Log In Sign up
The largest database of trusted experimental protocols
> Disorders > Pathologic Function > Infection

Infection

Infection refers to the invasion and multiplication of microorganisms, such as bacteria, viruses, fungi, or parasites, within the body.
This process can lead to the development of disease or illness.
Infections can occur in various parts of the body and can be caused by a wide range of pathogens.
The symptoms and severity of an infection depend on the type of microorganism, the route of infection, and the individual's immune response.
Proper diagnosis and treatment, which may include antimicrobial therapies, are crucial for managing infections and preventing complications.
Researchers can utilize advanced tools like PubCompare.ai to identify the most reproducible and accurate research methods for studying infection proceses and enhancing the quality of their work.

Most cited protocols related to «Infection»

1
Early COVID-19 Epidemiological Insights
The epidemic curve was constructed by date of illness onset, and key dates relating to epidemic identification and control measures were overlaid to aid interpretation. Case characteristics were described, including demographic characteristics, exposures, and health care worker status. The incubation period distribution (i.e., the time delay from infection to illness onset) was estimated by fitting a log-normal distribution to data on exposure histories and onset dates in a subset of cases with detailed information available. Onset-to-first-medical-visit and onset-to-admission distributions were estimated by fitting a Weibull distribution on the dates of illness onset, first medical visit, and hospital admission in a subset of cases with detailed information available. We fitted a gamma distribution to data from cluster investigations to estimate the serial interval distribution, defined as the delay between illness onset dates in successive cases in chains of transmission.
We estimated the epidemic growth rate by analyzing data on the cases with illness onset between December 10 and January 4, because we expected the proportion of infections identified would increase soon after the formal announcement of the outbreak in Wuhan on December 31. We fitted a transmission model (formulated with the use of renewal equations) with zoonotic infections to onset dates that were not linked to the Huanan Seafood Wholesale Market, and we used this model to derive the epidemic growth rate, the epidemic doubling time, and the basic reproductive number (R0), which is defined as the expected number of additional cases that one case will generate, on average, over the course of its infectious period in an otherwise uninfected population. We used an informative prior distribution for the serial interval based on the serial interval of SARS with a mean of 8.4 and a standard deviation of 3.8.11 (link)Analyses of the incubation period, serial interval, growth rate, and R0 were performed with the use of MATLAB software (MathWorks). Other analyses were performed with the use of SAS software (SAS Institute) and R software (R Foundation for Statistical Computing).
Li Q., Guan X., Wu P., Wang X., Zhou L., Tong Y., Ren R., Leung K.S., Lau E.H., Wong J.Y., Xing X., Xiang N., Wu Y., Li C., Chen Q., Li D., Liu T., Zhao J., Liu M., Tu W., Chen C., Jin L., Yang R., Wang Q., Zhou S., Wang R., Liu H., Luo Y., Liu Y., Shao G., Li H., Tao Z., Yang Y., Deng Z., Liu B., Ma Z., Zhang Y., Shi G., Lam T.T., Wu J.T., Gao G.F., Cowling B.J., Yang B., Leung G.M, & Feng Z. (2020). Early Transmission Dynamics in Wuhan, China, of Novel Coronavirus–Infected Pneumonia. The New England Journal of Medicine, 382(13), 1199-1207.
Publication 2020
Epidemics Gamma Rays Infection Seafood Severe Acute Respiratory Syndrome Transmission, Communicable Disease Workers Zoonoses
2
Age-Specific Incidence of Epidemic Spread
