Log In Sign up
The largest database of trusted experimental protocols
> Genes & Molecular Sequences > Gene or Genome > Operon

Operon

An operon is a fundamental unit of genetic organization found in bacteria and archaea, consisting of a cluster of genes that are transcribed into a single mRNA molecule.
This coordinated expression allows for efficient regulation of related genes involved in a specific metabolic pathway or cellular process.
Operons play a crucial role in the adaptability and survival of prokaryotic organisms, enabling them to rapidly respond to changes in their environment.
Understanding the structure and function of operons is essential for unraveling the complex regulatory networks that govern microbial physiology and behavior.
Researchers can leverage the power of AI-driven tools like PubCompare.ai to optimize their operon-related experiments, easily accessing relevant protocols and identifying the most effective and reproducible approaches for their studies.

Most cited protocols related to «Operon»

1
ZIKV 2007 Strain Real-Time PCR Assay
Two real-time primer/probe sets specific for the ZIKV 2007 strain were designed by using ZIKV 2007 nucleotide sequence data in the PrimerExpress software package (Applied Biosystems, Foster City, CA, USA). Primers were synthesized by Operon Biotechnologies (Huntsville, AL, USA) with 5-FAM as the reporter dye for the probe (Table 3). All real-time assays were performed by using the QuantiTect Probe RT-PCR Kit (QIAGEN, Valencia, CA, USA) with amplification in the iCycler instrument (Bio-Rad, Hercules, CA, USA) following the manufacturer’s protocol. Specificity of the ZIKV primers was evaluated by testing the following viral RNAs, all of which yielded negative results: DENV-1, DENV-2, DENV-3, DENV-4, WNV, St. Louis encephalitis virus, YFV, Powassan virus, Semliki Forest virus, o’nyong-nyong virus, chikungunya virus, and Spondweni virus (SPOV).
Sensitivity of the ZIKV real-time assay was evaluated by testing dilutions of known copy numbers of an RNA transcript copy of the ZIKV 2007 sequence. Copy numbers of RNA were determined by using the Ribogreen RNA-specific Quantitiation Kit (Invitrogen) and the TBE-380 mini-fluorometer (Turner Biosystems, Sunnyvale, CA, USA). RNA transcripts ranging from 16,000 to 0.2 copies were tested in quadruplicate to determine the sensitivity limit and to construct a standard curve for estimating the genome copy number of ZIKV in patient samples. All serum samples obtained during the epidemic were tested for ZIKV RNA by using this newly designed real-time RT-PCR. Concentration of viral RNA (copies/milliliter) was estimated in ZIKV-positive patients by using the standard curve calculated by the iCycler instrument (Table 4). All RT-PCR–positive specimens were placed on monolayers of Vero, LLC-MK2, and C6/36 cells to isolate virus; no specimens showed virus replication.
Lanciotti R.S., Kosoy O.L., Laven J.J., Velez J.O., Lambert A.J., Johnson A.J., Stanfield S.M, & Duffy M.R. (2008). Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007. Emerging Infectious Diseases, 14(8), 1232-1239.
Full text: Click here
Publication 2008
Base Sequence Biological Assay Cells Chikungunya virus Encephalitis Viruses Epidemics Genome Hypersensitivity Oligonucleotide Primers Operon Patients Powassan virus Real-Time Polymerase Chain Reaction Reverse Transcriptase Polymerase Chain Reaction RNA, Viral RNA Sequence Semliki forest virus Serum Strains Technique, Dilution Virus Virus Replication Zika Virus
2
Construction and Curation of Eukaryotic SSU rRNA Database
The construction of this database started >10 years ago, and our procedure has been optimized over time (for more details, recent history detailed at http://ssu-rrna.org/method.html). Here, we briefly describe the present general architecture of the database.
