Reconstructed transcript sequences (via de novo assembly, Scripture, or Cufflinks) were mapped to the reference coding sequences using BLAT35 (link). Full-length reference annotation mappings were defined as having at least 95% sequence identity covering the entire reference coding sequence and containing at most 5% insertions or deletions (cumulative gap content). In evaluating methods that leverage the strand-specific data (Trinity and Cufflinks), proper sense-strand mapping of sequences was required. Transcripts reconstructed by the alternative methods (Scripture, ABySS, and SOAPdenovo) were allowed to map to either strand. Fusion transcripts were identified as individual reconstructed transcripts that mapped as full-length to multiple reference coding sequences and lacked overlap among the matching regions within the reconstructed transcript. One-to-one mappings were required between reconstructed transcripts and reference transcripts, including alternatively spliced isoforms, with the exception of fusion transcripts.
Open Reading Frames
ORFs are an important concept in genetics and genomics, as they allow researchers to identify and study the protein-coding regions within a genome.
PubCompare.ai is an AI-driven platform that enhances reproducibility and research accuracy by helping scientists locate protocols from literature, pre-prints, and patents, and using AI-driven comparisons to identify the best protocols and products.
Expereince the future of scientific research today with PubCompare.ai's cutting-edge technology and streamlined workflow.
Most cited protocols related to «Open Reading Frames»
Reconstructed transcript sequences (via de novo assembly, Scripture, or Cufflinks) were mapped to the reference coding sequences using BLAT35 (link). Full-length reference annotation mappings were defined as having at least 95% sequence identity covering the entire reference coding sequence and containing at most 5% insertions or deletions (cumulative gap content). In evaluating methods that leverage the strand-specific data (Trinity and Cufflinks), proper sense-strand mapping of sequences was required. Transcripts reconstructed by the alternative methods (Scripture, ABySS, and SOAPdenovo) were allowed to map to either strand. Fusion transcripts were identified as individual reconstructed transcripts that mapped as full-length to multiple reference coding sequences and lacked overlap among the matching regions within the reconstructed transcript. One-to-one mappings were required between reconstructed transcripts and reference transcripts, including alternatively spliced isoforms, with the exception of fusion transcripts.
The protein interaction data sets used here were composed as follows. 'Gavin Spoke' is the spoke model of the raw purifications from Gavin et al [7 (link)]. 'Y2H' is all known large-scale [2 (link)-5 (link),10 (link)] combined with normal yeast two-hybrid results from MIPS. 'HTP Only' is only high-throughput or large-scale data [2 (link)-7 (link),10 (link)] The 'Benchmark' set was constructed from MIPS, YPD and PreBIND as previously described [6 (link)]. 'Pre HTMS' was composed of all yeast sets except the recent large-scale mass spectrometry data sets [6 (link),7 (link)]. 'AllYeast' was the combination of all above data sets. All data sets are non-redundant.
The large and rapidly growing protein sequence databases provide a wealth of information for the identification of protein-coding transcript. We derive another three features from parsing the output of BLASTX (16 (link)) search (using the transcript as query, E-value cutoff 1e-10) against UniProt Reference Clusters (UniRef90) which was developed as a nonredundant protein database with a 90% sequence identity threshold (17 (link)). First, a true protein-coding transcript is likely to have more hits with known proteins than a non-coding transcript does. Thus we extract the NUMBER OF HITS as a feature. Second, for a true protein-coding transcript the hits are also likely to have higher quality; i.e. the HSPs (High-scoring Segment Pairs) overall tend to have lower E-value. Thus we define feature HIT SCORE as follows:
where Eij is the E-value of the j-th HSP in frame i, Si measures the average quality of the HSPs in frame i and HIT SCORE is the average of Si across three frames. The higher the HIT SCORE, the better the overall quality of the hits and the more likely the transcript is protein-coding. Thirdly, for a true protein-coding transcript most of the hits are likely to reside within one frame, whereas for a true non-coding transcript, even if it matches certain known protein sequence segments by chance, these chance hits are likely to scatter in any of the three frames. Thus, we define feature FRAME SCORE to measure the distribution of the HSPs among three reading frames:
The higher the FRAME SCORE, the more concentrated the hits are and the more likely the transcript is protein-coding.