We explore the age-specific incidence of infection during the initial phase of an epidemic of an emerging infectious disease agent that spreads in a completely susceptible population. We focus on the generic features of epidemic spread along the transmission route that is specified by physical and nonphysical contacts as defined here. We partition the population into 5 y age bands, and we group all individuals aged 70 y and older together. This process results in 15 age classes. We denote the number of at-risk contacts of an individual in age class j with individuals in age class i by kij. We take kij as proportional to the observed number of contacts (both physical and nonphysical) that a respondent in age band j makes with other individuals in age band i. The matrix with elements kij is known in infectious disease epidemiology as the next generation matrix K [32 ]. The next generation matrix can be used to calculate the distribution of numbers of new cases in each generation of infection from any arbitrary initial number of introduced infections. For example, when infection is introduced by one single 65-y-old infected individual into a completely susceptible population, we can denote the number of initial cases in generation 0 by the vector x0 = (0,0,0,0,0,0,0,0,0,0,0,0,0,1,0)T. The expected numbers of new cases in the ith generation are denoted by the vector xi, and this vector is calculated by applying the next generation matrix K i times to the initial numbers of individuals x0, that is, xi = Ki x0. For large i, the vector xi will be proportional to the leading eigenvector of K. We find that, in practice, the distribution of new cases is stable after five generations; that is, the distribution no longer depends on the precise age of the initial case. The incidence of new infections per age band is obtained by dividing the expected number of new cases per age class by the number of individuals in each age class. To facilitate comparison among countries, we normalized the distribution of incidence over age classes such that for each country the age-specific incidences sum to one.
Mossong J., Hens N., Jit M., Beutels P., Auranen K., Mikolajczyk R., Massari M., Salmaso S., Tomba G.S., Wallinga J., Heijne J., Sadkowska-Todys M., Rosinska M, & Edmunds W.J. (2008). Social Contacts and Mixing Patterns Relevant to the Spread of Infectious Diseases. PLoS Medicine, 5(3), e74.
Publication 2008
Age Groups Cloning Vectors Communicable Diseases Communicable Diseases, Emerging Epidemics Generic Drugs Infection Maritally Unattached Physical Examination Transmission, Communicable Disease
3
Metabolite Extraction and Mass Spectrometry Analysis
At various time points following addition of labeled DMEM, metabolites were harvested as previously described.20 (link) After drying the samples, the metabolites extracted from the infected plates were dissolved in 600 µL of HPLC-grade water, while metabolites from mock-treated plates were dissolved in 300 µL. This 2-fold difference in volume accounts for the ~2-fold increase in volume of the fibroblasts during human cytomegalovirus infection. Volumes of 10 µL of each metabolite extract were analyzed via reversephase ion-pairing chromatography coupled to a stand-alone orbitrap mass spectrometer. The mass spectrometer scan rate was set to 1 Hz and resolving power to 100 000, scanning m/z 85–1000 in the negative ion mode. All other parameters are as in Lu et al.21 (link) The LC gradient was 0 min, 0% B; 2.5 min, 0% B; 5 min, 20% B; 7.5 min, 20% B; 13 min, 55% B; 15.5 min, 95% B; 18.5 min, 95% B; 19 min, 0% B; 25 min, 0% B. Solvent A is 97:3 water–methanol with 10 mM tributylamine and 15 mM acetic acid; solvent B is methanol. The flow rate was 200 µL/min on a Synergy Hydro-RP column (100 mm × 2 mm, 2.5 µm particle size, Phenomenex, Torrance, CA).
Melamud E., Vastag L, & Rabinowitz J.D. (2010). Metabolomic Analysis and Visualization Engine for LC–MS Data. Analytical chemistry, 82(23), 9818-9826.
Publication 2010
