandiari M., Faramarzi M., Gholinia H., Omidvar S., Nasiri-Amiri F, & Abdollahi S. (2020). Psychometric Properties and Factor Structure of the Persian Version of Revised Prenatal Distress Questionnaire in Second and Third Trimesters. Iranian Journal of Nursing and Midwifery Research, 25(5), 431-436.
Publication 2020
Acute Monocytic Leukemia Anxiety Gestational Age Mental Disorders Midwife Neuroses, Anxiety Patients Physical Examination Pregnancy Pregnant Women Woman
2
Differentiation of human monocyte-derived macrophages

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2012
Acute Monocytic Leukemia Atmosphere BLOOD Cell Lines Cells Ficoll Foam Cells Genes Glutamine Homo sapiens Hypaque Macrophage Monocytes Penicillins Scavenger Receptor Streptomycin Tissue Donors Transforming Growth Factor beta
3
Quantification of miRNA Expression

Protocol full text hidden due to copyright restrictions

Open the protocol to access the free full text link

Publication 2016
Acute Monocytic Leukemia BaseLine dental cement DNA, Complementary Fluorescence Hydrolysis MicroRNAs MIRN93 microRNA, human MIRN486 microRNA, human Oligonucleotide Primers prisma Reverse Transcription Stem, Plant Technique, Dilution
4
Benchmarking Proteomics Quantification Standards
Universal Proteomics Standard (UPS-1, Sigma-Aldrich) and Proteomics Dynamic Range Standard (UPS-2, Sigma-Aldrich), both containing 48 human proteins, either at equimolar concentrations (UPS-1) or formulated into a dynamic range of concentrations, covering five orders of magnitude (UPS-2), were prepared according to ref (30 (link)). Predigested yeast sample (Promega) was re-suspended in 0.1% trifluoroacetic acid to a final concentration of 500 ng/μl. Digested UPS-2 sample was spiked in two different amounts of 250 fmol to 2.5 amol peptide amount for sample 1 and 500 fmol to 5 amol for sample 2 into 500 ng yeast background, thereby creating two samples with a theoretical ratio 1:1 for the yeast proteome and 1:2 for the UPS peptides. In another sample, digested UPS-1 sample (25 fmol for all components) was spiked into 500 ng yeast.
Beck S., Michalski A., Raether O., Lubeck M., Kaspar S., Goedecke N., Baessmann C., Hornburg D., Meier F., Paron I., Kulak N.A., Cox J, & Mann M. (2015). The Impact II, a Very High-Resolution Quadrupole Time-of-Flight Instrument (QTOF) for Deep Shotgun Proteomics. Molecular & Cellular Proteomics : MCP, 14(7), 2014-2029.
Full text: Click here
Publication 2015
Acute Monocytic Leukemia NR4A2 protein, human Peptides Promega Proteome Trifluoroacetic Acid Yeast, Dried
5
Isolation and Culture of Mouse and Human Immune Cells
Mouse macrophage-like cell line Raw264.7 was obtained from ATCC (Manassas, VA) and cultured as described previously29 (link). Human acute monocytic leukemia cell line THP-1 was obtained from ATCC (Manassas, VA) and was grown in RPMI-1640 supplemented with 10% heat-inactivated FBS. Thioglycolate-elicited mouse primary peritoneal macrophages were prepared from female C57BL/6 J mice (6–8 weeks of age) as described previously29 (link). After 2 h, non-adherent cells were removed and the adherent cells were used as peritoneal macrophages. Bone marrow-derived dendritic cells (DCs) from C57BL/6 J mice (4 weeks of age) were generated as described49 (link).
Jiang X., Wang Y., Qin Y., He W., Benlahrech A., Zhang Q., Jiang X., Lu Z., Ji G, & Zheng Y. (2017). Micheliolide provides protection of mice against Staphylococcus aureus and MRSA infection by down-regulating inflammatory response. Scientific Reports, 7, 41964.
Full text: Click here
Publication 2017
Acute Monocytic Leukemia Bone Marrow Cells Cell Lines Cells Dendrites Females Homo sapiens LINE-1 Elements Macrophage Macrophages, Peritoneal Mice, Inbred C57BL Mus Thioglycolates