Entries containing at least one partial SSU rRNA gene sequence of eukaryotic origin are retrieved from three public databases using keywords. Our last update retrieved 484.657, 496.462 and 123 such entries from GenBank, EMBL and WGS-EMBL, respectively. An INSDC (http://www.insdc.org/) entry as defined by its accession number in public databases may contain several rRNA gene sequences, e.g. in long genomic fragments containing several partial or complete ribosomal operons. To allow such duplicated sequences within a single entry, each sequence was given a unique identifier, acc.p1.p2, where acc is the accession number of the entry containing the sequence, and p1 and p2 are the first and last positions of the sub-sequence within the complete sequence.
A majority of extracted sequences were shorter than 100 nucleotides or around 500 nucleotides (63% of retrieved sequences), likely resulting from the recent integration of short environmental sequences derived from clone libraries. Only sequences longer than 799 nt were considered.
The first step was the identification of sequences originating from organelles. A reference database of SSU-rRNA gene sequences from chloroplasts and mitochondria was constructed using entire genomes or genomic fragments that contained a SSU-rRNA gene sequence and a protein-coding gene specific either of mitochondria or of chloroplasts. For derived-organelle sequences such as apicoplasts, hydrogenosomes and nucleomorphs, databases were manually built, using information found in scientific publications. These databases were used to determine by sequence similarity the origin of every sequence in the database. These sequences were assigned to a reduced taxonomic framework, including their location (such as: |Organelle|chloro-SSU| or |Organelle|mito-SSU|). These sequences are not more detailed in the database.
Introns were found to be a major problem in eukaryotic rRNA sequences compared with prokaryotic sequences (1536 sequences with intron(s) described, 10 644 sequences with introns found by computation). A dedicated C++ algorithm was developed to identify the presence of introns in the remaining sequences (9 ). When detected, sequences with and without the intron(s) were generated (rRNA and rDNA sequences).
Sequences in the PR2 database are assigned an identifier in the form accession.p1.p2_X, where accession is the accession number of an entry, p1 and p2 are the positions of this sequence in a larger genomic entry and X corresponding to introns treatment of the sequence [X = G: genomic sequence containing a described intron (rDNA); X = R: the previous genomic rRNA sequence, without the intron(s); X = U: no intron described, but intron(s) may be present; X = UC: introns were detected in silico and removed from the sequence (putative rRNA)].
Guillou L., Bachar D., Audic S., Bass D., Berney C., Bittner L., Boutte C., Burgaud G., de Vargas C., Decelle J., del Campo J., Dolan J.R., Dunthorn M., Edvardsen B., Holzmann M., Kooistra W.H., Lara E., Le Bescot N., Logares R., Mahé F., Massana R., Montresor M., Morard R., Not F., Pawlowski J., Probert I., Sauvadet A.L., Siano R., Stoeck T., Vaulot D., Zimmermann P, & Christen R. (2012). The Protist Ribosomal Reference database (PR2): a catalog of unicellular eukaryote Small Sub-Unit rRNA sequences with curated taxonomy. Nucleic Acids Research, 41(Database issue), D597-D604.
Publication 2012
Apicoplasts Chloroplasts Clone Cells DNA, Ribosomal Eukaryota Genes Genes, Mitochondrial Genome Introns Mitochondria Mitomycin Multiple Birth Offspring Nucleotides Operon Organelles Prokaryotic Cells Ribosomal RNA Ribosomal RNA Genes Ribosomes Staphylococcal Protein A
3
Microarray Analysis of Differential Gene Expression