We incorporate these six features into a support vector machine (SVM) machine learning classifier (18 ). Mapping the input features onto a high-dimensional feature space via a proper kernel function, SVM constructs a classification hyper-plane (maximum margin hyper-plane) to separate the transformed data (18 ). Known for its high accuracy and good performance, SVM is a widely used classification tool in bioinformatics analysis such as microarray-based cancer classification (19 (link),20 (link)), prediction of protein function (21 (link),22 (link)) and prediction of subcellular localization (23 (link),24 (link)). We employed the LIBSVM package (25 ) to train a SVM model using the standard radial basis function kernel (RBF kernel). The C and gamma parameters were determined by grid-search in the training dataset. We trained the SVM model using the same training data set as CONC used (13 (link)), containing 5610 protein-coding cDNAs and 2670 noncoding RNAs.
Most recents protocols related to «Open Reading Frames»
Example 1
The sequence coding for the light chain variable region of the antibody was inserted into vector pFUSE2ss-CLIg-hK (Invivogen, Catalog Number: pfuse2ss-hclk) using EcoRI and BsiWI restriction sites to construct a light chain expression vector. The sequence coding for the heavy chain variable region of the antibody was inserted into vector pFUSEss-CHIg-hG2 (Invivogen, Catalog Number: pfusess-hchg2) or vector pFUSEss-CHIg-hG4 (Invivogen, Catalog Number: pfusess-hchg4) using EcoRI and NheI restriction sites to construct a heavy chain expression vector.
The culture and transfection of Expi293 cells were performed in accordance with the handbook of Expi293™ Expression System Kit from Invitrogen (Catalog Number: A14635). The density of the cells was adjusted to 2×106 cells/ml for transfection, and 0.6 μg of the light chain expression vector as described above and 0.4 μg of the heavy chain expression vector as described above were added to each ml of cell culture, and the supernatant of the culture was collected four days later.
The culture supernatant was subjected to non-reduced SDS-PAGE gel electrophoresis in accordance with the protocol described in Appendix 8, the Third edition of the “Molecular Cloning: A Laboratory Manual”.
Pictures were taken with a gel scanning imaging system from BEIJING JUNYI Electrophoresis Co., LTD and in-gel quantification was performed using Gel-PRO ANALYZER software to determine the expression levels of the antibodies after transient transfection. Results were expressed relative to the expression level of control antibody 1 (control antibody 1 was constructed according to U.S. Pat. No. 7,186,809, which comprises a light chain variable region as set forth in SEQ ID NO: 10 of U.S. Pat. No. 7,186,809 and a heavy chain variable region as set forth in SEQ ID NO: 12 of U.S. Pat. No. 7,186,809, the same below) (control antibody 2 was constructed according to U.S. Pat. No. 7,638,606, which comprises a light chain variable region as set forth in SEQ ID NO: 6 of U.S. Pat. No. 7,638,606 and a variable region as set forth in SEQ ID NO: 42 of U.S. Pat. No. 7,638,606, the same below). See Tables 2a-2c below for the results.
Example 4
6-8 week-old SPF Balb/c mice were selected and injected subcutaneously with antibodies (the antibodies of the present invention or control antibody 2) in a dose of 5 mg/kg (weight of the mouse). Blood samples were collected at the time points before administration (0 h) and at 2, 8, 24, 48, 72, 120, 168, 216, 264, 336 h after administration. For blood sampling, the animals were anesthetized by inhaling isoflurane, blood samples were taken from the orbital venous plexus, and the sampling volume for each animal was about 0.1 ml; 336 h after administration, the animals were anesthetized by inhaling isoflurane and then euthanized after taking blood in the inferior vena cava.
No anticoagulant was added to the blood samples, and serum was isolated from each sample by centrifugation at 1500 g for 10 min at room temperature within 2 h after blood sampling. The collected supernatants were immediately transferred to new labeled centrifuge tubes and then stored at −70° C. for temporary storage. The concentrations of the antibodies in the mice were determined by ELISA:
1. Preparation of Reagents
sIL-4Rα (PEPRO TECH, Catalog Number: 200-04R) solution: sIL-4Rα was taken and 1 ml ddH2O was added therein, mixed up and down, and then a solution of 100 μg/ml was obtained. The solution was stored in a refrigerator at −20° C. after being subpacked.