Acetic Acid Chromatography Cytomegalovirus Infections Fibroblasts High-Performance Liquid Chromatographies Homo sapiens Human Herpesvirus 5 Infection Methanol Solvents tributylamine
4
Genome-wide CRISPR Screening in Cancer Cells
Cancer cell lines were transduced with a lentiviral vector expressing the Cas9 nuclease under blasticidin selection (pXPR-311Cas9). Each Cas9-expressing cell line was subjected to a Cas9 activity assay3 (link) to characterize the efficacy of CRISPR/Cas9 in these cell lines (Supplementary Table 1). Cell lines with less than 45% measured Cas9 activity were considered ineligible for screening. Stable polyclonal Cas9+ cell lines were then infected in replicate (n = 3) at low multiplicity of infection (MOI < 1) with a library of 76,106 unique sgRNAs (Avana), which after filtering out sex chromosomes was composed of 70,086 targeting 17,670 genes (~4 sgRNAs per gene) annotated in the consensus coding sequence (CCDS) database, and 995 non-targeting control sgRNAs (Supplementary Table 2). Cells were selected in puromycin and blasticidin for 7 days and then passaged without selection while maintaining a representation of 500 cells per sgRNA until 21 days after infection. Genomic DNA was purified from endpoint cell pellets, the sgRNA barcodes are PCR amplified with sufficient gDNA to maintain representation, and the PCR products are sequenced using standard Illumina machines and protocols.
Meyers R.M., Bryan J.G., McFarland J.M., Weir B.A., Sizemore A.E., Xu H., Dharia N.V., Montgomery P.G., Cowley G.S., Pantel S., Goodale A., Lee Y., Ali L.D., Jiang G., Lubonja R., Harrington W.F., Strickland M., Wu T., Hawes D.C., Zhivich V.A., Wyatt M.R., Kalani Z., Chang J.J., Okamoto M., Stegmaier K., Golub T.R., Boehm J.S., Vazquez F., Root D.E., Hahn W.C, & Tsherniak A. (2017). Computational correction of copy-number effect improves specificity of CRISPR-Cas9 essentiality screens in cancer cells. Nature genetics, 49(12), 1779-1784.
Publication 2017
Cell Lines Cells Cloning Vectors Clustered Regularly Interspaced Short Palindromic Repeats Consensus Sequence DNA Library DNA Replication Genes Genome Infection Malignant Neoplasms Open Reading Frames Pellets, Drug Puromycin Sex Chromosomes
5
Deriving and Validating Sepsis Indicators
In UPMC derivation and validation data, indicators were generated for each component of the systemic inflammatory response syndrome (SIRS) criteria4 (link); the Sequential [Sepsis-related] Organ Failure Assessment (SOFA) score8 (link); and the Logistic Organ Dysfunction System (LODS) score,9 (link) a weighted organ dysfunction score (Table 1). We used a modified version of the LODS score that did not contain urine output (because of poor accuracy in recording on hospital ward encounters), prothrombin, or urea levels. The maximum SIRS criteria, SOFA score, and modified LODS score were calculated for the time window from 48 hours before to 24 hours after the onset of infection, as well as on each calendar day. This window was used for candidate criteria because organ dysfunction in sepsis may occur prior to, near the moment of, or after infection is recognized by clinicians or when a patient presents for care. Moreover, the clinical documentation, reporting of laboratory values in EHRs, and trajectory of organ dysfunction are heterogeneous across encounters and health systems. In a post hoc analysis requested by the task force, a change in SOFA score was calculated of 2 points or more from up to 48 hours before to up to 24 hours after the onset of infection.
Seymour C.W., Liu V.X., Iwashyna T.J., Brunkhorst F.M., Rea T.D., Scherag A., Rubenfeld G., Kahn J.M., Shankar-Hari M., Singer M., Deutschman C.S., Escobar G.J, & Angus D.C. (2016). Assessment of Clinical Criteria for Sepsis: For the Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA, 315(8), 762-774.
Publication 2016
Genetic Heterogeneity Infection Patients Prothrombin Sepsis Systemic Inflammatory Response Syndrome Urea Urine