The two real datasets were performed using Qiagen-Operon's mus musculus version 1.1 70-mer oligonucleotide library, representing 13,664 annotated transcripts. The first dataset is a simple comparison of wildtype mouse embryo fibroblast (MEF) cells to Ahr-/- MEF cells. A similar microarray comparison performed with mouse smooth muscle cells has previously been published [16 (link)-18 (link)]. The second dataset has been published [19 (link)], but we summarize the methods below. RNA quality for both experiments was assessed by separation with a denaturing formaldehyde/agarose/ethidium bromide gel, and quantified by analysis with an Agilent Bioanalyzer (Quantum Analytics, Inc., Foster City, CA). To examine differential gene expression, a 70-mer oligonucleotide library, representing 13,443 mouse genes (Operon Biotechnologies, Inc., Huntsville, AL), was used by the Genomic and Microarray Laboratory, Center for Environmental Genetics, University of Cincinnati, was used to fabricate microarrays. The microarray hybridisations were carried out as described [16 (link),18 (link)]. For the AHR experiment, each biological replicate consisted of one mouse cell culture, and for the Ni-treatment experiment, each exposure group consisted of nine mice. RNA from three mice was pooled for each microarray, and three separate microarrays per exposure group were compared to non-exposed controls. Both experiments were performed using 20 μg total RNA per array. Each sample of mRNA was reverse transcribed and tagged with either fluorescent Cyanine 3 (Cy3) or Cyanine 5 (Cy5) (e.g., Cy3 forcontrol and Cy5 for72-h exposure). Cy3 and Cy5 samples were co-hybridized with the printed 70-mers. Following hybridization, slides were washed and scanned at 635 (Cy5) and 532 (Cy3) nm (GenePix 4000B, Axon Instruments, Inc., Union City, CA).
Sartor M.A., Tomlinson C.R., Wesselkamper S.C., Sivaganesan S., Leikauf G.D, & Medvedovic M. (2006). Intensity-based hierarchical Bayes method improves testing for differentially expressed genes in microarray experiments. BMC Bioinformatics, 7, 538.
Full text: Click here
Publication 2006
Axon Biopharmaceuticals cDNA Library Cell Culture Techniques Crossbreeding DNA Replication Embryo Ethidium Bromide Fibroblasts Formaldehyde Gene Expression Genes Genome GPER protein, human Mice, House Microarray Analysis Mus Myocytes, Smooth Muscle Oligonucleotides Operon RNA, Messenger Sepharose Therapies, Investigational
4
Engineered Canthaxanthin Biosynthesis Pathway
A DNA fragment containing genes for canthaxanthin biosynthesis was made by PCR amplification of 4 genes from Pantoea ananatis that are necessary for biosynthesis of β-carotene (genes crtE, crtY, crtI and crtB) [20] (link) and of one gene from Agrobacterium aurantiacum (crtW) necessary to convert β-carotene to canthaxanthin [21] (link). crtW is used in addition to the 4 Pantoea genes because the orange/red color of canthaxanthin is more visible on agar plates than the yellow color of β-carotene. The Pantoea ananatis strain was obtained from the DSMZ (cat. DSM 30080), and a fragment containing crtW was synthesized by Mr. Gene GmbH (Regensburg, Germany). An artificial operon containing crtE-W-Y-I-B under control of the P. ananatis native promoter was made by ligation of three fragments derived from PCR: fragment 1 containing the promoter and crtE was amplified from P. ananatis genomic DNA with primers 5′-ttt ggtctc a ggag ggtaccgcacggtctgccaa and 5′-ttt ggtctc a tcatgcagcatccttaactgacggcag, fragment 2 containing crtW was amplified from a synthetic DNA fragment (sequence identical to the native sequence) with primers 5′-ttt ggtctc a atgagcgcacatgccctgcc and 5′-ttt ggtctc a tcactcatgcggtgtcccccttggt, and fragment 3 containing crtY-I-B was amplified from P. ananatis DNA using primers 5′-ttt ggtctc a gtgacttaagtgggagcggctatg and 5′-ttt ggtctc a atgtagtcgctctttaacgatgag. The fragments were assembled by Golden Gate cloning in a target vector using BsaI. Two BpiI and one Esp3I site present in crtY were removed using primers containing silent mutations in the recognition sites.
Weber E., Engler C., Gruetzner R., Werner S, & Marillonnet S. (2011). A Modular Cloning System for Standardized Assembly of Multigene Constructs. PLoS ONE, 6(2), e16765.
Full text: Click here
Publication 2011