Sample to be tested: 1 μl of serum collected at different time points was added to 999 μl of PBS containing 1% BSA to prepare a serum sample to be tested of 1:1000 dilution.
Standard sample: The antibody to be tested was diluted to 0.1 μg/ml with PBS containing 1% BSA and 0.1% normal animal serum (Beyotime, Catalog Number: ST023). Afterwards, 200, 400, 600, 800, 900, 950, 990 and 1000 μl of PBS containing 1% BSA and 0.1% normal animal serum were respectively added to 800, 600, 400, 200, 100, 50, 10 and 0 μl of 0.1 μg/ml antibodies to be tested, and thus standard samples of the antibodies of the present invention were prepared with a final concentration of 80, 60, 40, 20, 10, 5, 1, or 0 ng/ml respectively.
2. Detection by ELISA
250 μl of 100 μg/ml sIL-4Rα solution was added to 9.75 ml of PBS, mixed up and down, and then an antigen coating buffer of 2.5 μg/ml was obtained. The prepared antigen coating buffer was added to a 96-well ELISA plate (Corning) with a volume of 100 μl per well. The 96-well ELISA plate was incubated overnight in a refrigerator at 4° C. after being wrapped with preservative film (or covered). On the next day, the 96-well ELISA plate was taken out and the solution therein was discarded, and PBS containing 2% BSA was added thereto with a volume of 300 μl per well. The 96-well ELISA plate was incubated for 2 hours in a refrigerator at 4° C. after being wrapped with preservative film (or covered). Then the 96-well ELISA plate was taken out and the solution therein was discarded, and the plate was washed 3 times with PBST. The diluted standard antibodies and the sera to be detected were sequentially added to the corresponding wells, and three duplicate wells were made for each sample with a volume of 100 μl per well. The ELISA plate was wrapped with preservative film (or covered) and incubated for 1 h at room temperature. Subsequently, the solution in the 96-well ELISA plate was discarded and then the plate was washed with PBST for 3 times. Later, TMB solution (Solarbio, Catalog Number: PR1200) was added to the 96-well ELISA plate row by row with a volume of 100 μl per well. The 96-well ELISA plate was placed at room temperature for 5 minutes, and 2 M H2SO4 solution was added in immediately to terminate the reaction. The 96-well ELISA plate was then placed in flexstation 3 (Molecular Devices), the values of OD450 were read, the data were collected and the results were calculated with Winnonlin software. The pharmacokinetic results were shown in
Example 5
A series of pharmacokinetic experiments were carried out in Macaca fascicularises to further screen antibodies.
3-5 year-old Macaca fascicularises each weighting 2-5 Kg were selected and injected subcutaneously with antibodies (the antibodies of the present invention or control antibody 2) in a dose of 5 mg/kg (weight of the Macaca fascicularis). The antibody or control antibody 2 to be administered was accurately extracted with a disposable aseptic injector, and multi-point injections were made subcutaneously on the inner side of the thigh of the animal, and the injection volume per point was not more than 2 ml. Whole blood samples were collected from the subcutaneous vein of the hind limb of the animal at the time points before administration (0 h) and at 0.5, 2, 4, 8, 24, 48, 72, 120, 168, 240, 336 h, 432 h, 504 h, 600 h, 672 h after administration. The blood volume collected from each animal was about 0.1 ml each time.
No anticoagulant was added to the blood samples, and serum was isolated from each sample by centrifugation at 1500 g for 10 min at room temperature within 2 h after blood sampling. The collected supernatants were immediately transferred to new labeled centrifuge tubes and then stored at −70° C. for temporary storage. The concentrations of the antibodies in the Macaca fascicularises were determined according the method as described in Example 4. The pharmacokinetic results are shown in
Example 10
In vivo pharmacokinetics of the antibodies of the invention are further detected and compared in this Example, in order to investigate the possible effects of specific amino acids at specific positions on the pharmacokinetics of the antibodies in animals. The specific experimental method was the same as that described in Example 4, and the results are shown in Table 9 below.
From the specific sequence, the amino acid at position 103 in the sequence of the heavy chain H1031 (SEQ ID NO. 91) of the antibody (in CDR3) is Asp (103Asp), and the amino acid at position 104 is Tyr (104Tyr). Compared with antibodies that have no 103Asp and 104Tyr in heavy chain, the present antibodies which have 103Asp and 104Tyr have a 2- to 4-fold higher area under the drug-time curve and an about 70% reduced clearance rate.