Most recents protocols related to «Infection»

1
Investigating Virus Infectivity's Role in Plaque Size
Not available on PMC !

Example 3

Investigation of Virus Infectivity as a Factor that Determines Plaque Size.

With the revelation that plaque formation is strongly influenced by the immunogenicity of the virus, the possibility that infectivity of the virus could be another factor that determines plaque sizes was investigated. The uptake of viruses into cells in vitro was determined by measuring the amounts of specific viral RNA sequences through real-time PCR.

To measure total viral RNA, total cellular RNA was extracted using the RNEasy Mini kit (Qiagen), and complementary DNA synthesized using the iScript cDNA Synthesis kit (Bio-Rad). To measure total viral RNA, quantitative real-time PCR was done using a primer pair targeting a highly conserved region of the 3′ UTR common to all four serotypes of dengue; inter-sample normalization was done using GAPDH as a control. Primer sequences are listed in Table 5. Pronase (Roche) was used at a concentration of 1 mg/mL and incubated with infected cells for five minutes on ice, before washing with ice cold PBS. Total cellular RNA was then extracted from the cell pellets in the manner described above.

TABLE 5
PCR primer sequences.
Gene TargetPrimer Sequence
DENV LYL 3′UTRForward: TTGAGTAAACYRTGCTGCCTGTA
TGCC (SEQ ID NO: 24)
Reverse: GAGACAGCAGGATCTCTGGTCTY
TC (SEQ ID NO: 25)
GAPDH (Human)Forward: GAGTCAACGGATTTGGTCGT
(SEQ ID NO: 26)
Reverse: TTGATTTTGGAGGGATCTCG
(SEQ ID NO: 27)
CXCL10 (Human)Forward: GGTGAGAAGAGATGTCTGAATCC
(SEQ ID NO: 28)
Reverse: GTCCATCCTTGGAAGCACTGCA
(SEQ ID NO: 29)
ISG20 (Human)Forward: ACACGTCCACTGACAGGCTGTT
(SEQ ID NO: 30)
Reverse: ATCTTCCACCGAGCTGTGTCCA
(SEQ ID NO: 31)
IFIT2 (Human)Forward: GAAGAGGAAGATTTCTGAAG
(SEQ ID NO: 32)
Reverse: CATTTTAGTTGCCGTAGG
(SEQ ID NO: 33)
IFNα (Canine)Forward: GCTCTTGTGACCACTACACCA
(SEQ ID NO: 34)
Reverse: AAGACCTTCTGGGTCATCACG
(SEQ ID NO: 35)
IFNβ (Canine)Forward: GGATGGAATGAGACCACTGTCG
(SEQ ID NO: 36)
Reverse: ACGTCCTCCAGGATTATCTCCA
(SEQ ID NO: 37)

The proportion of infected cells was assessed by flow cytometry. Cells were fixed and permeabilised with 3% paraformaldehyde and 0.1% saponin, respectively. DENV envelope (E) protein was stained with mouse monoclonal 4G2 antibody (ATCC) and AlexaFluor488 anti-mouse secondary antibody. Flow cytometry analysis was done on a BD FACS Canto II (BD Bioscience).

Unexpectedly, despite DENV-2 PDK53 inducing stronger antiviral immune responses, it had higher rates of uptake by HuH-7 cells compared to DENV-2 16681 (FIG. 5). This difference continued to be observed when DENV-2 PDK53 inoculum was reduced 10-fold. In contrast, DENV-3 PGMK30 and its parental strain DENV-3 16562 displayed the same rate of viral uptake in host cells. Furthermore, DENV-2 PDK53 showed a higher viral replication rate compared to DENV-2 16681. This was determined by measuring the percentage of cells that harbored DENV E-protein, detected using flow cytometry. DENV-2 PDK53 showed a higher percentage of infected cells compared to DENV-2 16681 at the same amount of MOI from Day 1 to 3 (FIG. 6). In contrast, DENV-3 PGMK30 showed a reverse trend and displayed lower percentage of infected cells compared to DENV-3 16562. Results here show that successfully attenuated vaccines, as exemplified by DENV-2 PDK53, have greater uptake and replication rate.

Results above demonstrate that the DENV-2 PDK53 and DENV-3 PGMK30 are polarized in their properties that influence plaque morphologies. While both attenuated strains were selected for their formation of smaller plaques compared to their parental strains, the factors leading to this outcome are different between the two.

Accordingly, this study has demonstrated that successfully attenuated vaccines, as exemplified by DENV-2 PDK53 in this study, form smaller plaques due to induction of strong innate immune responses, which is triggered by fast viral uptake and spread of infection. In contrast, DENV-3 PGMK30 form smaller plaques due to its slower uptake and growth in host cells, which inadvertently causes lower up-regulation of the innate immune response.

Based on the results presented in the foregoing Examples, the present invention provides a new strategy to prepare a LAV, which expedites the production process and ensures the generation of effectively attenuated viruses fit for vaccine use.