Agar Agrobacterium aurantiacum Anabolism Canthaxanthin Carotene Cloning Vectors DNA, A-Form Gene Amplification Genes Genes, vif Genome Ligation Oligonucleotide Primers Operon Pantoea Pantoea ananatis Silent Mutation Strains
5
Plasmid Construction via Homologous Recombination
The plasmids used in this study are listed in Supplementary Table S1. All the primers and the PCR amplified fragments used for plasmids construction are given in Supplementary Table S2.
The promoter Pkat that constitutively expresses the kanamycin resistant gene from pKD4 and the egfp gene from pCL1920-eGFP were cloned into pBluescript SK- at the SmaI site to obtain pSK::eGFP, in which egfp is under the control of Pkat. The Pkat-eGFP fragment was used as the template for PCR to introduce 30-, 20-, 15-, 9- and 6-bp homologous ends to the SmaI-digested pBluescript SK- (SmaI-pSK). These fragments were cloned into SmaI-pSK with the TEDA method.
The phbCAB operon from pBHR68 was cut by NisI and XhoI and ligated into p5TG to form p5TG::phbCAB (18 ,19 (link)). The phbCAB under the control of five tac promoters (5Ptac-phbCAB) from p5TG::phbCAB was amplified via PCR as one fragment (4.3 kb), two fragments (2.8 kb/1.7 kb and 1.4 kb/3.1 kb), or three fragments (1.4, 1.4 and 1.7 kb) with 20-bp homologous ends to adjacent fragments or to SmaI-pSK. These fragments were assembled with SmaI-pSK to produce pSK::5Ptac-phbCAB by using TEDA.
5Ptac-phbCAB was also cloned into the PCR-amplified pBBR1MCS-2 to produce pBBR1MCS2::5Ptac-phbCAB by using TEDA. A TAA stop codon was inserted into phbC gene to obtain pBBR1MCS::5Ptac-phbCAB_TAA encoding a truncated and inactive PhbC. Similarly, pBBR1MCS2::5Ptac-phbCAB_2TAA contained a TAA insertion in both phbC and phbB, and pBBR1MCS2::5Ptac-phbCAB_3TAA contained a TAA insertion in phbC, phbB, and phbA. The TAA stop codons from these three plasmids were removed by using TEDA to test for SDM at single or multiple sites.
The trc promoter (Ptrc) from pTrc99a and the lacZ gene from MG1655 genome were cloned into PCR-amplified pBBR1MCS-5 and pCL1920 to obtain pMCS5::Ptrc-lacZ and pCL1920::Ptrc-lacZ, respectively, with the lac promoter in the original plasmids being removed. The lacZ gene was also cloned into PCR-amplified pBluescript SK- to get pSK::Plac-lacZ. The middle region of lacZ was removed from these three plasmids to obtain the truncated lacZ. Then, the middle region of lacZ was cloned back into these three PCR-amplified plasmids to produce the functional lacZ by using TEDA.
The kanamycin-resistant gene with its promoter sequence from pKD4 was amplified and treated with SmaI to generate the Kan-SmaI fragment. Kan-SmaI was ligated into pBluescript SK- at the SmaI site to obtain pSK-Kan. Then, the pSK-Kan plasmid was cut with SmaI, KpnI-SacI or HindIII-XbaI to produce three linearized vectors with blunt ends, 5′-overhangs (5′Oh) or 3′-overhangs (3′Oh), named as pSK-blunt, pSK-5′Oh, and pSK-3′Oh, respectively. The Pkat-eGFP fragment from pSK::eGFP was amplified with different primers to generate Pkat-eGFP-blunt, Pkat-eGFP-5′Oh and Pkat-eGFP-3′Oh, containing ends that were homologous to the ends of pSK-blunt, pSK-5′Oh, and pSK-3′Oh, respectively. To generate 20-bp homologous arms of Pkat-eGFP-5′Oh and Pkat-eGFP-3′Oh, the 4-bp overhangs were either added into the homologous arms or not to generate Pkat-eGFP-5′Oh-4bp-plus and Pkat-eGFP-3′Oh-4bp-plus or Pkat-eGFP-3′Oh-4bp-minus and Pkat-eGFP-3′Oh -4bp-minus. Further, 9-bp homologous arms of Pkat-eGFP-5′Oh-plus and Pkat-eGFP-3′Oh-plus were also generated. These inserts were assembled with pSK-5′Oh and pSK-3′Oh, respectively.
Xia Y., Li K., Li J., Wang T., Gu L, & Xun L. (2018). T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis. Nucleic Acids Research, 47(3), e15.
Publication 2018
4-hydroxybenzylcyanide 5'-palmitoyl cytarabine Arm, Upper Autosomal Recessive Polycystic Kidney Disease Cloning Vectors Genes Genome HMN (Hereditary Motor Neuropathy) Proximal Type I Kanamycin LacZ Genes Ochre Stop Codon Oligonucleotide Primers Operon Plasmids Promoter, Genetic