The expression levels of the antibodies of the present invention are also detected and compared, in order to investigate the possible effects of specific amino acids at specific positions on the expression of the antibodies. Culture and transfection of Expi293 cells were conducted according to Example 1, and the collected culture supernatant was then passed through a 0.22 μm filter and then purified by GE MabSelect Sure (Catalog Number: 11003494) Protein A affinity chromatography column in the purification system GE AKTA purifier 10. The purified antibody was collected and concentrated using Amicon ultrafiltration concentrating tube (Catalog Number: UFC903096) and then quantified. The quantitative results are shown in Table 10 below.
From the specific sequence, the amino acid at position 31 in the sequence of the light chain L1012 (SEQ ID NO. 44), L1020 (SEQ ID NO. 55) or L1023 (SEQ ID NO. 51) of the antibody (in CDR1) is Ser (31Ser). Compared with antibodies that have no 31Ser in light chain, the present antibodies which have 31Ser have a 2- to 5-fold higher expression level.
The above description for the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art can make various changes and variations according to the present invention, which are within the protection scope of the claims of the present invention without departing from the spirit of the same.
Example 1
a. Materials and Methods
i. Vector Construction
1. Virus-Like Particle
As most broadly neutralizing HPV antibodies are derived from the highly conserved N-terminal region of L2, amino acids 14-122 of HPV16 L2 were used to create HBc VLPs. L2 with flanking linker regions was inserted into the tip of the a-helical spike of an HBc gene copy which was fused to another copy of HBc lacking the L2 insert. This arrangement allows the formation of HBc dimers that contain only a single copy of L2, increasing VLP stability (Peyret et al. 2015). This heterodimer is referred to as HBche-L2. A dicot plant-optimized HPV16 L2 coding sequence was designed based upon the sequence of GenBank Accession No. CAC51368.1 and synthesized in vitro using synthetic oligonucleotides by the method described (Stemmer et al., 1995). The plant-optimized L2 nucleotide sequence encoding residues 1-473 is posted at GenBank Accession No. KC330735. PCR end-tailoring was used to insert Xbal and SpeI sites flanking the L2 aa 14-122 using primers L2-14-Xba-F (SEQ ID NO. 1: CGTCTAGAGTCCGCAACCCAACTTTACAAG) and L2-122-Spe-R (SEQ ID NO. 2: G GGACTAGTTGGGGCACCAGCATC). The SpeI site was fused to a sequence encoding a 6His tag, and the resulting fusion was cloned into a geminiviral replicon vector (Diamos, 2016) to produce pBYe3R2K2Mc-L2(14-122)6H.
The HBche heterodimer VLP system was adapted from Peyret et al (2015). Using the plant optimized HBc gene (Huang et al., 2009), inventors constructed a DNA sequence encoding a dimer comprising HBc aa 1-149, a linker (G2S)5G (SEQ ID NO. 39), HBc aa 1-77, a linker GT(G4S)2 (SEQ ID NO. 40), HPV-16 L2 aa 14-122, a linker (GGS)2GSSGGSGG (SEQ ID NO. 41), and HBc aa 78-176. The dimer sequence was generated using multiple PCR steps including overlap extensions and insertion of BamHI and SpeI restriction sites flanking the L2 aa 14-122, using primers L2-14-Bam-F (SEQ ID NO. 3: CAGGATCCGCAACC CAACTTTACAAGAC) and L2-122-Spe-R (SEQ ID NO. 2). The HBche-L2 coding sequence was inserted into a geminiviral replicon binary vector pBYR2eK2M (
2. Recombinant Immune Complex
The recombinant immune complex (RIC) vector was adapted from Kim et al., (2015). The HPV-16 L2 (aa 14-122) segment was inserted into the BamHI and SpeI sites of the gene encoding humanized mAb 6D8 heavy chain, resulting in 6D8 epitope-tagged L2. The heavy chain fusion was inserted into an expression cassette linked to a 6D8 kappa chain expression cassette, all inserted into a geminiviral replicon binary vector (
ii. Agroinfiltration of Nicotiana benthamiana Leaves
Binary vectors were separately introduced into Agrobacterium tumefaciens EHA105 by electroporation. The resulting strains were verified by restriction digestion or PCR, grown overnight at 30° C., and used to infiltrate leaves of 5- to 6-week-old N. benthamiana maintained at 23-25° C. Briefly, the bacteria were pelleted by centrifugation for 5 minutes at 5,000 g and then resuspended in infiltration buffer (10 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.5 and 10 mM MgSO4) to OD600=0.2, unless otherwise described. The resulting bacterial suspensions were injected by using a syringe without needle into leaves through a small puncture (Huang et al. 2004). Plant tissue was harvested after 5 DPI, or as stated for each experiment. Leaves producing GFP were photographed under UV illumination generated by a B-100AP lamp (UVP, Upland, CA).