US11865083B2. Rapid method of generating live attenuated vaccines (2024-01-09). NATIONAL UNIVERSITY OF SINGAPORE [SG]. Inventors: Eng Eong Ooi [SG], Kenneth Goh [SG], Swee Sen Kwek [SG], Choon Kit Tang [SG].
Patent 2024
Antibodies, Anti-Idiotypic Antigens, Viral Antiviral Agents Canis familiaris Cells Common Cold Cowpox virus Dengue Fever Dental Plaque DNA, Complementary DNA Replication Flow Cytometry GAPDH protein, human Genes Homo sapiens Immunity, Innate Infection Interferon-alpha Monoclonal Antibodies Mus Oligonucleotide Primers paraform Parent Pellets, Drug Pronase Proteins Real-Time Polymerase Chain Reaction Response, Immune RNA, Viral Saponin Senile Plaques Strains Vaccines Virus Virus Diseases Virus Replication
2
Arabidopsis Floral Dip Transformation Protocol
Not available on PMC !

Example 12

Plant transformation—The Arabidopsis thaliana var Columbia (To plants) were transformed according to the Floral Dip procedure [Clough S J, Bent A F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16(6): 735-43; and Desfeux C, Clough S J, Bent A F. (2000) Female reproductive tissues were the primary targets of Agrobacterium-mediated transformation by the Arabidopsis floral-dip method. Plant Physiol. 123(3): 895-904] with minor modifications. Briefly, Arabidopsis thaliana Columbia (C010) T0 plants were sown in 250 ml pots filled with wet peat-based growth mix. The pots were covered with aluminum foil and a plastic dome, kept at 4° C. for 3-4 days, then uncovered and incubated in a growth chamber at 18-24° C. under 16/8 hours light/dark cycles. The T0 plants were ready for transformation six days before anthesis.

Single colonies of Agrobacterium carrying the binary vectors harboring the genes of some embodiments of the invention were cultured in YEBS medium (Yeast extract 1 gr/L, Beef extract 5 gr/L, MgSO4*7H2O, Bacto peptone 5 gr/L) supplemented with kanamycin (50 mg/L) and gentamycin (50 mg/L). The cultures were incubated at 28° C. for 48 hours under vigorous shaking to desired optical density at 600 nm of 0.85 to 1.1. Before transformation into plants, 60 μl of Silwet L-77 was added into 300 ml of the Agrobacterium suspension.

Transformation of T0 plants was performed by inverting each plant into an Agrobacterium suspension such that the above ground plant tissue was submerged for 1 minute. Each inoculated T0 plant was immediately placed in a plastic tray, then covered with clear plastic dome to maintain humidity and was kept in the dark at room temperature for 18 hours to facilitate infection and transformation. Transformed (transgenic) plants were then uncovered and transferred to a greenhouse for recovery and maturation. The transgenic T0 plants were grown in the greenhouse for 3-5 weeks until siliques were brown and dry, then seeds were harvested from plants and kept at room temperature until sowing.

For generating T1 and T2 transgenic plants harboring the genes of some embodiments of the invention, seeds collected from transgenic T0 plants were surface-sterilized by exposing to chlorine fumes (6% sodium hypochlorite with 1.3% HCl) for 100 minutes. The surface-sterilized seeds were sown on culture plates containing half-strength Murashig-Skoog (Duchefa); 2% sucrose; 0.5% plant agar; 50 mg/L kanamycin; and 200 mg/L carbenicylin (Duchefa). The culture plates were incubated at 4° C. for 48 hours and then were transferred to a growth room at 25° C. for three weeks. Following incubation, the T1 plants were removed from culture plates and planted in growth mix contained in 250 ml pots. The transgenic plants were allowed to grow in a greenhouse to maturity. Seeds harvested from T1 plants were cultured and grown to maturity as T2 plants under the same conditions as used for culturing and growing the T1 plants.

US11859197B2. Insecticidal polypeptides and use thereof (2024-01-02). EVOGENE LTD. [IL]. Inventors: Or Rotem [IL], Moshe Elbaz [IL], Michal Simovitch Etkes [IL], Lisa N. Meihls [US], Noam Ben Naim [IL], Dhritiman Ghosh [US].
Patent 2024
Agar Agrobacterium Aluminum Animals, Transgenic Arabidopsis Arabidopsis thalianas Bacto-peptone Beef Chlorine Cloning Vectors Culture Media Decompression Sickness Females Genes Genes, Plant Gentamicin Humidity Infection Kanamycin Marijuana Abuse Plant Diseases Plant Embryos Plants Plants, Transgenic Reproduction Saccharomyces cerevisiae silwet L-77 Sodium Hypochlorite Sucrose Sulfate, Magnesium Tissues
3
Artemisinin Inhibits Malaria Transmission
Not available on PMC !