Most recents protocols related to «Operon»

1
Engineered Alginate Production in P. aeruginosa
Not available on PMC !

Example 2

PAO1, the parent strain of PGN5, is a wild-type P. aeruginosa strain that produces relatively small amounts of alginate and exhibits a non-mucoid phenotype; thus, PGN5 is also non-mucoid when cultured (FIG. 3A). In PAO1, the alginate biosynthetic operon, which contains genes required for alginate production, is negatively regulated. Activation of this operon leads to alginate production and a mucoid phenotype. For example, over-expression of mucE, an activator of the alginate biosynthetic pathway, induces a strong mucoid phenotype in the PAO1 strain (e.g., P. aeruginosa strain VE2; FIG. 3B). The plasmid pUCP20-pGm-mucE, which constitutively over-expresses MucE, was used to test whether the genetically-modified PGN5 strain could produce alginate. Indeed, the presence of this plasmid in PGN5 (PGN5+mucE) induced a mucoid phenotype (FIG. 3B). To measure the amount of alginate produced by PGN5+mucE on a cellular level, a standard carbazole assay was performed, which showed that the PGN5+mucE and VE2 (i.e., PAO1+mucE) strains produce comparable amounts of alginate (FIG. 3C; 80-120 g/L wet weight).

To examine whether the alginate produced by PGN5+mucE was similar in composition to alginate produced by VE2, HPLC was performed to compare the M and G content of alginate produced by each strain. The chromatograms obtained from alginate prepared from VE2 and PGN5+mucE were identical (FIG. 3D), and the M:G ratios were comparable to a commercial alginate control (data not shown). To confirm that the physical properties of VE2 and PGN5+mucE alginates were also similar, alginate gels were prepared from alginate produced by each strain and the viscosity and yield stress was measured. The viscosities of VE2 and PGN5+mucE alginate gels were comparable at 73.58 and 72.12 mPa, respectively (FIG. 3E). Similarly, the yield stress of VE2 and PGN5+mucE alginate gels were comparable at 47.34 and 47.16 Pa, respectively (FIG. 3G).

US11873477B2. Bacterial cultures and methods for production of alginate (2024-01-16). Marshall University Research Corporation [US]. Inventors: Hongwei D. Yu [US], Meagan E. Valentine [US], Richard M. Niles [US], Thomas Ryan Withers [US], Brandon D. Kirby [US].
Full text: Click here
Patent 2024
Alginate Alginates Anabolism Biological Assay Biosynthetic Pathways carbazole Cells Gels Genes High-Performance Liquid Chromatographies Operon Parent Phenotype Physical Processes Plasmids Pseudomonas aeruginosa Strains Viscosity
2
Localization and Mortality in Mucoidal Strains
Not available on PMC !

Example 4

Since no mortality was observed in mice injected with PGN5+mucE, it was determined whether cells of this strain might localize differently than VE2 cells within the mice post-injection. To test this, the luxCDABEG operon was used to tag each strain with bioluminescence. VE2 and PGN5+mucE both carry gentamicin resistance genes, while the plasmids used for labeling with bioluminescence required gentamicin sensitivity. Thus, the luxCDABEG operon was incorporated into the chromosome of PAO1 and PGN5, and then the pUCP20-pGm-mucE plasmid was introduced into each strain to induce alginate production and mucoidy. Intraperitoneal injection of C57BL/6 mice with bioluminescent PAO1+mucE showed either localization at the injection site or dissemination through the body, and lethality resulted in all mice injected (FIGS. 5A-5B). Conversely, localization at the injection site but no dissemination was observed with bioluminescent PGN5+mucE, and no mortality was observed in injected mice (FIGS. 5C-5D).