Most recents protocols related to «Acute Monocytic Leukemia»

1
Evaluating AST Cytotoxicity Compared to As(III)
Not available on PMC !

Example 6

The AST cytotoxicity was evaluated and compared with that of inorganic As(III) using five different types of human cell lines from major organs/tissues: HEK293, immortalized embryonic kidney cells; THP-1, monocytes derived from an acute monocytic leukemia patient; macrophage, macrophage-like cells differentiated from THP-1; HepG2, immortalized cells isolated from a hepatocellular carcinoma; and Caco-2, immortalized cell line derived from a colorectal adenocarcinoma patient (FIG. 5). The results show that AST has much lower cytotoxicity in human cells than As(III). The LC50 values of AST on all the tested cell lines except Caco2 were greater than 250 μM. Caco-2 was relatively more sensitive to AST with a lower LC50 value (150-200 μM). In contrast, the LC50 values of As(III) on all the tested cell lines except macrophage were lower than 25 μM, while that of macrophage was higher (100 μM), suggesting that AST is >10 times less cytotoxic than As(III). AST at 100 μM completely inhibits PfGS-I activity (FIG. 2C), P. falciparum proliferation in blood (FIG. 3) and transmission to mosquitoes (FIG. 4A), but had little effect on most of the tested human cell lines (FIG. 5). Thus, AST is effective against the malaria parasite with limited effect on human cells.