Example 5

The effects of AST on P. falciparum transmission to Anopheles gambiae mosquitoes was analyzed. AST was added to 15-day cultured P. falciparum-infected blood at concentrations from 0.1 to 3 μM and fed to An. gambiae using a standard membrane feeding assay (SMFA). The number of oocysts in mosquito midguts was counted on day 7 post-infection. AST completely inhibited malaria transmission at 3 μM (FIG. 4A) suggesting that AST effectively blocks transmission. Most of currently available antimalarial drugs and candidate drugs in clinical development require 5 μM or higher for complete inhibition of P. falciparum transmission in SMFAs. These results demonstrate that AST is at least as effective as current drugs. In contrast, no dead mosquitoes were observed, suggesting that AST has no or little insecticidal activity. The EC50 of AST in blocking the transmission of the sexual-stage P. falciparum to mosquitos, defined as the concentration of a compound that inhibits 50% of infection intensity (the number of oocysts per mosquito) compared to that of the compound-free control, was 0.34 μM.

Advantageously, AST significantly inhibits Plasmodium falciparum transmission to Anopheles gambiae mosquitoes compared to that of PT and MSO (FIG. 4B).

US11877996B1. Arsinothricin as a multi-stage antimalarial (2024-01-23). None [US], None [US], None [US], None [US]. Inventors: Masafumi Yoshinaga [US], Barry P. Rosen [US], Jun Li [US], Guodong Niu [US].
Patent 2024
Anopheles gambiae Antimalarials Biological Assay BLOOD Cardiac Arrest Culicidae Infection Insecticides Malaria Oocysts Pharmaceutical Preparations Plasmodium falciparum Psychological Inhibition Tissue, Membrane Transmission, Communicable Disease
4
Conformationally Correct SARS-CoV-2 Spike RBD Expression
Not available on PMC !

Example 9

Determination of the binding of recombinant ACE2-Fc was performed to confirm the native, physiologically-relevant folding of the S RBD after expression from the hAd5 S-Fusion+N-ETSD vaccine candidate. S RBD binds ACE2 during the course of SARS-CoV-2 infection and an effective neutralizing antibody prevents this interaction and thus infection. Such a neutralizing antibody is more likely to be effective if raised in response to S presented in the correct conformation. In addition to enhancement of cell surface expression, the optimized S allows for proper protein folding. It was found that compared to either hAd5 S-WT or hAd5 S-Fusion (FIGS. 11a and b, respectively), ACE2-Fc binding to S RBD expressed from the hAd5 S-Fusion+N-ETSD was clearly enhanced (FIG. 11c). Anti-RBD antibody binding studies (FIG. 1 if j) performed with the same experiment, confirmed the enhanced surface expression findings noted by ACE2-Fc binding. These findings of conformationally correct and enhanced S RBD expression, important for production of neutralizing antibodies, directed us to elect the hAd5 S-Fusion+N-ETSD vaccine candidate for clinical trials.

US11857620B2. Method of inducing immunity against SARS-CoV-2 using spike (s) and nucleocapsid (N)-ETSD immunogens delivered by a replication-defective adenovirus (2024-01-02). ImmunityBio, Inc. [US]. Inventors: Patrick Soon-Shiong [US], Peter Sieling [US], Kayvan Niazi [US], Shahrooz Rabizadeh [US], Lise Geissert [US], Annie Shin [US], Adrian Rice [US], Elizabeth Gabitzsch [US], Jeffrey Safrit [US], Leonard Sender [US].
Patent 2024
ACE2 protein, human Antibodies, Anti-Idiotypic Antibodies, Neutralizing Antibody Formation Cells COVID 19 Infection Transfection Vaccines
5
Canine Respiratory Pathology in Viral Infection
Not available on PMC !