US11873477B2. Bacterial cultures and methods for production of alginate (2024-01-16). Marshall University Research Corporation [US]. Inventors: Hongwei D. Yu [US], Meagan E. Valentine [US], Richard M. Niles [US], Thomas Ryan Withers [US], Brandon D. Kirby [US].
Full text: Click here
Patent 2024
Alginate Cells Chromosomes Cultured Cells Figs Genes Gentamicin Human Body Hypersensitivity Injections, Intraperitoneal Mice, Inbred C57BL Mus Operon Plasmids Strains
3
Comparative Analysis of Aerobactin-Harboring Plasmids
The 16 aerobactin-harbouring plasmids, in addition to the three reference plasmids mentioned above, were compared to two plasmids from previous studies that investigated K. pneumoniae harbouring aerobactin in pigs [12, 15 (link)]. However, only short reads were available from these studies. Therefore, these were compared to the rest of the above sequences on a gene level. Reads from one sample from each study (accession numbers SAMN07319199 and ERR3932286 for Germany and Italy, respectively) were downloaded and quality-checked before being assembled as described above. The draft genomes were subjected to VirulenceFinder, using the extended database, to identify the contig harbouring aerobactin. This contig was subsequently annotated using Bakta. The genetic neighbourhood of the aerobactin operon was manually scanned using the gff3 file from the annotation for all the 21 sequences. Potential composite transposons and other mobile elements were detected by using MobileElementFinder [43 (link)] version 1.0.3, database version 1.0.2, and the results were compared to the manual investigation. The detected composite transposon harbouring the aerobactin operon was extracted from the plasmid fasta sequence using Seqkit, and annotated with Bakta as described above, excluding the --circular option. ISFinder [44 (link)] blast was used to characterize the potential insertion sequence (IS) elements flanking the putative composite transposon. The IS elements that were closest to the genetic coordinates of the putative composite transposons were selected. If ties occurred, the highest scoring result was selected based on the blast results.
To confirm the presence of the composite transposon in the aerobactin-harbouring samples that were not long-read sequenced, the raw reads were mapped to a representative sequence of the composite transposon. This was performed in the Ellipsis pipeline by mapping with bwa [45 (link)] version 0.7.17 and SAMtools [46 (link)] version 1.9.
To determine the phylogenetic relationship between the composite transposons, ParSNP [47 (link)] version 1.6.1 was used to generate an alignment, using one of the input sequences as a reference at random, followed by a phylogenetic inference with iq-tree with the same settings as described above. Snp-dists was used to generate SNP distances from the ParSNP alignment.
Kaspersen H., Franklin-Alming F.V., Hetland M.A., Bernhoff E., Löhr I.H., Jiwakanon J., Urdahl A.M., Leangapichart T, & Sunde M. (2023). Highly conserved composite transposon harbouring aerobactin iuc3 in Klebsiella pneumoniae from pigs. Microbial Genomics, 9(2), mgen000960.
Full text: Click here
Publication 2023
aerobactin Genes Genome Insertion Sequence Elements Jumping Genes Klebsiella pneumoniae Operon Pigs Plasmids Trees
4
Kleborate-based Bacterial Typing and Characterization
Kleborate [20 (link)] version 2.1.0 was used to identify the exact species and sequence types (STs) of the isolates, as well as the presence of virulence and resistance genes. Kleborate also reports the STs of each virulence operon, e.g. aerobactin ST (AbST) and yersiniabactin ST (YbST). The species assignment of the isolates from Thailand was performed previously [16 (link)], while the virulence and resistance gene detection and multilocus sequence typing were carried out in the current study with Kleborate version 2.1.0.
Kaspersen H., Franklin-Alming F.V., Hetland M.A., Bernhoff E., Löhr I.H., Jiwakanon J., Urdahl A.M., Leangapichart T, & Sunde M. (2023). Highly conserved composite transposon harbouring aerobactin iuc3 in Klebsiella pneumoniae from pigs. Microbial Genomics, 9(2), mgen000960.
Full text: Click here
Publication 2023
aerobactin Genes heat-stable enterotoxin (Yersinia) Operon Virulence yersiniabactin
5
In Silico Subtyping of Shiga Toxin Genes in Genomes