iii. Protein Extraction
Total protein extract was obtained by homogenizing agroinfiltrated leaf samples with 1:5 (w:v) ice cold extraction buffer (25 mM sodium phosphate, pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 10 mg/mL sodium ascorbate, 0.3 mg/mL PMSF) using a Bullet Blender machine (Next Advance, Averill Park, NY) following the manufacturer's instruction. To enhance solubility, homogenized tissue was rotated at room temperature or 4° C. for 30 minutes. The crude plant extract was clarified by centrifugation at 13,000 g for 10 minutes at 4° C. Necrotic leaf tissue has reduced water weight, which can lead to inaccurate measurements based on leaf mass. Therefore, extracts were normalized based on total protein content by Bradford protein assay kit (Bio-Rad) with bovine serum albumin as standard.
iv. SDS-PAGE and Western Blot
Clarified plant protein extract was mixed with sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.02% bromophenol blue) and separated on 4-15% polyacrylamide gels (Bio-Rad). For reducing conditions, 0.5M DTT was added, and the samples were boiled for 10 minutes prior to loading. Polyacrylamide gels were either transferred to a PVDF membrane or stained with Coomassie stain (Bio-Rad) following the manufacturer's instructions. For L2 detection, the protein transferred membranes were blocked with 5% dry milk in PBST (PBS with 0.05% tween-20) overnight at 4° C. and probed with polyclonal rabbit anti-L2 diluted 1:5000 in 1% PBSTM, followed by goat anti-rabbit horseradish peroxidase conjugate (Sigma). Bound antibody was detected with ECL reagent (Amersham).
v. Immunization of Mice and Sample Collection
All animals were handled in accordance to the Animal Welfare Act and Arizona State University IACUC. Female BALB/C mice, 6-8 weeks old, were immunized subcutaneously with purified plant-expressed L2 (14-122), HBche-L2 VLP, L2 RIC, or PBS mixed 1:1 with Imject® Alum (Thermo Scientific, Rockford, IL). In all treatment groups, the total weight of antigen was set to deliver an equivalent 5 μg of L2. Doses were given on days 0, 21, and 42. Serum collection was done as described (Santi et al. 2008) by submandibular bleed on days 0, 21, 42, and 63.
vi. Antibody Measurements
Mouse antibody titers were measured by ELISA. Bacterially-expressed L2 (amino acids 11-128) was bound to 96-well high-binding polystyrene plates (Corning), and the plates were blocked with 5% nonfat dry milk in PBST. After washing the wells with PBST (PBS with 0.05% Tween 20), the diluted mouse sera were added and incubated. Mouse antibodies were detected by incubation with polyclonal goat anti-mouse IgG-horseradish peroxidase conjugate (Sigma). The plate was developed with TMB substrate (Pierce) and the absorbance was read at 450 nm. Endpoint titers were taken as the reciprocal of the lowest dilution which produced an OD450 reading twice the background. IgG1 and IgG2a antibodies were measured with goat-anti mouse IgG1 or IgG2a horseradish peroxidase conjugate.
vii. Electron Microscopy
Purified samples of HBche or HBche-L2 were initially incubated on 75/300 mesh grids coated with formvar. Following incubation, samples were briefly washed twice with deionized water then negatively stained with 2% aqueous uranyl acetate. Transmission electron microscopy was performed with a Phillips CM-12 microscope, and images were acquired with a Gatan model 791 CCD camera.