US11877996B1. Arsinothricin as a multi-stage antimalarial (2024-01-23). None [US], None [US], None [US], None [US]. Inventors: Masafumi Yoshinaga [US], Barry P. Rosen [US], Jun Li [US], Guodong Niu [US].
Full text: Click here
Patent 2024
Acute Monocytic Leukemia Adenocarcinoma BLOOD Cardiac Arrest Cell Lines Cells Culicidae Cytotoxin Embryo Hepatocellular Carcinomas Homo sapiens Kidney Macrophage Malaria Monocytes Parasites Patients Tissues Transmission, Communicable Disease
2
Telomerase Activity Measurement by TRAP Assay
The activity of telomerase was tested based on the classical TRAP method (Kim and Wu, 1997 (link)) with minor modification. Briefly, cultured cells were washed with PBS and the cell numbers were counted. A total of 1 × 106 cells were lysed with CHAPS lysis buffer for 30 min on ice. After centrifugation at 12,000 ×g for 20 min, the supernatant was removed into a new prechilled tubes and the concentration was determined by the Pierce BCA Protein Assay Kit (Thermo Scientific). Two steps were applied for TRAP assay. The first reaction system contained 1 μl cell lysate, 1 μl dNTP (2.5 mM), 1 μmol/l TS primer (5‘-AATCCGTCGAGCAGAGTT-3’), 1 μl 10 × TRAP buffer (200 mM Tris–HCL, 15 mM MgCL2, 630 mM KCL, 0.5% Tween 20, 10 mM EGTA, and 0.1% BSA, pH 8.3), and 6.5 μl ddH2O. The mixture were incubated at 30°C for 40 min, inactivated at 95°C 5 min, and stored at 4°C. The second step was PCR reaction, each 20 μl reaction system contained 2 μl of products from the first step, 2 μl 10 × TRAP buffer, 3 μl dNTP (2.5 mM), 0.5 μmol/l TS primer, 0.5 μmol/l ACX primer (5‘-GCGCGGCTTACCCTTACCCTTACCCTAACC-3’), 0.5 μmol/l NT primer (5‘-ATCGCTTCTCGGCCTTTT-3′), 0.5 amol/μl TSNT (5‘-AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT-3′), and 11 μl ddH2O. PCR was performed at 95°C for 3 min, 30 cycles of 94°C for 30 s, 59°C for 30 s, 72°C for 1 min, and 72°C for 5 min. PCR products were separated on a 15% native-PAGE gel in TBE buffer. After electrophoresis, the gel was stained with GelRed for 30 min and the images were captured under UV light with reverse processing.
Liu J., Zhao S., Li Z., Zhang Z., Zhao B., Guan G., Yin H, & Luo J. (2023). Activation of telomerase activity and telomere elongation of host cells by Theileria annulata infection. Frontiers in Microbiology, 14, 1128433.
Full text: Click here
Publication 2023
3-((3-cholamidopropyl)dimethylammonium)-1-propanesulfonate Acute Monocytic Leukemia Biological Assay Buffers Cells Centrifugation Cultured Cells Egtazic Acid Electrophoresis Magnesium Chloride Native Polyacrylamide Gel Electrophoresis Oligonucleotide Primers Proteins Telomerase Tris-borate-EDTA buffer Tromethamine Tween 20 Ultraviolet Rays
3
Single-cell analysis of NK-AML patients
Five patients who were pathologically diagnosed with NK-AML (M4/M5) and one healthy volunteer at The First Affiliated Hospital of Guangxi Medical University between 2019 and 2020 were enrolled in this study. None of the patients were treated with chemotherapy, radiation or any other antitumor medicines prior to BM sample collection. This study was approved by the Ethics Committee of The First Affiliated Hospital of Guangxi Medical University. Written informed consent was obtained from every participant in accordance with the Declaration of Helsinki.
BM mononuclear cells were isolated using density gradient centrifugation according to the manufacturer’s instructions. In brief, 2 ml of fresh BM aspirate and 2 ml 1 × DPBS (Gibco) were collected in an EDTA anticoagulant tube and subsequently layered onto Lymphocyte Separation Medium. After centrifugation, BM mononuclear cells (the third layer) were carefully transferred to a new tube and washed with 1 × DPBS. After supernatant removal, the cell pellets were suspended in red blood cell lysis buffer (Solarbio) and incubated on ice for 10 min to lyse red blood cells. After washing twice with 1 × DPBS, the cell pellets were resuspended in cell freezing medium (90% fetal calf serum supplemented with 10% dimethyl sulfoxide (DMSO)). Finally, the BM mononuclear cells were viably frozen and stored in liquid nitrogen or a – 85 ℃ freezer.
Viably frozen cells were thawed using standard procedures. First, frozen cells were thawed at 37 °C, suspended in Dulbecco’s Modified Eagle Medium (DMEM) and washed with DMEM. The cell suspension was passed through a 40 µm filter after resuspension in DMEM at a concentration of 1–2 million cells per ml. Finally, we obtained a single-cell suspension. Cell counts and viability were determined with a hemocytometer with trypan blue staining (Gibco). Samples were analyzed on a Chromium system (10 × Genomics) according to the manufacturer’s instructions for an expected capture rate of 20,000 single cells per patient.
Wu W., Shi Z., Tang Z., Li H., Huang X., Liang X., Li J., Yao Y., Zhao W., Wu M., Luo J, & Liu Z. (2023). Characterization of bone marrow heterogeneity in NK-AML (M4/M5) based on single-cell RNA sequencing. Experimental Hematology & Oncology, 12, 25.
Full text: Click here
Publication 2023