stx operons in the closed genomes were subtyped by aligning their sequences against the previously published collection of stx operons [10 (link)]. The Stx subtypes of 17 strains were clearly determined, as their stx operons showed exact sequence matches to some reference stx operons in the collection. Although the remaining 18 genomes showed no exact match, they were typed as stx2a because their stx operons differ from one of the reference stx2a operons only by one synonymous SNP (129 G>A).
For detection and subtyping of stx1 in draft genomes, trimmed reads were mapped to the stx1a operons of four O157:H7 strains [Sakai, clade 1; FDAARGOS_293 (accession no. CP022050.2), clade 4/5; PV15-279 (AP018488.1), clade 9; and 180-PT54 (CP015832.1), clade 7] by bwa-mem with default parameters. SAM files of top-hit reads to each reference were entered into a custom script (GitHub – https://github.com/IEkAdN/Type) to report ‘homology’ and ‘coverage’. The homology value was determined by calculating the proportion of exact matches at each base position in each reference sequence using top-hit reads and averaging the values across the reference sequence covered by top-hit reads. The coverage value represents the proportion of sequences covered by top-hit reads in the reference sequence. As the sequence similarities between the stx1a and stx1c operons and between the stx1a and stx1d operons in the reference collection [10 (link)] were calculated to be 96 and 91 %, respectively, we defined a strain as possessing an stx1 variant when its homology and coverage were both≥99 %. stx1 variants other than stx1a were not detected in the dataset analysed in this study even with lower thresholds.
stx2 operons in draft genomes were examined and subtyped using the same strategy. Because two different stx2 operon sequences were found for each of the stx2a or stx2c operons in the closed clade 8 genomes, four stx2 operons were used as references representing each sequence type: stx2a from strains TW14359 (SG8_30) and 08–3918 (SG8_33) and stx2c from strains TW14359 (SG8_30) and 08–3914 (SG8_31). However, the intersubtype nucleotide sequence identities between these stx2a and stx2c operons were≥98.2 %; those between the stx2a and stx2c operons in the reference collection [10 (link)] were≥97.4 %, leading to frequent cross-mapping of reads between the two stx2 subtypes. Therefore, exact-match reads were selected by the BamTools filter [45 (link)] using the option ‘NM:0’, and stx2 subtypes were assigned when such exact-match reads covered the entire sequence of any of the four references (100 % coverage). Results with any ambiguity were checked by manual inspection using igv. Note that any SNPs indicating the presence of stx2 subtypes other than stx2a and stx2c were not detected, and that short-read assembly is often unable to obtain full-length stx operons when a genome contained both stx2a and stx2c operons or multiple stx2a operons owing to high sequence similarity.
Miyata T., Taniguchi I., Nakamura K., Gotoh Y., Yoshimura D., Itoh T., Hirai S., Yokoyama E., Ohnishi M., Iyoda S., Ogura Y, & Hayashi T. (2023). Alteration of a Shiga toxin-encoding phage associated with a change in toxin production level and disease severity in Escherichia coli. Microbial Genomics, 9(2), mgen000935.
Full text: Click here
Publication 2023
Base Sequence Genome Operon Single Nucleotide Polymorphism STX2 protein, human

Top products related to «Operon»