viii. Statistical Analysis
The significance of vaccine treatments and virus neutralization was measured by non-parametric Mann-Whitney test using GraphPad prism software. Two stars (**) indicates p values <0.05. Three stars (***) indicates p values <0.001.
b. Design and Expression of HBc VLPs and RIC Displaying HPV16 L2
BeYDV plant expression vectors (
To express L2-containing MC, amino acids 14-122 of HPV16 L2 were fused with linker to the C-terminus of the 6D8 antibody heavy chain and tagged with the 6D8 epitope (Kim et al. 2015). A BeYDV vector (
After rigorous genetic optimization, the N. benthamiana system is capable of producing very high levels of recombinant protein, up to 30-50% of the total soluble plant protein, in 4-5 days (Diamos et al. 2016). Using this system, we produced and purified milligram quantities of fully assembled and potently immunogenic HBc VLPs displaying HPV L2 through a simple one-step purification process (
c. Purification and Characterization of HBche-L2 and L2 RIC
To assess the assembly of HBc-L2 VLP, clarified plant extracts containing either HBche-L2 or HBche were analyzed by sucrose gradient sedimentation. HBche-L2 sedimented largely with HBche, which is known to form VLP, though a small increase in density was observed with HBche-L2, perhaps due to the incorporation of L2 into the virus particle (
L2 RIC was purified from plant tissue by protein G affinity chromatography. By SDS-PAGE, an appropriately sized band was visible >150 kDa that was highly pure (
d. Mouse Immunization with HBche-L2 and L2 RIC
Groups of Balb/c mice (n=8) were immunized, using alum as adjuvant, with three doses each of 5 μg L2 delivered as either L2 alone, HBche-L2 VLP, L2 RIC, or a combination of half VLP and half RIC. VLP and RIC, alone or combined, greatly enhanced antibody titers compared to L2 alone by more than an order of magnitude at all time points tested (
In vitro neutralization of HPV16 pseudovirions showed that the VLP and RIC groups greatly enhanced neutralization compared to L2 alone (
In this study, by displaying amino acids 11-128 on the surface of plant-produced HBc VLPs, L2 antibody titers as high as those seen with L1 vaccines were generated (
Mice immunized with L2 alone had highly variable antibody titers, with titers spanning two orders of magnitude. By contrast, the VLP and VLP/RIC groups had much more homogenous antibody responses, with no animals below an endpoint titer of 1:1,000,000 (
Fc gamma receptors are present on immune cells and strongly impact antibody effector functions such as antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity (Jefferis 2009). In mice, these interactions are controlled in part by IgG subtypes. IgG1 is associated with a Th2 response and has limited effector functions. By contrast, IgG2a is associated with a Th1 response and more strongly binds complement components (Neuberger and Raj ewsky 1981) and Fc receptors (Radaev 2002), enhancing effector functions and opsonophagocytosis by macrophages (Takai et al. 1994). Immunization with L2 alone was found to produce low levels of IgG2a, however immunization with RIC and VLP produced significant increases in IgG2a titers. VLP-containing groups in particular showed a 3-fold increase in the ratio of IgG2a to IgG1 antibodies (
The glycosylation state of the Fc receptor also plays an important role in antibody function. Advances in glycoengineering have led to the development of transgenic plants with silenced fucosyl- and xylosyl-transferase genes capable of producing recombinant proteins with authentic human N-glycosylation (Strasser et al. 2008). Antibodies produced in this manner have more homogenous glycoforms, resulting in improved interaction with Fc gamma and complement receptors compared to the otherwise identical antibodies produced in mammalian cell culture systems (Zeitlin et al. 2011; Hiatt et al. 2014; Strasser et al. 2014; Marusic et al. 2017). As the known mechanisms by which RIC vaccines increase immunogenicity of an antigen depend in part on Fc and complement receptor binding, HPV L2 RIC were produced in transgenic plants with silenced fucosyl- and xylosyl-transferase. Consistent with these data, we found that L2 RIC strongly enhanced the immunogenicity of L2 (
e. Neutralization of HPV Pseudovirions
Neutralization of papilloma pseudoviruses (HPV 16, 18, and 58) with sera from mice immunized IP with HBc-L2 VLP and L2(11-128) showed neutralization of HPV 16 at titers of 400-1600 and 200-800, respectively (Table 1). More mice IP-immunized with HBc-L2 VLP had antisera that cross-neutralized HPV 18 and HPV 58 pseudoviruses, compared with mice immunized with L2(11-128). Anti-HBc-L2 VLP sera neutralized HPV 18 at titers of 400 and HPV 58 at titers ranging from 400-800 (Table 1), while anti-L2(11-128) sera neutralized HPV 18 at a titer of 200 and HPV 58 at a titer of 400 (Table 1). None of the sera from intranasal-immunized mice demonstrated neutralizing activity, consistent with lower anti-L2 titers for intranasal than for intraperitoneal immunized mice.