Acute Monocytic Leukemia Anticoagulants Antineoplastic Agents Buffers Cells Centrifugation Centrifugation, Density Gradient Chromium Eagle Edetic Acid Electromagnetic Radiation Erythrocytes Ethics Committees, Clinical Fetal Bovine Serum Freezing Healthy Volunteers Lymphocyte Nitrogen Patients Pellets, Drug Pharmacotherapy Specimen Collection Sulfoxide, Dimethyl Trypan Blue
4
Evaluating Gene Expression in NK-AML
A total of 30 BM samples were obtained from 20 chemotherapy-naive NK-AML (M4/M5) patients and 10 healthy volunteers between 2013 and 2016 at The First Affiliated Hospital of Guangxi Medical University. The NK-AML(M4/M5) patients were classified according to the French-American-British (FAB, 2016) Criteria. All NK-AML (M4/M5) patients received regular follow-up, and the follow-up period ended in December 2017. Patients who had other hematological diseases or malignant tumors were excluded. The healthy volunteers had no obvious abnormalities in any examination indexes. Written informed consent was obtained from all the participants according to the Declaration of Helsinki prior to BM collection. Detailed clinical features of the 30 samples are provided in Additional file 2: Table S1C.
Up to 2 ml of BM sample was extracted from each participant, and BM mononuclear cells were separated by density gradient centrifugation. Total RNA was isolated from the BM cells using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. RNA was then reverse transcribed into cDNA. Reverse transcription was performed with a SuperScriptTM III Reverse Transcriptase kit (Invitrogen: 18080–044) on a Gene Amp PCR System 9700 (Applied Biosystems). qRT‒PCR was performed on a ViiA 7 Real-time PCR System (Applied Biosystems) using the 2X PCR Master Mix Kit (Arraystar). The following reaction conditions were used: 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 1 min. ACTB was used as an endogenous reference gene, and the primer sequences used in the present study were as follows: ACTB forward: 5′GTGGCCGAGGACTTTGATTG3′ and reverse: 5′CCTGTAACAACGCATCTCATATT3′; ITPR2 forward: 5′TGCGCCAATCAGCTACTTCT3′ and reverse: 5′TCAGGATTAAGCTCTGCAGCTA3′; ADGRE2 forward: 5′GGTCCTGGAACCTGAGAAGC3′ and reverse: 5′AGGTGCTGGTGTTCTGGATG3′; ANKRD28 forward: 5′TGGTCACCGTCTATGTCTTCAG3′ and reverse: 5′AGGGCTTATTGTTGCTCTATTATC3′; KDM5B forward: 5′AATAGAACCCGAGGAGACAACG3′ and reverse: 5′GACAGACATACAGGTCCACAGCA3′; ITGA4 forward: 5′CTGGGTAGCCCTAATGGA3′ and reverse: 5′ATGCCCACAAGTCACGAT3′; and CDK6 forward: 5′CATTCAAAATCTGCCCAACC3′ and reverse: 5′GGTCCTGGAAGTATGGGTGA3′. The relative expression of target genes was calculated with the comparative 2 −  ∆∆Ct method. As the data did not exhibit a normal distribution, the relative expression of target genes was compared among different groups using the Mann‒Whitney U test.
Wu W., Shi Z., Tang Z., Li H., Huang X., Liang X., Li J., Yao Y., Zhao W., Wu M., Luo J, & Liu Z. (2023). Characterization of bone marrow heterogeneity in NK-AML (M4/M5) based on single-cell RNA sequencing. Experimental Hematology & Oncology, 12, 25.
Full text: Click here
Publication 2023
Acute Monocytic Leukemia Adjustment Disorders CDK6 protein, human Cells Centrifugation, Density Gradient Congenital Abnormality DNA, Complementary Gene Expression Genes Genitalia Healthy Volunteers Hematological Disease KDM5B protein, human Malignant Neoplasms Oligonucleotide Primers Patients Pharmacotherapy Reverse Transcription RNA-Directed DNA Polymerase trizol
5
Rabies Surveillance in Iran
This experimental study was based on samples, which were received from four provinces of Iran (Ardabil, Gilan, Golestan, and Mazandaran) by the North Research Center of the Pasteur Institute of Iran in the city of Amol from March 2016 to March 2018 (Figure 1).
Based on the protocol, the bitten domestic animals were quarantined for 15 days, and in case of rabies symptoms, they were euthanized. The brain samples were collected from suspected animals and packed in a vial containing 50% glycerin and 50% phosphate buffer saline (PBS) [15 (link)]. In the case of no symptom detection, the suspected animal was kept in quarantine for another 15 days, and if no rabies symptoms appeared, it was returned to its original place of living.
Regarding wild animals, if they were trapped by veterinarians or environmental officers while showing bitten or any suspicious signs, they were first quarantined according to the same procedure, and if symptoms appeared, they were euthanized. The brain sample was sent to the laboratory. These wild animals act as a link (carrier) between wildlife and domestic animals. Furthermore, they can be the main carriers of the virus from its reservoir (jackal) to other animals.
Kavoosian S., Behzadi R., Asouri M., Ahmadi A.A., Nasirikenari M, & Salehi A. (2023). Comparison of Rabies Cases Received by the Shomal Pasteur Institute in Northern Iran: A 2-Year Study. Global Health, Epidemiology and Genomics, 2023, 3492601.
Full text: Click here
Publication 2023
Acute Monocytic Leukemia Animals Animals, Domestic Animals, Wild Brain Buffers Dental Occlusion Glycerin Hydrophobia Jackals Phosphates Saline Solution Veterinarian Virus