Example 14

In contrast to the previous experimental infection using specific pathogen-free Beagles (Crawford et al., 2005), the virus-inoculated mongrel dogs had pneumonia as evidenced by gross and histological analyses of the lungs from days 1 to 6 p.i. In addition to pneumonia, the dogs had rhinitis, tracheitis, bronchitis, and bronchiolitis similar to that described in naturally infected dogs (Crawford et al., 2005). There was epithelial necrosis and erosion of the lining of the airways and bronchial glands with neutrophil and macrophage infiltration of the submucosal tissues (FIG. 5, upper panels). Immunohistochemistry detected viral H3 antigen in the epithelial cells of bronchi, bronchioles, and bronchial glands (FIG. 5, lower panels). No bacterial superinfection was present. The respiratory tissues from the 2 sham-inoculated dogs were normal.

US11865172B2. Materials and methods for respiratory disease control in canines (2024-01-09). UNIVERSITY OF FLORIDA RESEARCH FOUNDATION, INC. [US], CORNELL RESEARCH FOUNDATION, INC. [US], The Government of The United States of America as represented by The Secretary of the Department of [US]. Inventors: Patti Cynthia Crawford [US], Paul J. Gibbs [US], Edward J. Dubovi [US], Ruben Omar Donis [US], Jacqueline Katz [US], Alexander I. Klimov [US], Nallakannu P. Lakshmanan [US], Melissa Anne Lum [US], Daniel Ghislena Emiel Goovaerts [NL], Mark William Mellencamp [US], Nancy J. Cox [US], William L. Castleman [US].
Patent 2024
Antigens, Viral Autopsy Bacteria Bronchi Bronchioles Bronchiolitis Bronchitis Canis familiaris Epithelial Cells Immunohistochemistry Infection Lung Macrophage Necrosis Neutrophil Pneumonia Respiratory Rate Rhinitis Specific Pathogen Free Superinfection Tissues Tracheitis Virus

Top products related to «Infection»