Example 4
ASOs also are being evaluated therapeutically for another form of muscle disease, Duchenne muscular dystrophy (DMD), to modify dystrophin pre-mRNA splicing directly by inducing skipping of a target exon to restore the open reading frame and produce a truncated, partially functional protein27, 28. Detection of therapeutic drug effects in DMD patients involves multiple muscle biopsies to examine splicing outcomes and dystrophin protein production. To test whether biofluid exRNA contains DMD deletion transcripts, we examined urine from several subjects with DMD and found patient-specific DMD deletion transcripts (
Example 1
Adult fish were raised and maintained as described in [28] and in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals by University of Southern California, where the protocol was approved by the Institutional Animal Care and Use Committee (IACUC) (Permit Number: 12007 USC). Transgenic FlipTrap Gt(desm-citrine)ct122a/+ line was obtained from a previously described screen in the lab [23], Tg(kdrl:eGFP)s843 line [24] was provided by the Stainier lab, and Tg(ubiq:membrane-Cerulean-2a-H2B-tdTomato) line was generated by injecting a construct containing tol2 transposable elements flanking the ubiquitin promoter, coding sequence for membrane localized cerulean, a short sequence encoding the ribosome-skipping peptide of Thosea asigna virus (2a) followed by H2B-tdTomato. Upon crossing appropriate adult lines, the embryos obtained were raised in Egg Water (about 60 μg/ml of Instant Ocean and about 75 μg/ml of CaSO4 in Milli-Q water) at about 28.5° C. with addition of about 0.003% (w/v) 1-phenyl-2-thiourea (PTU) about 18 hpf to reduce pigment formation [28].
Example 2
CAR-T constructs in pLenti6.3/V5-DEST were purified using the PureLink HQ plasmid purification kit (Life Technology). CAR-T plasmids were lipofected into 293-FT cells with ViraPower packaging plasmids (Life Technologies) according to the manufacturer's protocol. After 48-72 hours, cell supernatant containing live Lentivirus was harvested. Optionally, the virus was concentrated using Lenti-X Concentrator (Clontech), according to the manufacturer's protocol.
Jurkat E6.1 cells were grown in RPMI (Sigma), 10% foetal bovine serum, 2 mM L-glutamine
Jurkat E6.1 cells were transduced for 48-72 hours with viral supernatant in a 50:50 mix of HEK cell supernatant:Jurkat medium: cells at a final concentration of 5×105/ml.
A non-CAR-T construct containing the open reading frame of the Green Fluorescent Protein (GFP) was included as a control. Note that this construct gives cytoplasmic expression.
Top products related to «Open Reading Frames»
More about "Open Reading Frames"
ORFs are a crucial concept in genetics and genomics, as they allow researchers to identify and study the protein-coding regions within a genome.
Discover the power of ORFs with PubCompare.ai, an AI-driven platform that enhances reproducibility and research accuracy.
This cutting-edge technology helps scientists locate protocols from literature, preprints, and patents, and uses AI-driven comparisons to identify the best protocols and products for their research needs.
ORFs are closely related to other important genetic and molecular biology concepts, such as open reading frame analysis, coding sequences (CDS), gene annotation, transcription and translation, Lipofectamine 2000 and Lipofectamine 3000 transfection reagents, pGEM-T Easy vector for cloning, Dual-Luciferase Reporter Assay System for gene expression analysis, pcDNA3.1 expression vector, TRIzol reagent for RNA extraction, and the In-Fusion HD Cloning Kit for seamless cloning.
Elevate your research with PubCompare.ai's streamlined workflow and expereince the future of scientific research today.
Unlock the full potential of ORFs and enhance the reproducibility and accuracy of your studies.