Top products related to «Acute Monocytic Leukemia»

1
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
2
Rpmi 1640 medium by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Japan, France, Canada, Australia, Italy, Switzerland, Belgium, New Zealand, Spain, Israel, Sweden, Denmark, Macao, Brazil, Ireland, India, Austria, Netherlands, Holy See (Vatican City State), Poland, Norway, Cameroon, Hong Kong, Morocco, Singapore, Thailand, Argentina, Taiwan, Province of China, Palestine, State of, Finland, Colombia, United Arab Emirates
RPMI 1640 medium is a commonly used cell culture medium developed at Roswell Park Memorial Institute. It is a balanced salt solution that provides essential nutrients, vitamins, and amino acids to support the growth and maintenance of a variety of cell types in vitro.
3
Thp 1 by American Type Culture Collection
Sourced in United States, Germany, China, United Kingdom, Japan, France, Israel
The THP-1 is a human acute monocytic leukemia cell line. It is a commonly used model for studying monocyte and macrophage biology.
4
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
5
Rpmi 1640 by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Canada, Japan, Australia, Italy, Switzerland, Belgium, New Zealand, Austria, Netherlands, Israel, Sweden, Denmark, India, Ireland, Spain, Brazil, Norway, Argentina, Macao, Poland, Holy See (Vatican City State), Mexico, Hong Kong, Portugal, Cameroon
RPMI 1640 is a common cell culture medium used for the in vitro cultivation of a variety of cells, including human and animal cells. It provides a balanced salt solution and a source of essential nutrients and growth factors to support cell growth and proliferation.
6
Phorbol myristate acetate (pma) by Merck Group
Sourced in United States, Germany, United Kingdom, France, Italy, China, Canada, Switzerland, Sao Tome and Principe, Macao, Poland, Japan, Australia, Belgium, Hungary, Netherlands, India, Denmark, Chile
The PMA is a versatile laboratory equipment designed for precision measurement and analysis. It functions as a sensitive pressure transducer, accurately measuring and monitoring pressure levels in various applications. The PMA provides reliable and consistent data for research and testing purposes.
7
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.
8
Streptomycin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
9
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
10
Thp 1 cell by American Type Culture Collection
Sourced in United States, United Kingdom, Japan, Germany
THP-1 cells are a human monocytic cell line derived from an acute monocytic leukemia patient. They are commonly used in cell biology research to study monocyte and macrophage functions.

More about "Acute Monocytic Leukemia"

Acute Monocytic Leukemia (AMoL) is a rare and aggressive form of acute myeloid leukemia (AML) characterized by the proliferation of immature monocytic cells.
This hematological malignancy is also known as acute monoblastic leukemia or M5 AML.
Patients with AMoL may experience symptoms such as fever, fatigue, and increased susceptibility to infections due to the overproduction of abnormal monocytes.
Early diagnosis and appropriate treatment are crucial for managing this condition.
Diagnostic techniques may involve peripheral blood smears, bone marrow aspiration, and immunophenotyping to identify the presence of CD14+ and CD11b+ monocytic cells.
Treatment typically includes a combination of chemotherapy, targeted therapies, and potentially hematopoietic stem cell transplantation.
In cell culture studies, AMoL is often modeled using the THP-1 cell line, which is derived from a patient with acute monocytic leukemia.
These cells can be cultured in RPMI 1640 medium supplemented with fetal bovine serum (FBS) and antibiotics such as penicillin and streptomycin.
Phorbol 12-myristate 13-acetate (PMA) is commonly used to induce differentiation of THP-1 cells into a more mature monocytic phenotype, providing a valuable tool for investigating the biology and potential therapeutic approaches for AMoL.
Conducting research on Acute Monocytic Leukemia can be streamlined with the help of PubCompare.ai's AI-driven platform.
This cutting-edge technology can assist researchers in accessing relevant protocols, pre-prints, and patents, as well as providing intelligent comparisons to identify the best strategies for their studies.
By leveraging PubCompare.ai's resources, researchers can make more informed decisions and optimize their research process on this rare and aggressive form of acute myeloid leukemia.