1
Polybrene by Merck Group
Sourced in United States, Germany, China, Sao Tome and Principe, United Kingdom, Macao, Canada, France, Japan, Switzerland, Italy, Australia, Netherlands, Morocco, Israel, Ireland, Belgium, Denmark, Norway
Polybrene is a cationic polymer used as a transfection reagent in cell biology research. It facilitates the introduction of genetic material into cells by enhancing the efficiency of DNA or RNA uptake.
2
Fetal bovine serum (fbs) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, Australia, Japan, Canada, Italy, France, Switzerland, New Zealand, Brazil, Belgium, India, Spain, Israel, Austria, Poland, Ireland, Sweden, Macao, Netherlands, Denmark, Cameroon, Singapore, Portugal, Argentina, Holy See (Vatican City State), Morocco, Uruguay, Mexico, Thailand, Sao Tome and Principe, Hungary, Panama, Hong Kong, Norway, United Arab Emirates, Czechia, Russian Federation, Chile, Moldova, Republic of, Gabon, Palestine, State of, Saudi Arabia, Senegal
Fetal Bovine Serum (FBS) is a cell culture supplement derived from the blood of bovine fetuses. FBS provides a source of proteins, growth factors, and other components that support the growth and maintenance of various cell types in in vitro cell culture applications.
3
Lipofectamine 2000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Canada, Japan, France, Italy, Switzerland, Australia, Spain, Belgium, Denmark, Singapore, India, Netherlands, Sweden, New Zealand, Portugal, Poland, Israel, Lithuania, Hong Kong, Argentina, Ireland, Austria, Czechia, Cameroon, Taiwan, Province of China, Morocco
Lipofectamine 2000 is a cationic lipid-based transfection reagent designed for efficient and reliable delivery of nucleic acids, such as plasmid DNA and small interfering RNA (siRNA), into a wide range of eukaryotic cell types. It facilitates the formation of complexes between the nucleic acid and the lipid components, which can then be introduced into cells to enable gene expression or gene silencing studies.
4
Dulbecco modified eagle medium (dmem) by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom, Germany, France, Australia, Canada, Japan, Italy, Switzerland, Belgium, Austria, Spain, Israel, New Zealand, Ireland, Denmark, India, Poland, Sweden, Argentina, Netherlands, Brazil, Macao, Singapore, Sao Tome and Principe, Cameroon, Hong Kong, Portugal, Morocco, Hungary, Finland, Puerto Rico, Holy See (Vatican City State), Gabon, Bulgaria, Norway, Jamaica
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium formulated to support the growth and maintenance of a variety of cell types, including mammalian cells. It provides essential nutrients, amino acids, vitamins, and other components necessary for cell proliferation and survival in an in vitro environment.
5
Puromycin by Merck Group
Sourced in United States, Germany, China, Sao Tome and Principe, United Kingdom, Macao, Canada, Japan, Italy, Switzerland, France, Israel, Australia, Spain, Belgium, Morocco, Sweden
Puromycin is a laboratory product manufactured by Merck Group. It functions as an antibiotic that inhibits protein synthesis in eukaryotic cells.
6
Penicillin streptomycin by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, China, Canada, France, Japan, Australia, Switzerland, Israel, Italy, Belgium, Austria, Spain, Gabon, Ireland, New Zealand, Sweden, Netherlands, Denmark, Brazil, Macao, India, Singapore, Poland, Argentina, Cameroon, Uruguay, Morocco, Panama, Colombia, Holy See (Vatican City State), Hungary, Norway, Portugal, Mexico, Thailand, Palestine, State of, Finland, Moldova, Republic of, Jamaica, Czechia
Penicillin/streptomycin is a commonly used antibiotic solution for cell culture applications. It contains a combination of penicillin and streptomycin, which are broad-spectrum antibiotics that inhibit the growth of both Gram-positive and Gram-negative bacteria.
7
Lipofectamine 3000 by Thermo Fisher Scientific
Sourced in United States, China, Germany, Japan, United Kingdom, France, Canada, Italy, Australia, Switzerland, Denmark, Spain, Singapore, Belgium, Lithuania, Israel, Sweden, Austria, Moldova, Republic of, Greece, Azerbaijan, Finland
Lipofectamine 3000 is a transfection reagent used for the efficient delivery of nucleic acids, such as plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It facilitates the entry of these molecules into the cells, enabling their expression or silencing.
8
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
9
Streptomycin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Australia, Japan, Switzerland, Italy, Belgium, Israel, Austria, Spain, Netherlands, Poland, Brazil, Denmark, Argentina, Sweden, New Zealand, Ireland, India, Gabon, Macao, Portugal, Czechia, Singapore, Norway, Thailand, Uruguay, Moldova, Republic of, Finland, Panama
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a protein synthesis inhibitor, targeting the 30S subunit of bacterial ribosomes, which plays a crucial role in the translation of genetic information into proteins. Streptomycin is commonly used in microbiological research and applications that require selective inhibition of bacterial growth.
10
Penicillin by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Germany, China, France, Canada, Japan, Australia, Switzerland, Italy, Israel, Belgium, Austria, Spain, Brazil, Netherlands, Gabon, Denmark, Poland, Ireland, New Zealand, Sweden, Argentina, India, Macao, Uruguay, Portugal, Holy See (Vatican City State), Czechia, Singapore, Panama, Thailand, Moldova, Republic of, Finland, Morocco
Penicillin is a type of antibiotic used in laboratory settings. It is a broad-spectrum antimicrobial agent effective against a variety of bacteria. Penicillin functions by disrupting the bacterial cell wall, leading to cell death.

More about "Infection"

Infection is the invasion and multiplication of microorganisms, such as bacteria, viruses, fungi, or parasites, within the body.
This process can lead to the development of disease or illness.
Infections can occur in various parts of the body and can be caused by a wide range of pathogens.
The symptoms and severity of an infection depend on the type of microorganism, the route of infection, and the individual's immune response.
Proper diagnosis and treatment, which may include antimicrobial therapies like Penicillin, Streptomycin, Puromycin, and Lipofectamine 2000, are crucial for managing infections and preventing complications.
Researchers can utilize advanced tools like PubCompare.ai to identify the most reproducible and accurate research methods for studying infection processes, such as using Polybrene, FBS, DMEM, and TRIzol reagent, to enhance the quality of their work.
Discover optimized infection protocols and experence the power of AI-driven protocol selection today.