1
Rneasy mini kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Japan, Canada, France, China, Australia, Italy, Switzerland, Sweden, Belgium, Denmark, India, Jamaica, Singapore, Poland, Lithuania, Brazil, New Zealand, Austria, Hong Kong, Portugal, Romania, Cameroon, Norway
The RNeasy Mini Kit is a laboratory equipment designed for the purification of total RNA from a variety of sample types, including animal cells, tissues, and other biological materials. The kit utilizes a silica-based membrane technology to selectively bind and isolate RNA molecules, allowing for efficient extraction and recovery of high-quality RNA.
2
Trizol reagent by Thermo Fisher Scientific
Sourced in United States, China, Japan, Germany, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Netherlands, Belgium, Lithuania, Denmark, Singapore, New Zealand, India, Brazil, Argentina, Sweden, Norway, Austria, Poland, Finland, Israel, Hong Kong, Cameroon, Sao Tome and Principe, Macao, Taiwan, Province of China, Thailand
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of the RNA while disrupting cells and dissolving cell components.
3
Oligonucleotides by Eurofins
Sourced in Germany, United States, Japan
Oligonucleotides are short, synthetic DNA or RNA molecules that are used as building blocks in various biotechnology and molecular biology applications. They serve as probes, primers, and templates for a wide range of techniques, including DNA sequencing, gene expression analysis, and diagnostic assays.
4
Qiaquick pcr purification kit by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, France, Japan, China, Canada, Italy, Australia, Switzerland, Singapore, Sweden, India, Malaysia
The QIAquick PCR Purification Kit is a lab equipment product designed for the rapid purification of PCR (Polymerase Chain Reaction) amplicons. It utilizes a silica-membrane technology to efficiently capture and purify DNA fragments from PCR reactions, removing unwanted primers, nucleotides, and enzymes.
5
T4 dna ligase by New England Biolabs
Sourced in United States, China, United Kingdom, Germany, Japan, France, Canada, Morocco, Switzerland, Australia
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in DNA. It is commonly used in molecular biology for the joining of DNA fragments.
6
Qiaquick gel extraction kit by Qiagen
Sourced in Germany, United States, Netherlands, United Kingdom, Japan, Canada, France, Spain, China, Italy, India, Switzerland, Austria, Lithuania, Sweden, Australia
The QIAquick Gel Extraction Kit is a product designed for the purification of DNA fragments from agarose gels. It efficiently extracts and purifies DNA from gel slices after electrophoresis.
7
Superscript 3 by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Japan, Australia, Canada, China, France, Spain, Netherlands, Lithuania, Switzerland, Belgium, Italy
Superscript III is a reverse transcriptase enzyme produced by Thermo Fisher Scientific. It is designed for cDNA synthesis from RNA templates during the process of reverse transcription.
8
Trizol by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, United Kingdom, Canada, France, Italy, Australia, Spain, Switzerland, Belgium, Denmark, Netherlands, India, Ireland, Lithuania, Singapore, Sweden, Norway, Austria, Brazil, Argentina, Hungary, Sao Tome and Principe, New Zealand, Hong Kong, Cameroon, Philippines
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for the isolation of total RNA from various biological samples. It is a reagent designed to facilitate the disruption of cells and the subsequent isolation of RNA.
9
Iscript cdna synthesis kit by Bio-Rad
Sourced in United States, Germany, Italy, Canada, United Kingdom, France, Netherlands, Switzerland, Sweden, Belgium, Japan, Australia, China, India, Spain, Denmark, Austria, Norway
The IScript cDNA Synthesis Kit is a reagent kit used for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains all the necessary components to perform this reaction, including a reverse transcriptase enzyme, reaction buffer, and oligo(dT) primers.
10
Qiaprep spin miniprep kit by Qiagen
Sourced in Germany, United States, United Kingdom, Spain, Netherlands, Canada, Japan, France, Norway, China, Switzerland, Denmark, Australia, Italy
The QIAprep Spin Miniprep Kit is a laboratory product designed for the rapid and efficient purification of plasmid DNA from bacterial cultures. It is a versatile tool used in various molecular biology applications.

More about "Operon"

Operons are a fundamental unit of genetic organization found in prokaryotic organisms like bacteria and archaea.
These clusters of co-transcribed genes enable efficient regulation of related metabolic pathways or cellular processes, allowing microbes to rapidly adapt to environmental changes.
Understanding the structure and function of operons is crucial for unraveling the complex regulatory networks governing microbial physiology and behavior.
Researchers can leverage powerful AI-driven tools like PubCompare.ai to optimize their operon-related experiments.
This innovative protocol comparison platform helps scientists easily locate relevant experimental protocols from published literature, preprints, and patents.
By utilizing the AI's intelligent analysis, researchers can identify the most effective and reproducible approaches for their operon studies.
To further enhance their operon research, scientists may also employ techniques and reagents such as the RNeasy Mini Kit for RNA extraction, TRIzol reagent for RNA isolation, oligonucleotides for gene expression analysis, the QIAquick PCR Purification Kit for purifying amplified DNA, T4 DNA ligase for ligation reactions, the QIAquick Gel Extraction Kit for DNA fragment recovery, Superscript III for reverse transcription, the IScript cDNA synthesis kit for cDNA generation, and the QIAprep Spin Miniprep Kit for plasmid DNA purification.
These tools and techniques, combined with the power of PubCompare.ai, can help researchers optimize their operon-related experiments and gain deeper insights into the complex regulatory networks of prokaryotic organisms.
By leveraging the synergy between advanced AI-powered tools and established molecular biology techniques, scientists can unlock new discoveries and advance our understanding of the pivotal role operons play in microbial adaptability and survival.